IndraLab

Statements


USP30 affects AS1
| 338
| 336

sparser
"USP30-AS1 could suppress cell proliferation and metastasis of colon cancer via sponging miR-765."

sparser
"Based on six signature lncRNAs (LINC00899, LINC01503, PRKAG2-AS1, RAD21-AS1, SRRM2-AS1 and USP30-AS1), the risk score (RS) system was constructed."
| PMC

sparser
"To the best of our knowledge, the presented reported for the first time that PTP4A1 could be regulated by USP30-AS1 at the post-transcriptional level in cervical cancer."

sparser
"Utilizing The Cancer Genome Atlas (TCGA) database, it was revealed that USP30-AS1 was one of the most dysregulated lncRNAs in cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), suggesting that USP30-AS1 may exert important roles during cervical cancer progression."

sparser
"On the other hand, lncRNAs as NRIR, MIR155HG, U62317.2, USP30-AS1 and TNK2-AS1 contain a reduced number of RBPbinding sites (<2 CLIP sites per 1000 nucleotides), thus are likely involved in the activity of lncRNA-centered regulatory complexes[51,53]."
| DOI

sparser
"Thus, we conducted a stepwise Cox regression analysis of 37 lncRNAs with survival significance and finally obtained a gene combination ( xref , xref ) composed of seven lncRNAs (HLA-DQB1 antisense RNA 1 (HLA-DQB1-AS1), USP30 antisense RNA 1 (USP30-AS1), AL645929, AL365361, long intergenic nonprotein coding RNA 520 (LINC00520), LINC00324, and AC055822)."

sparser
"The prognostic value of USP30-AS1 in colon cancer."

sparser
"As the present study demonstrated that USP30-AS1 functions as a ceRNA to positively regulate PTP4A1 expression by sequestering miR-299-3p in cervical cancer, rescue experiments were performed to understand whether the tumour-promoting roles of USP30-AS1 were mediated by the miR-299-3p/PTP4A1 axis."

sparser
"While the elevated expression of miR-765 could attenuate the inhibitory effect of USP30-AS1 on the proliferation of colon cancer cells ( P < 0.01, Fig. xref C)."

sparser
"The expression levels of all im-lncRNAs were significantly higher in IH than IL samples (USP30-AS1 P = 1.12e-18 , HCP5 P = 8.07e-15 , PSMB8-AS1 P = 1.15e-15 , AL133264.2 P = 4.07e-10 , LINC01684 P = 1.50e-11 , and LINC01506 P = 3.00e-10 , xref )."
SOD2 binds USP30 and AS1. 1 / 1
| 1

sparser
"DEGs GenesUpregulated IRF7, MX2, CMPK2, TRIM25, OAS3, IFIT5, DDX60L, RSAD2, MX1, IFI16, ADAR, USP18, STAT1, PNPT1, TRIM14, OAS1, OAS2, XAF1, IFIT1, DHX58, DDX58, CMTR1, RTP4, PARP12, SP100, EPSTI1, IFIT2, PARP9, IFI35, HERC6, LAMP3, UBE2L6, SAMD9L, PLSCR1, HERC5, OASL, IFIT3, C19orf66, IFI44, TRANK1, SP110, HSH2D, DTX3L, ISG15, IFIH1, ZC3HAV1, PARP10, TRIM21, DDX60, PARP14, IFITM1, NMI, SLC25A28, ISG20, ETV7, STAT2, NLRC5, TRIM5, MYD88, TDRD7, SMCHD1, XRN1, TRIM22, PHF11, SAMD9, GTPBP2, RNF213, NT5C3A, LAP3, ZCCHC2, FAM46A, IFI44L, TREX1, SCO2, GTPBP1, PML, FBXO6, TOR1B, PLEKHA4, UBA7, AIM2, TNFSF10, TAP1, NUB1, GBP4, LMO2, MOV10, APOL6, TAPSAR1, GBP1, SCAMP1-AS1, STARD5, EIF2AK2, N4BP1, BST2, TYMP, IFITM3, IRF9, HELZ2, RNF19B, HLA-E, MOB3C, LGALS9, CNP, SPATS2L, ZNFX1, GMPR, OPTN, CXCL10, C5orf56, RBCK1, APOBEC3G, HDX, CSRNP1, SECTM1, PRKD2, PSMB8, FBXO39,TTC39B, PSMB9, WARS, IRF1, BATF2, TRIM38, LGALS17A, LY6E, IFI6, JAK2, CLEC7A, SAMHD1, SP140L, EXOC3L1, PI4K2B, NUPR1, SIDT1, PCGF5, IFNL3, CASP1, ACSL1, EHD4, CD68, TAP2, SLFN5, TLR3, LOC101927027, TRIB2, LIFR, GRIP2, ACE2, MASTL, BCL2L14, TRAFD1, PRICKLE4, APOL2, BCL3, GBP5, BTC, PIK3AP1, SLC15A3, NFE2L3, ZBP1, ZFYVE26, RASGRP3, TMEM140, ZC3H12A, KIAA1551, CTRL, MLKL, NFKBIA, LYSMD2, MAB21L2, GNB4, C17orf67, GBP1P1, DUOX2, PMAIP1, USP30-AS1, SOD2, CIITA, OGFR, LYPD5, APOBEC3A, IFNL1, AKAP7, ACKR4, TNFAIP3, RBMS2, HESX1, HTR2B, MXD1, IL4I1, BLZF1, DUOXA2, NCOA7, RBM11, HRASLS2, SUSD3, FGD2, CCL5, IFI27, TICAM1, CCDC109B, APOBEC3F, GCH1, IL22RA1, TNFSF13B, C19orf38, IKBKE, IFNL2, CASP10, LRRN2, PPM1K, CD7, APOL3, IRAK2, NFKBIZ, UBQLNL, C21orf91, IL7, HLA-F, CD38, RELB, GCNT4, RHBDF2, CX3CL1, CD83, TNFRSF6B, PPM1J, TAGAP, BTN3A3, TMEM229B, FFAR2, CARD16, SOCS1, STX11, OVOL1, IL19, BIRC3, GLRX, CPNE5, MAFF, CXorf49, CXorf49B, CEACAM1, SEC16B, PRDM1, ADCY4, ATF3, LINC00623, TLR2, IFITM2, NRG2, BBC3, SOCS3, KIAA0226, CXCL11, CXCL9, IL15RA, LAG3, STARD4, IDO1, SOCS2, ICOSLG, C1GALT1, FANCA, KCNQ4, NCF1, C10orf105, AP5B1, TMEM171, GBP2, HK2, BRIP1, RAB43, MUC13, IFI30, NCF1C, SP140, HAPLN3, ARID5A, SLC16A1, CD274, KLHDC7B, CACNA1A, CSF3, MAP2, CCL20, TMEM106A, SERPING1, TNFAIP2, CLCA3P, TNIP3, DLG2, CXCL8, MAPK8IP2, IL17C, PLAUR, NEURL3, PROX1, APOBEC3B, TNF, MB21D1, THEMIS2, FRMD3, HBEGF, BRCA2, DUXAP10, TMEM92, DUSP5, EXOC3L4, APOL4, C11orf82, RIMS2, C15orf48, C2CD4B, NOV, ADAM8, SLFN12, MICB, GBP3, GRIN3A, C1R, LOC102724163, SEMA3D, IL2RG, LOC645638, FGF2, FAM169B, LOC100294362, MT2A, ABCD1, ZNF618, LRRC3, SAA4, CYP21A1P, SLC26A4-AS1, SERPINB9, SERPINB9P1, BATF, LOC388692, TLDC2, IL36G, PRRX2, TGM1, ELOVL7, CXCL3, TNFRSF10A, RTKN2, CCL22, HDAC9, ATP10A, IL6, SBK1, BCL2A1, DOC2B, C2CD4A, C1S, ADM, HCG4B, PTPRH, HCAR3, PDCD1LG2, C8orf4, CXCL2, STS, RET, NOS2, SLC26A4, SLCO4A1, SELL, NTNG2, HLA-J, RND1, CFB, XDH, MMP13, TRIM31, SAA2, SPRR2A, PTGS2, MTNR1A, AKAP2, ACHE, DEFB4A, ICAM1, EREG, SPRR2F, CH25H, IL1RN, NEXN, CSF1, HSPA6, LOC554223, APOL1, SLAMF7, LIF, MEF2C, SSC5D, TGM2, ZDHHC14, CXCL13, ERAP2, ANGPTL4, SH2D1B, THSD1, PLA2G4E Downregulated C20orf195, FAM13C, HPX, INHBB, GPATCH11, PTGFR, PRR18, SLC16A14, SLC47A2 Differential expression of data between infection and control. (A) Differential expression of data between RVA and control; (B) Differential expression of data between RVC and control; (C) The intersection of RVA and RVC DEGs."
USP30 binds PSMB8 and AS1. 1 / 1
| 1

sparser
"An EMT-related lncRNA signature consisting of TTC28-AS1, LINC02446, AL662844.4, AC105942.1, AL049840.3, SNHG26, USP30-AS1, PSMB8-AS1, AL031775.1, AC073534.1, U62317.2, C5orf56, AJ271736.1, and AL139385.1 was constructed."
USP30 affects PRKN
| 32 1
USP30 inhibits PRKN.
| 20
USP30 inhibits PRKN. 10 / 22
| 18

reach
"Parkin mediated effects are further regulated by de-ubiquitinating enzymes, such as USP30 and USP35, which reportedly de-ubiquitinate Parkin substrates to antagonize mitophagy [24 *] or Parkin depende[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The regulation of USP30 activity is important, since hyperactivation of USP30 prevents Parkin from promoting removal of dysfunctional mitochondria (186, 187)."

reach
"Our findings provided further verification explaining the functions of Parkin and USP30 in mitophagy and cell senescence, demonstrating that USP30 knockdown could alleviate d-gal-induced mitochondrial damage, and d-gal-promoted myocardial cell senescence by increasing the activity of Parkin.In conclusion, the findings of the present study demonstrated that silencing USP30 upregulated Parkin, resulting in the stimulation of mitophagy and deceleration of myocardial cell senescence (Fig. 6)."

reach
"In contrast, a recent report demonstrated that in Drosophila the age dependent increase in mitophagy in both muscle and dopaminergic neurons is dependent on PINK1 and Parkin, and the knockdown of USP15 and USP30 rescues mitophagy in Parkin deficient organisms."

reach
"The E3 ligase Parkin ubiquitinates the membrane proteins on targeted mitochondria to initiate mitophagy, whereas USP30 antagonizes Parkin-dependent mitophagy by removing ubiquitin from Parkin substrates."

reach
"On one hand, overexpression of USP30 can block Parkin dependent accumulation of Ub chains on MOM proteins in response to depolarization, suggesting that USP30 directly antagonizes Parkin activity."

reach
"Strikingly USP30 knockdown invivo could rescue the PINK1 or Parkin -/- phenotypes in Drosophila, indicating that the inhibition of USP30 could be therapeutically advantageous in patients with equivalent null mutations in these genes [XREF_BIBR]."

reach
"Emerging promising molecules include selective inhibitor of the mitochondrial deubiquitinase, USP30 that negatively regulates PRKN-mediated mitophagy [132,200]."
| PMC

reach
"In this regard, USP15 and USP30 were found to antagonize Parkin activity by competing for the common substrates on OMM."

reach
"Parkin mediated effects are further regulated by de-ubiquitinating enzymes, such as USP30 and USP35, which reportedly de-ubiquitinate Parkin substrates to antagonize mitophagy [XREF_BIBR] or Parkin dependent cell death [XREF_BIBR]."
USP30 inhibits mutated PRKN. 2 / 2
| 2

reach
"Early studies on USP30 focused on reversal of Parkin dependent MOM ubiquitylation in HeLa cells overexpressing Parkin, as well as in Drosophila, where reduction in USP30 function enhanced the activity of Parkin mutants."

reach
"In addition, loss of USP30 can promote the activity of mutant Parkin alleles."
USP30 activates PRKN.
| 10
USP30 activates PRKN. 10 / 10
| 10

reach
"USP30 knockdown also increases the ubiquitination level on multiple Parkin substrates, thus confirming that USP30 antagonizes Parkin function."

reach
"Although SILAC provides a rigorous way for performing quantification, other studies used label-free quantification to examine targeted mitochondrial outer membrane ubiquitylation by PARKIN in the presence or absence of the mitochondrial deubiquitylating enzyme USP30, leading to the identification of a dozen mitochondrial PARKIN targets that are regulated by USP30 (see below)."

reach
"Nevertheless, deletion of USP30 from cells with endogenous Parkin only results in a modest effect on mitophagic flux, and Parkin can rapidly overcome USP30’s activity to allow maximal activation of the Parkin dependent mitophagy ."

reach
"More specifically, USP30 has been reported to mediate Parkin and PINK1-dependent mitophagy following the acute depolarization of the mitochondria [9] via the deubiquitylating Parkin substrates in the mitochondria [10]."

reach
"Knockdown of USP30 rescues the defective mitophagy caused by pathogenic mutations in parkin and improves mitochondrial integrity in parkin- or PINK1 deficient flies."

reach
"Silencing USP30 alleviates d-gal-induced mitochondrial damage and consequently suppresses myocardial cell senescence by activating Parkin."

reach
"Although SILAC provides a rigorous way for performing quantification, other studies used label-free quantification to examine targeted mitochondrial outer membrane ubiquitylation by PARKIN in the pres[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These results demonstrated that USP30 could promote d-gal-induced mitochondrial damage and cell senescence through antagonizing Parkin."

reach
"Knockdown of the Drosophila homologs of USP15 (CG8334, hereafter called dUSP15) and USP30 (CG3016, hereafter dUSP30) largely rescues the mitochondrial defects of parkin deficient fly muscle in vivo."

reach
"Knockdown of the mitochondrial deubiquitinase, USP30, rescues mitophagy defects and disease in flies with pathogenic mutations in Parkin, suggesting a potential role for the inhibition of DUBs that target selective autophagy E3 ligases in the treatment of Parkinson 's and other diseases."
USP30 deubiquitinates PRKN.
| 2
USP30 deubiquitinates PRKN. 2 / 2
| 2

reach
"Reciprocally, the dequbiquitination enzymes USP30 and USP35 have been shown to antagonize the mitophagy process by deubiquitinating Parkin [138,139]."

reach
"At present, the negative regulatory mechanisms against Parkin-mediated ubiquitination have been reported, with the discovery of several deubiquitinases including USP8, USP15 and USP30 that are able to cause the deubiquitination of Parkin and/or OMM proteins."
USP30 binds PRKN.
| 1
| 1

sparser
"Importantly, Parkin and USP30 assemble xref , xref or disassemble xref , xref , respectively, a similar set of ubiquitin linkages, sharing a preference for Lys6-linked chains."
PRKN affects USP30
1 | 9 7
PRKN ubiquitinates USP30.
1 | 3 6
PRKN ubiquitinates USP30. 10 / 11
1 | 3 6

reach
"Ubiquitination of USP30 by Parkin."

reach
"Parkin ubiquitinates USP30 in cells which may lead to its degradation XREF_BIBR."

sparser
"A study demonstrated that Parkin ubiquitinates USP30 both in vivo and in vitro ( xref )."

sparser
"Ubiquitination of USP30 by Parkin."

sparser
"Parkin ubiquitinates USP30 in cells which may lead to its degradation xref ."

reach
"Such is the case with USP30, which is monoubiquitinated at three sites near its substrate interaction domain by the E3 Parkin (183, 184, 185)."

sparser
"In cells, Parkin ubiquitinates the endogenous USP30 and leads to its proteasome-dependent degradation, as MG132 inhibition can rescue the USP30 level ( xref )."

sparser
"Interestingly, USP30 is actually a Parkin substrate, and Parkin-dependent ubiquitination of USP30 facilitates proteasome-dependent degradation of the protein so that this DUB is kept at low levels when active Parkin is required to promote mitophagy."

sparser
"In vitro reconstitution of USP30 ubiquitination by phosphorylated Parkin ( xref , xref ) revealed monoubiquitination on Lys235 and Lys289 at the tip of the fingers subdomain, and on Lys310 in the distal ubiquitin binding site ( xref , xref ), matching sites previously found in cells xref , xref ."
PRKN activates USP30.
| 3
PRKN activates USP30. 3 / 3
| 3

reach
"Whilst the phosphatase that dephosphorylates p-Ub remains unknown, two DUBs have been identified that deubiquitylate Parkin directed substrates, USP30 and USP15, and USP8 has also been reported to reverse Parkin autoubiquitylation."

reach
"Although SILAC provides a rigorous way for performing quantification, other studies used label-free quantification to examine targeted mitochondrial outer membrane ubiquitylation by PARKIN in the presence or absence of the mitochondrial deubiquitylating enzyme USP30, leading to the identification of a dozen mitochondrial PARKIN targets that are regulated by USP30 (see below)."

reach
"Although SILAC provides a rigorous way for performing quantification, other studies used label-free quantification to examine targeted mitochondrial outer membrane ubiquitylation by PARKIN in the pres[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
PRKN inhibits USP30.
| 2
PRKN inhibits USP30. 2 / 2
| 2

reach
"One potential explanation for no effect on the feed-forward process with overt depolarization is that activated Parkin rapidly inactivates USP30 or otherwise outpaces Ub removal by USP30, as previously proposed."

reach
"Bingol and colleagues first reported that USP30 antagonises Parkin mediated mitophagy [XREF_BIBR]."
PRKN decreases the amount of USP30.
| 1
PRKN decreases the amount of USP30. 1 / 1
| 1

reach
"RT-qPCR results indicated that the treatment of oe-Parkin increased Parkin expression and the treatment of sh-USP30 decreased the USP30 expression in the d-gal-induced rat aging model (Fig. 5A, B)."
PRKN binds USP30.
| 1
| 1

sparser
"Importantly, Parkin and USP30 assemble xref , xref or disassemble xref , xref , respectively, a similar set of ubiquitin linkages, sharing a preference for Lys6-linked chains."

reach
"USP30 negatively regulates mitophagy and promotes myocardial cell senescence through antagonism on Parkin."

reach
"In particular, pharmacological inhibition of USP30 induces a significant increase in cardiac mitophagy without detriment to cardiac function."

reach
"In cultured cells, including neurons, USP30 overexpression inhibits mitophagy, and this effect is not seen when a catalytically inactive mutant of USP30 is employed ."

reach
"It is well established that the USP30 dependent suppression of mitophagy may rely on over-expressed Parkin together with an overt depolarization ."

reach
"Current models invoke USP30 functioning under normal physiological conditions to prevent inappropriate mitophagy."

reach
"Deubiquitinating enzyme USP30 negatively regulates mitophagy and accelerates myocardial cell senescence through antagonism of Parkin."

reach
"Overall, our results demonstrate the pharmacological inhibition of USP30 by ST-539 modulates PINK1/Parkin dependent mitophagy, and efficiently induces cardiac mitophagy."

reach
"Pharmacological Inhibition of USP30 activates Tissue-specific Mitophagy."

reach
"Depletion of USP30 has been shown to promote mitochondrial elongation and mitophagy (Nakamura & Hirose, 2008)."

reach
"Furthermore, the knockdown of USP30 enhances mitophagy in cultured cells ."

reach
"Nevertheless, deletion of USP30 from cells with endogenous Parkin only results in a modest effect on mitophagic flux, and Parkin can rapidly overcome USP30’s activity to allow maximal activation of the Parkin dependent mitophagy ."

reach
"More specifically, USP30 has been reported to mediate Parkin and PINK1-dependent mitophagy following the acute depolarization of the mitochondria [9] via the deubiquitylating Parkin substrates in the mitochondria [10]."

reach
"A small molecule targeting USP30 acts to enhance cardiac mitophagy in vivo [132], although it is unclear why mitophagy was not induced in other tissues."
USP30 affects Ubiquitin
| 9 2
USP30 activates Ubiquitin.
| 4
| 4

reach
"USP30 mediates the removal of the ubiquitin chains added by Parkin."

reach
"The ubiquitin chains targeted by USP30 are similar to the ones Parkin adds to its substrates, suggesting that these two enzymes act as antagonists on shared substrates."

reach
"Thus, USP30 may enable a dynamic ubiquitin economy that is required for multiple core functions at these organelles, whilst preventing inadvertent engagement of the autophagy machinery."

reach
"Ubiquitin carboxyl-terminal hydrolase 30 (USP30) mediates the removal of the ubiquitin chains added by parkin to ubiquitilated forms of mitofusins, such as MFN2, therefore we analyzed the expression of this deubiquitinating enzyme tethered to the OMM and showed in CTNS−/− ciPTEC 62.9% decreasing compared to wild type cells (p < 0.001)."
USP30 inhibits Ubiquitin.
| 3
| 3

reach
"In the mammalian system, Usp30 deubiquitinase was shown to localize to mitochondria and antagonize the ubiquitin ligase Parkin-mediated mitophagy [63]."

reach
"The E3 ligase Parkin ubiquitinates the membrane proteins on targeted mitochondria to initiate mitophagy, whereas USP30 antagonizes Parkin-dependent mitophagy by removing ubiquitin from Parkin substrates."

reach
"The OMM localized DUB ubiquitin specific processing proteases USP30 and USP15 antagonize PARKIN activity by cleaving ubiquitin chains on mitochondria."
USP30 binds Ubiquitin.
| 2

sparser
"This explains complications with estimating USP30K M values for monoubiquitin substrates xref , xref , orK d values for the interaction between inactive USP30 and fluorescent ubiquitin ( xref , xref ); similar substrates bind other (inactive) USPs with nM to low µM affinities xref , xref ( xref )."

sparser
"The USP30 diubiquitin complex structure ( xref , xref ) explains this preferential binding, and reveals how the proximal ubiquitin interacts with USP30 in three areas ( xref ):"
USP30 phosphorylates Ubiquitin.
| 1
USP30 phosphorylates Ubiquitin. 1 / 1
| 1

reach
"USP30 has lower activity against phosphorylated ubiquitin linkages, therefore potentially acting upstream or independently of PINK1."
| PMC
USP30 dephosphorylates Ubiquitin.
| 1
USP30 leads to the dephosphorylation of Ubiquitin. 1 / 1
| 1

reach
"Importantly, USP30 inhibition enhanced ubiquitin phosphorylation and mitophagy even in the absence of Parkin, placing USP30 upstream of Parkin."
| PMC
USP30 affects TOMM20
1 | 4 4
USP30 binds TOMM20.
| 4
| 4

sparser
"Moreover, we found that USP30 associates with TOMM20 in iNeurons on the basis of co-immunoprecipitation analysis ( xref A), as previously found in HeLa cells ( xref )."

sparser
"Moreover, we found that USP30 associates with TOMM20 in iNeurons based on co-immunoprecipitation analysis ( xref ), as previously found in HeLa cells ( xref )."

sparser
"USP30 interacts directly with TOM20 (ref. xref ) and stabilises it during mitophagy induction xref , xref , while USP30 knockdown increases TOM20 Lys6-ubiquitination."

sparser
"We have previously shown that USP30 physically interacts with TOM20, a component of the OMM transport complex that recognises mitochondrial targeting sequences ( xref ; xref )."
USP30 deubiquitinates TOMM20.
1 | 2
USP30 leads to the deubiquitination of TOMM20. 2 / 2
1 | 1

reach
"USP30 depletion promotes ubiquitylation of TOM20 and depolarization‐induced cell death [19]."
Modified USP30 leads to the deubiquitination of TOMM20. 1 / 1
| 1

reach
"As expected, expression of WT USP30, but not a catalytically inactive mutant (C77A), reversed TOMM20 ubiquitylation, but did not affect MFN2 or CISD1 ubiquitylation (XREF_FIG, XREF_SUPPLEMENTARY)."
USP30 inhibits TOMM20.
| 1
USP30 inhibits TOMM20. 1 / 2
| 1

reach
"USP30 prevents TOM20 from being ubiquitylated by Parkin, and its absence increases depolarization-induced cell death in Parkin-overexpressing cells."
USP30 ubiquitinates TOMM20.
| 1
USP30 leads to the ubiquitination of TOMM20. 1 / 1
| 1

reach
"In this context, increased expression of USP30 blocked the accumulation of ubiquitinated TOM20 and prevented the destruction of this outer mitochondrial protein, as well as TOM40 and TIM23, after A/O treatment (Figure 1a)."
ST-539 affects USP30
| 4 7
ST-539 inhibits USP30.
| 4 6
ST-539 inhibits USP30. 10 / 10
| 4 6

reach
"Overall, our results demonstrate the pharmacological inhibition of USP30 by ST-539 modulates PINK1/Parkin dependent mitophagy, and efficiently induces cardiac mitophagy."

eidos
"Our study , both in vitro and in a mouse model , reports that ST-539 inhibits USP30 , effectively activating mitophagy in cells and in the heart ."

eidos
"Effects of USP30 inhibition on mitochondrial function We next investigated if the pharmacological inhibition of USP30 by ST-539 could influence mitochondrial functions ."

reach
"ST-539 inhibits USP30 and promotes mitophagy."

reach
"Additionally, the PK/PD and toxicity profiles of ST-539 should allow further preclinical assessment of USP30 inhibition as a therapeutic strategy for a wide variety of diseases."

eidos
"Overall , our results demonstrate the pharmacological inhibition of USP30 by ST-539 modulates PINK1 / Parkin dependent mitophagy , and efficiently induces cardiac mitophagy ."

reach
"Together the data imply that the pharmacological inhibition of USP30 by ST-539 marginally alters mitochondrial function, regardless of USP30 expression."

eidos
"Together the data imply that the pharmacological inhibition of USP30 by ST-539 marginally alters mitochondrial function , regardless of USP30 expression ."

reach
"Our study, both in vitro and in a mouse model, reports that ST-539 inhibits USP30, effectively activating mitophagy in cells and in the heart."

reach
"We next investigated if the pharmacological inhibition of USP30 by ST-539 could influence mitochondrial functions."
ST-539 activates USP30.
| 1
ST-539 activates USP30. 1 / 1
| 1

reach
"Interestingly, ST-539 treatment restored A/O induced mitophagy in HeLa-Parkin cells expressing USP30 (Figure 1d)."
USP30 is modified
| 1 9
USP30 is phosphorylated.
| 5
USP30 is phosphorylated. 5 / 5
| 5

sparser
"Moreover, IKKβ-induced USP30 phosphorylation and stabilization promote tumor growth and development in the dimethylnitrosamine (DEN)-/CCL4-induced model of HCC ( xref )."

sparser
"IKKβ phosphorylated and stabilized USP30, which promoted USP30 to deubiquitinate ATP citrate lyase (ACLY) and fatty acid synthase (FASN)."

sparser
"Firstly, USP30 was phosphorylated in human hepatocellular carcinoma (HCC)."

sparser
"USP30 hydrolyses phosphorylated ubiquitin-KG-TAMRA with ~8-fold lower efficiency ( xref , xref ), and phosphorylation of monoubiquitinated inactive USP30 consistently impaired deubiquitination by active USP30 ( xref , xref )."

sparser
"In HCC, the IκB kinase (IKKβ) phosphorylated and stabilized USP30, which promoted USP30 to deubiquitinate the critical lipogenesis-related enzyme-ATP citrate lyase (ACLY) ( xref ; xref ), and prompted the development of HCC ( xref )."
USP30 is ubiquitinated.
| 4
USP30 is ubiquitinated. 4 / 4
| 4

sparser
"Secondly, USP30 can be ubiquitinated by the mitochondria ubiquitin ligase Parkin ( xref )."

sparser
"In vitro reconstitution of USP30 ubiquitination by phosphorylated Parkin ( xref , xref ) revealed monoubiquitination on Lys235 and Lys289 at the tip of the fingers subdomain, and on Lys310 in the distal ubiquitin binding site ( xref , xref ), matching sites previously found in cells xref , xref ."

sparser
"In human cells, ubiquitinating and deubiquitinating enzymes March5 and USP30 were shown to act adjacent to the TOM translocase to determine if the precursor can continue its import [ xref ]."

sparser
"This suggests that USP30 activity is switched off in mitophagy, which could occur via Parkin-mediated USP30 ubiquitination xref ( xref )."
USP30 is degraded.
| 1
USP30 is degraded. 1 / 1
| 1

reach
"RT-qPCR results indicated that the treatment of oe-Parkin increased Parkin expression and the treatment of sh-USP30 decreased the USP30 expression in the d-gal-induced rat aging model (Fig. 5A, B)."
USP30 affects mitophagy
| 9
| 9

eidos
"Furthermore , the knockdown of USP30 enhances mitophagy in cultured cells21 ."

eidos
"In contrast , USP30 inhibits mitophagy by opposing parkin-mediated ubiquitination of target proteins ."

eidos
"The depletion of USP30 increases both pexophagy and mitophagy ."

eidos
"Importantly , USP30 inhibition enhanced ubiquitin phosphorylation and mitophagy even in the absence of Parkin , placing USP30 upstream of Parkin ."
| PMC

eidos
"Based on its influence on mitophagy , USP30 inhibitors have been developed to promote mitophagy as a potential therapeutic option for PD227 ,228 ."

eidos
"Inhibition of USP30 results in mitophagy and cellular clearance ."

eidos
"Much less understood are the inhibitors of USP30 and whether inhibiting USP30 will activate mitophagy in vivo ."

eidos
"Depletion of USP30 has been shown to promote mitochondrial elongation and mitophagy ( Nakamura & Hirose , 2008 ) ."

eidos
"Interestingly , recent studies have provided a comprehensive analysis of the impact of USP30 on mitochondrial ubiquitylation dynamics , establishing a model proposing that USP30 loss or inhibition may boost mitophagy by lowering the threshold of mitochondrial damage19 ,29,48 ."

sparser
"qRT-PCR results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were overexpressed and HOXB-AS1 was lowexpressed in MCF-7 and T-47D cell lines compared to HBL-100 cell line ( xref , P <0.05)."

sparser
"And we further verified that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were significantly increased and HOXB-AS1 was significantly decreased in breast cancer tissues and cells."

sparser
"The results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 expression were significantly increased and HOXB-AS1 expression was significantly decreased in breast cancer tissues compared with normal breast tissue ( xref , P <0.001)."

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."

sparser
"The result implies that PD-L1 was significantly associated with some FRlncRNAs, such as LINC02328, LINC01871, LMNTD2-AS1, LINC00702, LINC02384, AP001434.1, TRG-AS1, LIPE-AS1, HSD11B1-AS1, USP30-AS1, LINC02446, AC099329.2, PRKAR1B-AS1, and LINC02084."

sparser
"Using a web for RNA–Protein Interaction Prediction (), we analyzed whether there are potential interactions of USP30-AS1 with some PcG and TrxG proteins."

sparser
"Notably, USP30-AS1, HCP5, PSMB8-AS1, and LINC01506 were “IH-specific” lncRNAs, and AL133264.2, LINC01684 were “Constitutive” lncRNAs."
USP30 affects PINK1
| 6
USP30 inhibits PINK1.
| 4
USP30 inhibits PINK1. 4 / 4
| 4

reach
"Our data showing that USP30 suppresses a PINK1 dependent component of basal mitophagy indicate a link between USP30 function and phospho-ubiquitin, the key substrate of PINK1 in mitophagy."

reach
"One model consistent with this observation envisages that by suppressing basal ubiquitylation at mitochondria, USP30 may effectively limit PINK1 ubiquitin-substrate availability and the generation of pUb ' Parkin-receptor sites ', thus primarily influencing the initiation phase of mitophagy 86."

reach
"Strikingly USP30 knockdown invivo could rescue the PINK1 or Parkin -/- phenotypes in Drosophila, indicating that the inhibition of USP30 could be therapeutically advantageous in patients with equivalent null mutations in these genes [XREF_BIBR]."

reach
"Here we report that USP30, a deubiquitinase localized to mitochondria, antagonizes mitophagy driven by the ubiquitin ligase parkin (also known as PARK2) and protein kinase PINK1, which are encoded by two genes associated with Parkinson 's disease."
USP30 activates PINK1.
| 2
USP30 activates PINK1. 2 / 2
| 2

reach
"Knockdown of USP30 rescues the defective mitophagy caused by pathogenic mutations in parkin and improves mitochondrial integrity in parkin- or PINK1 deficient flies."

reach
"More specifically, USP30 has been reported to mediate Parkin and PINK1-dependent mitophagy following the acute depolarization of the mitochondria [9] via the deubiquitylating Parkin substrates in the mitochondria [10]."
ASH2L affects USP30
| 6
ASH2L increases the amount of USP30.
| 2
ASH2L increases the amount of USP30. 2 / 2
| 2

reach
"As indicated by PCR, the knockdown of ASH2L decreased USP30 and ANKRD13A expression (***p < 0.001) and impaired the promoting effect of overexpressed USP30-AS1 on USP30 and ANKRD13A expression (Fig. 8E)."

reach
"The overexpression of ASH2L increased USP30 and ANKRD13A expression (***p < 0.001) and attenuated the reduction USP30 and ANKRD13A after USP30-AS1 knockdown."
ASH2L activates USP30.
| 2
ASH2L activates USP30. 2 / 2
| 2

reach
"Overexpression of ASH2L partially restored the enrichment of USP30 and ANKRD13A promoters in H3K4me3 protein after USP30-AS1 knockdown (Fig. 8F)."

reach
"ASH2L knockdown dramatically decreased the enrichment of USP30 and ANKRD13A promoters in despite USP30-AS1 overexpression."
ASH2L inhibits USP30.
| 1
ASH2L inhibits USP30. 1 / 1
| 1

reach
"The overexpression of ASH2L increased USP30 and ANKRD13A expression (***p < 0.001) and attenuated the reduction USP30 and ANKRD13A after USP30-AS1 knockdown."
ASH2L decreases the amount of USP30.
| 1
ASH2L decreases the amount of USP30. 1 / 1
| 1

reach
"As indicated by PCR, the knockdown of ASH2L decreased USP30 and ANKRD13A expression (***p < 0.001) and impaired the promoting effect of overexpressed USP30-AS1 on USP30 and ANKRD13A expression (Fig. 8E)."
USP30 affects cell death
| 5
USP30 inhibits cell death.
| 4
| 4

reach
"Parkin mediated effects are further regulated by de-ubiquitinating enzymes, such as USP30 and USP35, which reportedly de-ubiquitinate Parkin substrates to antagonize mitophagy [24 *] or Parkin depende[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"In addition, overexpressing USP30, a mitochondrial deubiquitinase, attenuated cell death induced by Rot, but not by DA treated cells."

reach
"USP30 deubiquitylates mitochondrial Parkin substrates and restricts apoptotic cell death."

reach
"In contrast, direct siRNA mediated depletion of MIRO2 to comparable residual levels marginally decreased PARP cleavage, whilst a combined knockdown of USP30 and MIRO2 promoted cell death in a similar fashion to USP30 siRNA on its own (XREF_SUPPLEMENTARY)."
USP30 activates cell death.
| 1
| 1

reach
"Cell death promoted by USP30 depletion upon treatment with ABT-737 was partially suppressed by BAX knockdown but required concomitant depletion of both BAK and BAX for full suppression (Fig XREF_FIG D and E)."
USP30 affects ACLY
| 3 1 1
USP30 binds ACLY.
| 1 1 1
| 1 1

sparser
"IKKβ also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter's deubiquitination."

reach
"IKKbeta also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter 's deubiquitination."
ACLY binds USP30. 1 / 1
| 1

isi
"IKKbeta also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter's deubiquitination."
USP30 deubiquitinates ACLY.
| 1
USP30 deubiquitinates ACLY. 1 / 1
| 1

reach
"In addition, IKKβ-phosphorylated ACLY binds to IKKβ-phosphorylated and stabilized ubiquitin-specific protease–30 (USP30), which deubiquitinates and stabilizes ACLY in HCC cells (Gu et al., 2020)."
USP30 activates ACLY.
| 1
USP30 activates ACLY. 1 / 1
| 1

reach
"USP30 promotes stabilization of dynamin-related protein 1 (DRP1) or ATP citrate lyase (ACLY), resulting in accelerated development of hepatocellular carcinoma [17, 18]."
TOMM20 affects USP30
| 4
| 4

sparser
"Moreover, we found that USP30 associates with TOMM20 in iNeurons on the basis of co-immunoprecipitation analysis ( xref A), as previously found in HeLa cells ( xref )."

sparser
"Moreover, we found that USP30 associates with TOMM20 in iNeurons based on co-immunoprecipitation analysis ( xref ), as previously found in HeLa cells ( xref )."

sparser
"USP30 interacts directly with TOM20 (ref. xref ) and stabilises it during mitophagy induction xref , xref , while USP30 knockdown increases TOM20 Lys6-ubiquitination."

sparser
"We have previously shown that USP30 physically interacts with TOM20, a component of the OMM transport complex that recognises mitochondrial targeting sequences ( xref ; xref )."
4 |
Valproic acid increases the amount of USP30.
3 |
Valproic acid increases the amount of USP30. 3 / 3
3 |

No evidence text available

No evidence text available

No evidence text available
Valproic acid decreases the amount of USP30.
1 |
Valproic acid decreases the amount of USP30. 1 / 1
1 |

No evidence text available
| 4
| 2

reach
"However, USP30 overexpression antagonizes the activity of Parkin to sustain AKT/mTOR activity and inhibit apoptosis."

reach
"These results indicate that inhibition of USP30 sensitizes cancer cells to aumdubin-induced apoptosis in lung cancer cells."
| 2

reach
"Additionally, we found that USP30 deficiency effectively suppressed oxidative stress and neuronal apoptosis in TBI."

reach
"Knockdown of USP30 could induce the mitochondrial apoptosis pathway [XREF_BIBR]."
USP30 affects UBD
| 2 2
USP30 binds UBD.
| 1 2
| 1 1

reach
"Indeed, fluorescently labelled Lys6 linked diubiquitin binds inactive USP30 with a K d of ~ 4 microM, while other chain types show poor or no binding in the concentration range assessed (up to 60 microM diubiquitin) (XREF_FIG, XREF_SUPPLEMENTARY)."

sparser
"Indeed, fluorescently labelled Lys6-linked diubiquitin binds inactive USP30 with aK d of ~4 µM, while other chain types show poor or no binding in the concentration range assessed (up to 60 µM diubiquitin) ( xref , xref )."
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
USP30 inhibits UBD.
| 1
USP30 inhibits UBD. 1 / 1
| 1

reach
"As expected, Cys and His mutations abrogate USP30 activity, while Ser mutation to Ala, but also to Asn or Asp, that are usually found in USP DUBs XREF_BIBR, reduce activity in both mono- and diubiquitin based substrate cleavage assays (XREF_FIG, XREF_SUPPLEMENTARY)."
USP30 affects OMM proteins
| 4
USP30 deubiquitinates OMM proteins.
| 3
USP30 deubiquitinates OMM proteins. 3 / 3
| 3

reach
"Previous results from cell culture experiments and flies suggest that USP30 can deubiquitylate OMM proteins and antagonize Parkin’s activity ."

reach
"Recent advances have demonstrated that USP30 can counteract Parkin-dependent mitophagy by deubiquitylating OMM proteins, including TOMM20 ."

reach
"At present, the negative regulatory mechanisms against Parkin-mediated ubiquitination have been reported, with the discovery of several deubiquitinases including USP8, USP15 and USP30 that are able to cause the deubiquitination of Parkin and/or OMM proteins."
USP30 ubiquitinates OMM proteins.
| 1
USP30 leads to the ubiquitination of OMM proteins. 1 / 1
| 1

reach
"Parkin mediated ubiquitination of OMM proteins can be reversed by USP15 and USP30."
USP30 affects NLRP3
| 2 2
USP30 binds NLRP3.
| 1 2
| 1 2

sparser
"The interaction between USP30 and NLRP3 was verified by co-immunoprecipitation and ubiquitination assays."

reach
"The interaction between USP30 and NLRP3 was verified by co-immunoprecipitation and ubiquitination assays."

sparser
"Finally, we show that inhibition of USP30 via MF-094 treatment facilitated wound healing in diabetic rats and resulted in decreased protein levels of NLRP3 and its downstream target caspase-1 p20, thus establishing the physiological importance of the identified USP30-NLRP3 link."
USP30 deubiquitinates NLRP3.
| 1
USP30 deubiquitinates NLRP3. 1 / 1
| 1

reach
"Mechanistically, we demonstrate that USP30 activates the NLRP3 inflammasome by deubiquitinating NLRP3."
USP30 affects Aging
| 4
USP30 activates Aging. 4 / 4
| 4

reach
"Deubiquitinating enzyme USP30 negatively regulates mitophagy and accelerates myocardial cell senescence through antagonism of Parkin."

reach
"USP30 negatively regulates mitophagy and promotes myocardial cell senescence through antagonism on Parkin."

reach
"These results demonstrated that USP30 could promote d-gal-induced mitochondrial damage and cell senescence through antagonizing Parkin."

reach
"Silencing USP30 alleviates d-gal-induced mitochondrial damage and consequently suppresses myocardial cell senescence by activating Parkin."
Trisulfur affects USP30
| 3
Trisulfur inhibits USP30.
| 2
| 2

reach
"It will be of interest to elucidate if S3 can also abolish the USP30 dependent downregulation of mitophagy in Parkinson 's disease."

reach
"The inhibition of USP30 by S3 leads to an increase of non degradative ubiquitination of Mfn1/2, which enhances Mfn1 and Mfn2 activity and promotes mitochondrial fusion."
Trisulfur activates USP30.
| 1
| 1

reach
"S3 can target deubiquitinase USP30 in mitochondria, an isopeptidase that regulates mitochondrial morphology by deubiquitination of MFN1 and MFN2."
Monoubiquitin affects USP30
| 2 1
USP30 binds Lys6 and monoubiquitin. 2 / 2
| 2

reach
"Here we report crystal structures of human USP30 bound to monoubiquitin and Lys6 linked diubiquitin, which explain how USP30 achieves Lys6-linkage preference through unique ubiquitin binding interfaces."

reach
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
Aumdubin affects USP30
| 3
Aumdubin inhibits USP30. 3 / 3
| 3

reach
"Taken together, these results indicate that aumdubin inhibits DUBs, including mitochondrial USP30, in lung cancer cells."

reach
"Furthermore, we found that aumdubin was able to inhibit USP30, a mitochondrial outer membrane DUB."

reach
"Consistently, aumdubin inhibits the DUB activity of purified USP30 in a dose-dependent manner (Fig. 1H)."
Ubiquitin affects USP30
| 2

sparser
"This explains complications with estimating USP30K M values for monoubiquitin substrates xref , xref , orK d values for the interaction between inactive USP30 and fluorescent ubiquitin ( xref , xref ); similar substrates bind other (inactive) USPs with nM to low µM affinities xref , xref ( xref )."

sparser
"The USP30 diubiquitin complex structure ( xref , xref ) explains this preferential binding, and reveals how the proximal ubiquitin interacts with USP30 in three areas ( xref ):"
USP30-AS1 affects USP30
| 3
USP30-AS1 increases the amount of USP30.
| 2
USP30-AS1 increases the amount of USP30. 2 / 2
| 2

reach
"USP30-AS1 increases the expression of USP30 and ANKRD13A through a cis mechanism."

reach
"The previous tests confirmed that USP30-AS1 positively regulates the expression of USP30 and ANKRD13A."
USP30-AS1 activates USP30.
| 1
USP30-AS1 activates USP30. 1 / 1
| 1

reach
"Similar to USP30-AS1, overexpression of a fragment of USP30-AS1 (250–550 bp) also increased the enrichment of USP30 and ANKRD13A promoters in H3K4me3 protein (*p < 0.05)."
USP30 affects monoubiquitin
| 2 1
USP30 binds Lys6 and monoubiquitin. 2 / 2
| 2

reach
"Here we report crystal structures of human USP30 bound to monoubiquitin and Lys6 linked diubiquitin, which explain how USP30 achieves Lys6-linkage preference through unique ubiquitin binding interfaces."

reach
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
USP30 affects TFAP2A
| 3

sparser
"qRT-PCR results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were overexpressed and HOXB-AS1 was lowexpressed in MCF-7 and T-47D cell lines compared to HBL-100 cell line ( xref , P <0.05)."

sparser
"And we further verified that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were significantly increased and HOXB-AS1 was significantly decreased in breast cancer tissues and cells."

sparser
"The results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 expression were significantly increased and HOXB-AS1 expression was significantly decreased in breast cancer tissues compared with normal breast tissue ( xref , P <0.001)."
USP30 affects PEX2
| 3
USP30 inhibits PEX2. 3 / 3
| 3

reach
"We demonstrate that USP30 prevents pexophagy by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2."

reach
"Overexpression of USP30 prevents pexophagy during amino acid starvation, by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2 [266, 267]."

reach
"Overexpression of USP30 prevents pexophagy during amino acid starvation, by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2 XREF_BIBR, XREF_BIBR."
USP30 affects MFN2
1 | 2
USP30 ubiquitinates MFN2.
| 1
USP30 leads to the ubiquitination of MFN2. 1 / 1
| 1

reach
"USP30 overexpression suppresses OGDR induced ubiquitination and degradation of MFN2, and protects against mitochondrial fragmentation."
USP30 inhibits MFN2.
| 1
USP30 inhibits MFN2. 1 / 1
| 1

reach
"S3 induced inhibition of USP30, a mitochondrial localized deubiquitinase, increased the ubiqutinylation of MFN1 and MFN2 without affecting their protein levels."
USP30 deubiquitinates MFN2.
1 |
USP30 deubiquitinates MFN2. 1 / 1
1 |

"USP30, a mitochondrial deubiquitinase, promotes mitochondrial fusion by mediating the deubiquitination of ubiquitylated forms of mitofusins, such as Mfn1 and Mfn2."
USP30 affects MFN1
1 | 2
USP30 inhibits MFN1.
| 2
USP30 inhibits MFN1. 2 / 2
| 2

reach
"S3 induced inhibition of USP30, a mitochondrial localized deubiquitinase, increased the ubiqutinylation of MFN1 and MFN2 without affecting their protein levels."

reach
"For example, based on a phenotypic screening, it was shown that the inhibition of USP30 by the compound 15-oxospiramilactone enhances the activity of USP30 's targets Mfn1 and Mfn2 -- two GTPases anchored at the OMM and essential for tethering adjacent mitochondria -- and promotes mitochondrial fusion, thus contributing to the restoration of the mitochondria network [XREF_BIBR]."
USP30 deubiquitinates MFN1.
1 |
USP30 deubiquitinates MFN1. 1 / 1
1 |

"USP30, a mitochondrial deubiquitinase, promotes mitochondrial fusion by mediating the deubiquitination of ubiquitylated forms of mitofusins, such as Mfn1 and Mfn2."
| 3
| 3

reach
"Overexpression of USP30 prevents pexophagy during amino acid starvation, by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2 XREF_BIBR, XREF_BIBR."

reach
"Overexpression of USP30 prevents pexophagy during amino acid starvation, by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2 [266, 267]."

reach
"We demonstrate that USP30 prevents pexophagy by counteracting the action of the peroxisomal E3 ubiquitin ligase PEX2."
USP30 affects BAX
| 3
USP30 binds BAX.
| 2
| 2

reach
"Moreover, we found interaction between Bax and USP30, as well as aumdubin-increased ubiquitination and mitochondrial location of Bax."

reach
"As shown in Fig. 6A, B, endogenous USP30, but not other DUBs such as proteasomal USP14 and mitochondrial USP15, was detected in the Bax affinity-isolation precipitates of A549 and H1299 cells, indicating that USP30 can specifically bind with Bax."
USP30 deubiquitinates BAX.
| 1
USP30 leads to the deubiquitination of BAX. 1 / 1
| 1

reach
"A plausible explanation is that USP30 is the DUB of Bax, and USP30 inhibition-mediated Bax ubiquitination induces the translocation of pro-apoptotic Bax on the mitochondria."
UBD affects USP30
| 1 2
| 1 1

reach
"Indeed, fluorescently labelled Lys6 linked diubiquitin binds inactive USP30 with a K d of ~ 4 microM, while other chain types show poor or no binding in the concentration range assessed (up to 60 microM diubiquitin) (XREF_FIG, XREF_SUPPLEMENTARY)."

sparser
"Indeed, fluorescently labelled Lys6-linked diubiquitin binds inactive USP30 with aK d of ~4 µM, while other chain types show poor or no binding in the concentration range assessed (up to 60 µM diubiquitin) ( xref , xref )."
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
TFAP2A affects USP30
| 3

sparser
"qRT-PCR results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were overexpressed and HOXB-AS1 was lowexpressed in MCF-7 and T-47D cell lines compared to HBL-100 cell line ( xref , P <0.05)."

sparser
"And we further verified that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were significantly increased and HOXB-AS1 was significantly decreased in breast cancer tissues and cells."

sparser
"The results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 expression were significantly increased and HOXB-AS1 expression was significantly decreased in breast cancer tissues compared with normal breast tissue ( xref , P <0.001)."
NLRP3 affects USP30
| 1 2
| 1 2

sparser
"The interaction between USP30 and NLRP3 was verified by co-immunoprecipitation and ubiquitination assays."

reach
"The interaction between USP30 and NLRP3 was verified by co-immunoprecipitation and ubiquitination assays."

sparser
"Finally, we show that inhibition of USP30 via MF-094 treatment facilitated wound healing in diabetic rats and resulted in decreased protein levels of NLRP3 and its downstream target caspase-1 p20, thus establishing the physiological importance of the identified USP30-NLRP3 link."
IKBKB affects USP30
| 2 1
IKBKB phosphorylates USP30. 2 / 2
| 2

sparser
"IKKβ phosphorylated and stabilized USP30, which promoted USP30 to deubiquitinate ATP citrate lyase (ACLY) and fatty acid synthase (FASN)."

sparser
"Further study found that USP30 was directly phosphorylated on Ser210 and Ser364 sites by IKKβ, facilitating the stabilization of the USP30 ( xref )."
IKBKB phosphorylates USP30. 1 / 1
| 1

isi
"IKKbeta phosphorylated and stabilized USP30, which promoted USP30 to deubiquitinate ATP citrate lyase (ACLY) and fatty acid synthase (FASN)."

sparser
"qRT-PCR results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were overexpressed and HOXB-AS1 was lowexpressed in MCF-7 and T-47D cell lines compared to HBL-100 cell line ( xref , P <0.05)."

sparser
"And we further verified that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 were significantly increased and HOXB-AS1 was significantly decreased in breast cancer tissues and cells."

sparser
"The results showed that USP30-AS1, TFAP2A-AS1, MAPT-AS1, and LINC01087 expression were significantly increased and HOXB-AS1 expression was significantly decreased in breast cancer tissues compared with normal breast tissue ( xref , P <0.001)."
ACLY affects USP30
| 1 1 1
| 1 1

sparser
"IKKβ also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter's deubiquitination."

reach
"IKKbeta also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter 's deubiquitination."
ACLY binds USP30. 1 / 1
| 1

isi
"IKKbeta also directly phosphorylated ACLY and facilitated the interaction between USP30 and ACLY and the latter's deubiquitination."
Small interfering RNA increases the amount of USP30. 2 / 2
| 2

sparser
"The consequence of USP30 inhibition by these compounds, siRNA knockdown and overexpression of dominant-negative USP30 on the mitophagy pathway in different disease-relevant cellular models was explored."

sparser
"The consequence of USP30 inhibition by these compounds, siRNA knockdown and overexpression of dominant-negative USP30 in the mitophagy pathway in different disease-relevant cellular models was explored."
Paracetamol affects USP30
2 |
Paracetamol decreases the amount of USP30. 2 / 2
2 |

No evidence text available

No evidence text available
Monoubiquitin affects Lys6
| 2
USP30 binds Lys6 and monoubiquitin. 2 / 2
| 2

reach
"Here we report crystal structures of human USP30 bound to monoubiquitin and Lys6 linked diubiquitin, which explain how USP30 achieves Lys6-linkage preference through unique ubiquitin binding interfaces."

reach
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
2 |
Cyclosporin A decreases the amount of USP30. 2 / 2
2 |

No evidence text available

No evidence text available
Bisphenol A affects USP30
2 |
Bisphenol A increases the amount of USP30. 2 / 2
2 |

No evidence text available

No evidence text available
AtpD affects USP30
| 2
| 1

sparser
"Ubiquitinated intramitochondrial proteins including ATPB lead to the reduction of the TOM (translocase of the outer membrane) complex in USP30‐knockdown cells. xref Therefore, we performed co‐IP assays to determine whether FABP4 affects the interaction between ATPB and March5 or USP30."
| 1

sparser
"Expectedly, FABP4 upregulation markedly blocked the binding of USP30 to ATPB, while had no effects on the level of March5 (Figure xref ), indicating that FABP4 accelerates ATPB ubiquitination by blocking the interaction of ATPB with USP30."
2 |
Aflatoxin B1 increases the amount of USP30.
1 |
Aflatoxin B1 increases the amount of USP30. 1 / 1
1 |

No evidence text available
Aflatoxin B1 decreases the amount of USP30.
1 |
Aflatoxin B1 decreases the amount of USP30. 1 / 1
1 |

No evidence text available
VCP affects USP30
| 1 1
| 1 1

sparser
"In addition, we found that p97 interacts with USP30, an OMM-associated deubiquitinating protein (Nakamura and Hirose, xref ), as well as Mfn1 (a substrate of p97-dependent degradation, as detailed above) (data not shown), further connecting p97 with the OMM."

reach
"In addition, we found that p97 interacts with USP30, an OMM associated deubiquitinating protein, as well as Mfn1 (a substrate of p97 dependent degradation, as detailed above) (data not shown), further connecting p97 with the OMM."
USP30 increases the amount of reactive oxygen species. 2 / 2
| 2

reach
"In this regard, we further observed that co-depletion of STK38 and USP30 was sufficient to fully restore total mitochondrial mass and mitochondrial ROS levels to normal values as observed in control cells."

reach
"Even more importantly, depletion of USP30, a major opponent of PINK1 and Parkin mediated mitophagy [XREF_BIBR, XREF_BIBR], partially restored soft agar growth, and fully restored total mitochondrial mass and ROS levels of STK38 depleted Ras transformed cells."
USP30 affects pexophagy
| 1 1
USP30 inhibits pexophagy.
| 1
| 1

eidos
"The depletion of USP30 increases both pexophagy and mitophagy ."
USP30 activates pexophagy.
| 1
| 1

reach
"We show that this pathway is distinct from pexophagy induced by the USP30 deubiquitylase inhibitor CMPD-39, for which we identify the adaptor NBR1 as a central player."

reach
"In diethylnitrosamine (DEN)/CCl -induced liver tumors in mice, USP30 deletion attenuated lipogenesis, inflammation, and tumor growth (Gu et al., 2020)."

reach
"In HCCs arising in DEN and CCl 4 -treated mice, USP30 deletion attenuated lipogenesis, inflammation and tumorigenesis irrespective of diet."
USP30 affects atpD
| 2
| 1

sparser
"Ubiquitinated intramitochondrial proteins including ATPB lead to the reduction of the TOM (translocase of the outer membrane) complex in USP30‐knockdown cells. xref Therefore, we performed co‐IP assays to determine whether FABP4 affects the interaction between ATPB and March5 or USP30."
| 1

sparser
"Expectedly, FABP4 upregulation markedly blocked the binding of USP30 to ATPB, while had no effects on the level of March5 (Figure xref ), indicating that FABP4 accelerates ATPB ubiquitination by blocking the interaction of ATPB with USP30."
USP30 affects VCP
| 1 1
| 1 1

sparser
"In addition, we found that p97 interacts with USP30, an OMM-associated deubiquitinating protein (Nakamura and Hirose, xref ), as well as Mfn1 (a substrate of p97-dependent degradation, as detailed above) (data not shown), further connecting p97 with the OMM."

reach
"In addition, we found that p97 interacts with USP30, an OMM associated deubiquitinating protein, as well as Mfn1 (a substrate of p97 dependent degradation, as detailed above) (data not shown), further connecting p97 with the OMM."
USP30 affects Protein 3a
| 2

sparser
"Viral ORF-3a is theorized to localize to ubiquitin-specific protease-30 (USP30), which is typically involved in mitochondrial fission/fusion and mitophagy; and the sequence of ORF-3a that interacts with USP30 has been found in SARS-CoV-2 ."

sparser
"Viral ORF-3a is theorized to localize to ubiquitin-specific protease-30 (USP30), which is typically involved in mitochondrial fission/fusion and mitophagy; and the sequence of ORF-3a that interacts with USP30 has been found in SARS-CoV-2 (Singh et al., 2020)."
USP30 affects PolgammaA
| 2
USP30 deubiquitinates PolgammaA. 2 / 2
| 2

reach
"In both the conditions, USP30 could deubiquitylate PolgammaA (XREF_SUPPLEMENTARY)."

reach
"For example, while we observe that USP30 deubiquitylates PolgammaA in vitro, its expression in asynchronously growing cells does not rescue MITOL dependent decrease in the level PolgammaA nor alter the extent of PolgammaA ubiquitylation."
USP30 affects POMK
2 |
2 |

No evidence text available

No evidence text available
USP30 affects MARCHF5
| 1 1
USP30 deubiquitinates MARCHF5.
| 1
USP30 deubiquitinates MARCHF5. 1 / 1
| 1

reach
"We wanted to test whether USP30 could deubiquitylate MITOL mediated ubiquitylation on PolgammaA."
USP30 binds MARCHF5.
| 1
| 1

sparser
"Ubiquitinated intramitochondrial proteins including ATPB lead to the reduction of the TOM (translocase of the outer membrane) complex in USP30‐knockdown cells. xref Therefore, we performed co‐IP assays to determine whether FABP4 affects the interaction between ATPB and March5 or USP30."
USP30 affects Lys6
| 2
USP30 binds Lys6 and monoubiquitin. 2 / 2
| 2

reach
"Here we report crystal structures of human USP30 bound to monoubiquitin and Lys6 linked diubiquitin, which explain how USP30 achieves Lys6-linkage preference through unique ubiquitin binding interfaces."

reach
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
USP30 affects H3K27Ac
| 2
USP30 activates H3K27Ac. 2 / 2
| 2

reach
"The results showed that in USP30-AS1 (KD) cells, the enrichment of USP30 and ANKRD13A promoters in H3K4me3 and H3K27Ac proteins significantly reduced."

reach
"In the USP30-AS1 (OE) group of cells, the enrichment of the USP30 and ANKRD13A promoters in the H3K27Ac protein was significantly increased (*p < 0.05, Fig. 7C)."
USP30 affects Flag
| 2
| 2

sparser
"To determine whether overexpression of USP30, a deubiquitinase localized to mitochondria, also protects against OGDR induced mitochondrial fragmentation, after transfected with USP30-Flag(200ng or 500ng) and Mito-GFP plasmids for 36 h, SK-N-BE(2) cells were subjected to OGD 4 h plus 4 h reperfusion ( xref )."

sparser
"To further analyze the role of USP30 in the regulation of ubiquitination and expression of MFN2 after OGDR insult, we transfected SK-N-BE(2) cells with USP30-Flag plasmids to increase USP30 expression."
USP30 affects EXOSC7
2 |
2 |

No evidence text available

No evidence text available
USP30 affects DNM1L
| 2
USP30 deubiquitinates DNM1L.
| 1
USP30 deubiquitinates DNM1L. 1 / 1
| 1

reach
"Mechanistically, GNPAT recruited the enzyme USP30, which deubiquitylated and stabilized dynamin related protein 1 (DRP1), thereby facilitating regulation of mitochondrial morphology, lipid metabolism, and hepatocarcinogenesis."
USP30 activates DNM1L.
| 1
USP30 activates DNM1L. 1 / 1
| 1

reach
"USP30 promotes stabilization of dynamin-related protein 1 (DRP1) or ATP citrate lyase (ACLY), resulting in accelerated development of hepatocellular carcinoma [17, 18]."
USP30 affects C1QB
2 |
2 |

No evidence text available

No evidence text available
Protein 3a affects USP30
| 2

sparser
"Viral ORF-3a is theorized to localize to ubiquitin-specific protease-30 (USP30), which is typically involved in mitochondrial fission/fusion and mitophagy; and the sequence of ORF-3a that interacts with USP30 has been found in SARS-CoV-2 ."

sparser
"Viral ORF-3a is theorized to localize to ubiquitin-specific protease-30 (USP30), which is typically involved in mitochondrial fission/fusion and mitophagy; and the sequence of ORF-3a that interacts with USP30 has been found in SARS-CoV-2 (Singh et al., 2020)."
POMK affects USP30
2 |
2 |

No evidence text available

No evidence text available
Lys6 affects monoubiquitin
| 2
USP30 binds Lys6 and monoubiquitin. 2 / 2
| 2

reach
"Here we report crystal structures of human USP30 bound to monoubiquitin and Lys6 linked diubiquitin, which explain how USP30 achieves Lys6-linkage preference through unique ubiquitin binding interfaces."

reach
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
IKB affects USP30
| 2
IKB phosphorylates USP30.
| 1
IKB phosphorylates USP30. 1 / 1
| 1

sparser
"In HCC, the IκB kinase (IKKβ) phosphorylated and stabilized USP30, which promoted USP30 to deubiquitinate the critical lipogenesis-related enzyme-ATP citrate lyase (ACLY) ( xref ; xref ), and prompted the development of HCC ( xref )."
IKB binds USP30.
| 1
| 1

sparser
"Co-immunoprecipitation experiments conducted in HepG2 cell lines verified that the IκB kinase β (IKKβ) interacts with USP30 ( xref )."
Flag affects USP30
| 2
| 2

sparser
"To determine whether overexpression of USP30, a deubiquitinase localized to mitochondria, also protects against OGDR induced mitochondrial fragmentation, after transfected with USP30-Flag(200ng or 500ng) and Mito-GFP plasmids for 36 h, SK-N-BE(2) cells were subjected to OGD 4 h plus 4 h reperfusion ( xref )."

sparser
"To further analyze the role of USP30 in the regulation of ubiquitination and expression of MFN2 after OGDR insult, we transfected SK-N-BE(2) cells with USP30-Flag plasmids to increase USP30 expression."
EXOSC7 affects USP30
2 |
2 |

No evidence text available

No evidence text available
C1QB affects USP30
2 |
2 |

No evidence text available

No evidence text available
BAX affects USP30
| 2
| 2

reach
"Moreover, we found interaction between Bax and USP30, as well as aumdubin-increased ubiquitination and mitochondrial location of Bax."

reach
"As shown in Fig. 6A, B, endogenous USP30, but not other DUBs such as proteasomal USP14 and mitochondrial USP15, was detected in the Bax affinity-isolation precipitates of A549 and H1299 cells, indicating that USP30 can specifically bind with Bax."
Vinclozolin affects USP30
1 |
Vinclozolin decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Urethane affects USP30
1 |
Urethane decreases the amount of USP30. 1 / 1
1 |

No evidence text available
1 |
Trichostatin A increases the amount of USP30. 1 / 1
1 |

No evidence text available
Topotecan affects USP30
1 |
Topotecan decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Pyrrolidine affects USP30
| 1
| 1

reach
"Recently, Rusilowicz-Jones et al. reported a N-cyano pyrrolidine derivative (FT3967385) inhibited USP30 with an IC 50 of 1.5 nM and, whilst it showed some off-target inhibition of USP6, enhanced mitophagy in cultured neuroblastoma cells [XREF_BIBR]."

sparser
"Using a web for RNA–Protein Interaction Prediction (), we analyzed whether there are potential interactions of USP30-AS1 with some PcG and TrxG proteins."
Oxaliplatin affects USP30
1 |
Oxaliplatin decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Oe-USP30 affects USP30
| 1
Oe-USP30 increases the amount of USP30. 1 / 1
| 1

reach
"Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) results revealed that the introduction of oe-USP30 increased USP30 expression, while the introduction of sh-USP30 decreased its expression (Fig. 4A), among which sh-USP30 revealed superior interfering effects compared to sh-USP30-1 and sh-USP30-2 (Supplementary Fig. 2)."
Oe-Parkin affects USP30
| 1
Oe-Parkin decreases the amount of USP30. 1 / 1
| 1

reach
"RT-qPCR results indicated that the treatment of oe-Parkin increased Parkin expression and the treatment of sh-USP30 decreased the USP30 expression in the d-gal-induced rat aging model (Fig. 5A, B)."
Nickel atom affects USP30
1 |
Nickel atom decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Monoubiquitin affects UBD
| 1
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
Methyl methanesulfonate increases the amount of USP30. 1 / 1
1 |

No evidence text available
1 |
Methamphetamine decreases the amount of USP30. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-877-5p decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Hsa-miR-484 affects USP30
1 |
Hsa-miR-484 decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Glyphosate affects USP30
1 |
1 |

No evidence text available
Ethyl methanesulfonate increases the amount of USP30. 1 / 1
1 |

No evidence text available
Ethanol affects USP30
| 1
Ethanol activates USP30. 1 / 1
| 1

reach
"Quercetin administration markedly attenuated the unfavorable changes of Parkin, Usp30 and VDAC1 induced by ethanol."
Doxorubicin affects USP30
1 |
Doxorubicin decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Detailed cell biological characterization benzosulphonamide molecule affects USP30
| 1
Detailed cell biological characterization benzosulphonamide molecule inhibits USP30. 1 / 1
| 1

eidos
"We provide a detailed cell biological characterization of a benzosulphonamide molecule , compound 39 , that has previously been reported to inhibit USP30 in an in vitro enzymatic assay ."
1 |
Deoxynivalenol increases the amount of USP30. 1 / 1
1 |

No evidence text available
Decabromodiphenyl ether increases the amount of USP30. 1 / 1
1 |

No evidence text available
Copper(II) sulfate increases the amount of USP30. 1 / 1
1 |

No evidence text available
1 |
Benzo[a]pyrene decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Atrazine affects USP30
1 |
Atrazine increases the amount of USP30. 1 / 1
1 |

No evidence text available
AtpD affects MARCHF5
| 1
| 1

sparser
"Ubiquitinated intramitochondrial proteins including ATPB lead to the reduction of the TOM (translocase of the outer membrane) complex in USP30‐knockdown cells. xref Therefore, we performed co‐IP assays to determine whether FABP4 affects the interaction between ATPB and March5 or USP30."
Antithrombin affects USP30
| 1
USP30 binds antithrombin. 1 / 1
| 1

reach
"We found that USP2, but not USP30, binds to antithrombin, although identification of the domains required for USP2-antithrombin interaction will have to await future studies."
Analogue formyl group attached nitrogen atom indole ring affects USP30
| 1
Analogue formyl group attached nitrogen atom indole ring activates USP30. 1 / 1
| 1

eidos
"It was found that the Trp analogue with a formyl group attached to the nitrogen atom of indole ring led to improved activity of USP30 likely due to enhanced polar interactions , and that another Trp analogue , 3-benzothienyl-L-alanine , induced a unique K6-specificity ."
Abrine affects USP30
1 |
Abrine increases the amount of USP30. 1 / 1
1 |

No evidence text available
VPS9D1 affects USP30
| 1

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."
USP30 affects viability migration HSF2 cells
| 1
USP30 inhibits viability migration HSF2 cells. 1 / 1
| 1

eidos
"Functionally , downregulation of USP30 via shRNA-mediated knockdown or treatment with the USP30 inhibitor MF-094 , restored viability and migration of AGE-treated HSF2 cells ."
USP30 affects ubiquitylation subset Parkin substrates
| 1
USP30 inhibits ubiquitylation subset Parkin substrates. 1 / 1
| 1

eidos
"Previous studies demonstrated that USP30 can reverse ubiquitylation of a subset of Parkin substrates or completely removal of ubiquitin chains ( Bingol et al ., 2014 ; Cunningham et al ., 2015 ; Gersch et al ., 2017 ; Ordureau et al ., 2014 ; Sato et al ., 2017 ) ."
USP30 affects ubiquitination Parkin substrates
| 1
USP30 inhibits ubiquitination Parkin substrates. 1 / 1
| 1

eidos
"USP30 knockdown also increases the ubiquitination level on multiple Parkin substrates , thus confirming that USP30 antagonizes Parkin function ."
USP30 affects ubiquitin-KG-TAMRA
| 1
USP30 phosphorylates ubiquitin-KG-TAMRA. 1 / 1
| 1

reach
"USP30 hydrolyses phosphorylated ubiquitin-KG-TAMRA with ~ 8-fold lower efficiency (XREF_FIG, XREF_SUPPLEMENTARY), and phosphorylation of monoubiquitinated inactive USP30 consistently impaired deubiquitination by active USP30 (XREF_FIG, XREF_SUPPLEMENTARY)."
USP30 affects ubiquitin phosphorylation
| 1
USP30 inhibits ubiquitin phosphorylation. 1 / 1
| 1

eidos
"Importantly , USP30 inhibition enhanced ubiquitin phosphorylation and mitophagy even in the absence of Parkin , placing USP30 upstream of Parkin ."
| PMC
USP30 affects subsequent mitophagy
| 1
USP30 inhibits subsequent mitophagy. 1 / 1
| 1

eidos
"For instance , Ubiquitin-specific protease 30 ( USP30 ) removes ubiquin attached by Parkin to the OMM substrates , attenuating subsequent mitophagy ."
USP30 affects stress-induced basal mitophagy
| 1
USP30 inhibits stress-induced basal mitophagy. 1 / 1
| 1

eidos
"Loss of USP30 enhances both stress-induced and basal mitophagy ."
| PMC
USP30 affects stability ACLY
| 1
USP30 activates stability ACLY. 1 / 1
| 1

eidos
"However , USP13 and USP30 can mediate deubiquitination of ACLY , increasing the stability of ACLY to promote development of ovarian cancer and hepatocellular carcinoma , respectively [ 271 , 279 ] ."
| PMC
USP30 affects sgRNA1
| 1
USP30 activates sgRNA1. 1 / 1
| 1

reach
"USP30 knockout cells were generated using CRISPR-Cas9 technology with either one of two USP30 specific sgRNAs targeting exon 3 of isoform 1 (sgRNA1 : AGTTCACCTCCCAGTACTCC, sgRNA2 : GTCTGCCTGTCCTGCTTTCA)."
USP30 affects removal ubiquitin chains
| 1
USP30 inhibits removal ubiquitin chains. 1 / 1
| 1

eidos
"Previous studies demonstrated that USP30 can reverse ubiquitylation of a subset of Parkin substrates or completely removal of ubiquitin chains ( Bingol et al ., 2014 ; Cunningham et al ., 2015 ; Gersch et al ., 2017 ; Ordureau et al ., 2014 ; Sato et al ., 2017 ) ."
USP30 affects removal ubiquitin chains added parkin ubiquitilated mitofusins
| 1
USP30 activates removal ubiquitin chains added parkin ubiquitilated mitofusins. 1 / 1
| 1

eidos
"Ubiquitin carboxyl-terminal hydrolase 30 ( USP30 ) mediates the removal of the ubiquitin chains added by parkin to ubiquitilated forms of mitofusins , such as MFN2 , therefore we analyzed the expression of this deubiquitinating enzyme tethered to the OMM and showed in CTNS - / - ciPTEC 62.9 % decreasing compared to wild type cells ( p < 0.001 ) ."
USP30 affects proteolysis
| 1
| 1

reach
"USP30, a mitochondrial deubiquitinase, counterbalances Parkin activity to prevent mitochondrial protein degradation and mitophagy [25]."
USP30 affects protein NLRP3 downstream target caspase-1 p20
| 1
USP30 activates protein NLRP3 downstream target caspase-1 p20. 1 / 1
| 1

eidos
"Finally , we show that inhibition of USP30 via MF-094 treatment facilitated wound healing in diabetic rats and resulted in decreased protein levels of NLRP3 and its downstream target caspase-1 p20 , thus establishing the physiological importance of the identified USP30-NLRP3 link ."

sparser
"Using a web for RNA–Protein Interaction Prediction (), we analyzed whether there are potential interactions of USP30-AS1 with some PcG and TrxG proteins."
USP30 affects pUb
| 1
USP30 inhibits pUb. 1 / 1
| 1

reach
"One model consistent with this observation envisages that by suppressing basal ubiquitylation at mitochondria, USP30 may effectively limit PINK1 ubiquitin-substrate availability and the generation of pUb ' Parkin-receptor sites ', thus primarily influencing the initiation phase of mitophagy 86."
USP30 affects pS65-Ub accumulation
| 1
USP30 inhibits pS65-Ub accumulation. 1 / 1
| 1

eidos
"However , at sub-threshold levels of depolarization , the absence of USP30 results in a modest acceleration in pS65-Ub accumulation and rate of PINK1-dependent mitophagic flux , as measured using new genetically encoded flux reporters in iNeurons ."
| 1

reach
"In utero knockdown of USP1, USP4, and USP20 in the mouse cerebellum disrupts granule neuron morphogenesis, while knockdown of USP30 and USP33 disrupts granule neuron migration (79)."
USP30 affects mutant Parkin alleles
| 1
USP30 inhibits mutant Parkin alleles. 1 / 1
| 1

eidos
"In addition , loss of USP30 can promote the activity of mutant Parkin alleles ( Bingol et al ., 2014 ) ."
USP30 affects mitophagy flux
| 1
USP30 inhibits mitophagy flux. 1 / 1
| 1

eidos
"This is in line with a model proposing that USP30 inhibition would be helpful to boost mitophagy flux , by lowering the threshold of damage needed to initiate Parkin activation and the feed-forward system ."
USP30 affects mitochondrial morphology [
| 1
USP30 inhibits mitochondrial morphology [. 1 / 1
| 1

reach
"The modification of the Mitofusins is reversed by USP30, thereby regulating mitochondrial morphology [XREF_BIBR, XREF_BIBR]."
USP30 affects mitochondrial elongation
| 1
USP30 inhibits mitochondrial elongation. 1 / 1
| 1

eidos
"Depletion of USP30 has been shown to promote mitochondrial elongation and mitophagy ( Nakamura & Hirose , 2008 ) ."
USP30 affects maximal activation Parkin dependent mitophagy19
| 1
USP30 activates maximal activation Parkin dependent mitophagy19. 1 / 1
| 1

eidos
"Nevertheless , deletion of USP30 from cells with endogenous Parkin only results in a modest effect on mitophagic flux , and Parkin can rapidly overcome USP30 's activity to allow maximal activation of the Parkin dependent mitophagy19 ."
USP30 affects marketed drugs
| 1
USP30 inhibits marketed drugs. 1 / 1
| 1

eidos
"Target validation could pave the way for discovering and developing USP30 inhibitors that could ultimately lead to marketed drugs ."

reach
"In diethylnitrosamine (DEN)/CCl -induced liver tumors in mice, USP30 deletion attenuated lipogenesis, inflammation, and tumor growth (Gu et al., 2020)."
USP30 affects isoform 1
| 1
USP30 inhibits isoform 1. 1 / 1
| 1

reach
"USP30 knockout cells were generated using CRISPR-Cas9 technology with either one of two USP30 specific sgRNAs targeting exon 3 of isoform 1 (sgRNA1 : AGTTCACCTCCCAGTACTCC, sgRNA2 : GTCTGCCTGTCCTGCTTTCA)."

reach
"Beyond Deubiquitylation : USP30 Mediated Regulation of Mitochondrial Homeostasis."
USP30 affects dopamine
| 1
| 1

reach
"RNAi mediated knockdown of USP30 specifically in dopaminergic neurons via the dopamine decarboxylase driver completely rescued the paraquat induced behavioral deficit and prevented dopamine depletion [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP30 affects deubiquitination ACLY
| 1
USP30 activates deubiquitination ACLY. 1 / 1
| 1

eidos
"However , USP13 and USP30 can mediate deubiquitination of ACLY , increasing the stability of ACLY to promote development of ovarian cancer and hepatocellular carcinoma , respectively [ 271 , 279 ] ."
| PMC
USP30 affects destruction outer mitochondrial protein
| 1
USP30 inhibits destruction outer mitochondrial protein. 1 / 1
| 1

eidos
"In this context , increased expression of USP30 blocked the accumulation of ubiquitinated TOM20 and prevented the destruction of this outer mitochondrial protein , as well as TOM40 and TIM23 , after A / O treatment ( Figure 1a ) ."
USP30 affects components
| 1
USP30 ubiquitinates components. 1 / 1
| 1

sparser
"The improved coverage now also reveals USP30-dependent ubiquitylation of multiple TOM complex components, including the two translocase receptors, TOM20 and TOM70, the TOM40 channel and an accessory subunit TOM5 within this set of strong outliers."
USP30 affects cellular clearance
| 1
USP30 inhibits cellular clearance. 1 / 1
| 1

eidos
"Inhibition of USP30 results in mitophagy and cellular clearance ."
USP30 affects cardiac mitophagy
| 1
USP30 inhibits cardiac mitophagy. 1 / 1
| 1

eidos
"Overall , our results demonstrate the pharmacological inhibition of USP30 by ST-539 modulates PINK1 / Parkin dependent mitophagy , and efficiently induces cardiac mitophagy ."
USP30 affects cancer-promoting USP30-AS1
| 1
USP30 activates cancer-promoting USP30-AS1. 1 / 1
| 1

eidos
"Knockdown of USP30 , but not ANKRD13A , abolished the cancer-promoting effects of USP30-AS1 ."
USP30 affects autophagy
| 1
| 1

reach
"The mitochondrial deubiquitylase USP30 negatively regulates the selective autophagy of damaged mitochondria."
USP30 affects antithrombin
| 1
USP30 binds antithrombin. 1 / 1
| 1

reach
"We found that USP2, but not USP30, binds to antithrombin, although identification of the domains required for USP2-antithrombin interaction will have to await future studies."
USP30 affects accumulation ubiquitinated TOM20
| 1
USP30 inhibits accumulation ubiquitinated TOM20. 1 / 1
| 1

eidos
"In this context , increased expression of USP30 blocked the accumulation of ubiquitinated TOM20 and prevented the destruction of this outer mitochondrial protein , as well as TOM40 and TIM23 , after A / O treatment ( Figure 1a ) ."
USP30 affects VPS9D1
| 1

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."
USP30 affects VDAC1
1 |
USP30 deubiquitinates VDAC1. 1 / 1
1 |
USP30 affects Ub chains
| 1
USP30 inhibits Ub chains. 1 / 1
| 1

reach
"On one hand, overexpression of USP30 can block Parkin dependent accumulation of Ub chains on MOM proteins in response to depolarization, suggesting that USP30 directly antagonizes Parkin activity."
USP30 affects USP30
| 1
USP30 inhibits USP30. 1 / 1
| 1

reach
"The overexpression of ASH2L increased USP30 and ANKRD13A expression (***p < 0.001) and attenuated the reduction USP30 and ANKRD13A after USP30-AS1 knockdown."
USP30 affects UPS30-AS1
| 1
USP30 increases the amount of UPS30-AS1. 1 / 1
| 1

reach
"In addition, overexpression of USP30 abrogated the regulatory effect of UPS30-AS1 knockdown on apoptosis in KG-1 cells; knockdown of USP30 abrogated the regulatory effect of UPS30-AS1 overexpression on apoptosis in HL-60 cells (Fig. 5B)."
USP30 affects UPS30-AS1 knockdown
| 1
USP30 activates UPS30-AS1 knockdown. 1 / 1
| 1

reach
"In addition, overexpression of USP30 abrogated the regulatory effect of UPS30-AS1 knockdown on apoptosis in KG-1 cells; knockdown of USP30 abrogated the regulatory effect of UPS30-AS1 overexpression on apoptosis in HL-60 cells (Fig. 5B)."
USP30 affects UCHL1
| 1
USP30 activates UCHL1. 1 / 1
| 1

reach
"Structure of a USP20 inhibitor from GSK.Figure 29 Structure of a USP30 inhibitor.Structures of UCHL1 inhibitors.VAE(OMe)-FMK Structure of a weak tripeptide FMK UCHL1 inhibitor.Figure 33 Structures of UCHL3 inhibitors.Structures of TRABID and RPN11 inhibitors."
USP30 affects UBC
1 |
1 |

No evidence text available
USP30 affects TOMM70
1 |
USP30 deubiquitinates TOMM70. 1 / 1
1 |

"Similar findings were reported for another DUB: USP30. USP30 overexpression impaired PARKIN-mediated mitophagy by deubiquitinating mitochondrial substrates that include TOM20, TOM70, and the VDACs"
USP30 affects TOMM40
| 1
USP30 inhibits TOMM40. 1 / 1
| 1

reach
"In this context, increased expression of USP30 blocked the accumulation of ubiquitinated TOM20 and prevented the destruction of this outer mitochondrial protein, as well as TOM40 and TIM23, after A/O treatment (Figure 1a)."
USP30 affects TOM complex components
| 1
USP30 deubiquitinates TOM complex components. 1 / 1
| 1

reach
"USP30 deubiquitylation of TOM complex components dampens the trigger for the Parkin dependent amplification of mitochondrial ubiquitylation leading to mitophagy."
USP30 affects TIMM8A
1 |
1 |

No evidence text available
USP30 affects TIMM23
| 1
USP30 inhibits TIMM23. 1 / 1
| 1

reach
"In this context, increased expression of USP30 blocked the accumulation of ubiquitinated TOM20 and prevented the destruction of this outer mitochondrial protein, as well as TOM40 and TIM23, after A/O treatment (Figure 1a)."
USP30 affects TBI
| 1
USP30 activates TBI. 1 / 1
| 1

reach
"Additionally, we found that USP30 deficiency effectively suppressed oxidative stress and neuronal apoptosis in TBI."
USP30 affects STK38
| 1
USP30 activates STK38. 1 / 1
| 1

reach
"In this regard, we speculated that USP30 depletion might compensate for STK38 deficiency, hence restoring anchorage independent growth of STK38 depleted Ras transformed cells."
USP30 affects ST7
| 1

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."
USP30 affects SS18L1
1 |
1 |

No evidence text available
USP30 affects SOD2
| 1
SOD2 binds USP30 and AS1. 1 / 1
| 1

sparser
"DEGs GenesUpregulated IRF7, MX2, CMPK2, TRIM25, OAS3, IFIT5, DDX60L, RSAD2, MX1, IFI16, ADAR, USP18, STAT1, PNPT1, TRIM14, OAS1, OAS2, XAF1, IFIT1, DHX58, DDX58, CMTR1, RTP4, PARP12, SP100, EPSTI1, IFIT2, PARP9, IFI35, HERC6, LAMP3, UBE2L6, SAMD9L, PLSCR1, HERC5, OASL, IFIT3, C19orf66, IFI44, TRANK1, SP110, HSH2D, DTX3L, ISG15, IFIH1, ZC3HAV1, PARP10, TRIM21, DDX60, PARP14, IFITM1, NMI, SLC25A28, ISG20, ETV7, STAT2, NLRC5, TRIM5, MYD88, TDRD7, SMCHD1, XRN1, TRIM22, PHF11, SAMD9, GTPBP2, RNF213, NT5C3A, LAP3, ZCCHC2, FAM46A, IFI44L, TREX1, SCO2, GTPBP1, PML, FBXO6, TOR1B, PLEKHA4, UBA7, AIM2, TNFSF10, TAP1, NUB1, GBP4, LMO2, MOV10, APOL6, TAPSAR1, GBP1, SCAMP1-AS1, STARD5, EIF2AK2, N4BP1, BST2, TYMP, IFITM3, IRF9, HELZ2, RNF19B, HLA-E, MOB3C, LGALS9, CNP, SPATS2L, ZNFX1, GMPR, OPTN, CXCL10, C5orf56, RBCK1, APOBEC3G, HDX, CSRNP1, SECTM1, PRKD2, PSMB8, FBXO39,TTC39B, PSMB9, WARS, IRF1, BATF2, TRIM38, LGALS17A, LY6E, IFI6, JAK2, CLEC7A, SAMHD1, SP140L, EXOC3L1, PI4K2B, NUPR1, SIDT1, PCGF5, IFNL3, CASP1, ACSL1, EHD4, CD68, TAP2, SLFN5, TLR3, LOC101927027, TRIB2, LIFR, GRIP2, ACE2, MASTL, BCL2L14, TRAFD1, PRICKLE4, APOL2, BCL3, GBP5, BTC, PIK3AP1, SLC15A3, NFE2L3, ZBP1, ZFYVE26, RASGRP3, TMEM140, ZC3H12A, KIAA1551, CTRL, MLKL, NFKBIA, LYSMD2, MAB21L2, GNB4, C17orf67, GBP1P1, DUOX2, PMAIP1, USP30-AS1, SOD2, CIITA, OGFR, LYPD5, APOBEC3A, IFNL1, AKAP7, ACKR4, TNFAIP3, RBMS2, HESX1, HTR2B, MXD1, IL4I1, BLZF1, DUOXA2, NCOA7, RBM11, HRASLS2, SUSD3, FGD2, CCL5, IFI27, TICAM1, CCDC109B, APOBEC3F, GCH1, IL22RA1, TNFSF13B, C19orf38, IKBKE, IFNL2, CASP10, LRRN2, PPM1K, CD7, APOL3, IRAK2, NFKBIZ, UBQLNL, C21orf91, IL7, HLA-F, CD38, RELB, GCNT4, RHBDF2, CX3CL1, CD83, TNFRSF6B, PPM1J, TAGAP, BTN3A3, TMEM229B, FFAR2, CARD16, SOCS1, STX11, OVOL1, IL19, BIRC3, GLRX, CPNE5, MAFF, CXorf49, CXorf49B, CEACAM1, SEC16B, PRDM1, ADCY4, ATF3, LINC00623, TLR2, IFITM2, NRG2, BBC3, SOCS3, KIAA0226, CXCL11, CXCL9, IL15RA, LAG3, STARD4, IDO1, SOCS2, ICOSLG, C1GALT1, FANCA, KCNQ4, NCF1, C10orf105, AP5B1, TMEM171, GBP2, HK2, BRIP1, RAB43, MUC13, IFI30, NCF1C, SP140, HAPLN3, ARID5A, SLC16A1, CD274, KLHDC7B, CACNA1A, CSF3, MAP2, CCL20, TMEM106A, SERPING1, TNFAIP2, CLCA3P, TNIP3, DLG2, CXCL8, MAPK8IP2, IL17C, PLAUR, NEURL3, PROX1, APOBEC3B, TNF, MB21D1, THEMIS2, FRMD3, HBEGF, BRCA2, DUXAP10, TMEM92, DUSP5, EXOC3L4, APOL4, C11orf82, RIMS2, C15orf48, C2CD4B, NOV, ADAM8, SLFN12, MICB, GBP3, GRIN3A, C1R, LOC102724163, SEMA3D, IL2RG, LOC645638, FGF2, FAM169B, LOC100294362, MT2A, ABCD1, ZNF618, LRRC3, SAA4, CYP21A1P, SLC26A4-AS1, SERPINB9, SERPINB9P1, BATF, LOC388692, TLDC2, IL36G, PRRX2, TGM1, ELOVL7, CXCL3, TNFRSF10A, RTKN2, CCL22, HDAC9, ATP10A, IL6, SBK1, BCL2A1, DOC2B, C2CD4A, C1S, ADM, HCG4B, PTPRH, HCAR3, PDCD1LG2, C8orf4, CXCL2, STS, RET, NOS2, SLC26A4, SLCO4A1, SELL, NTNG2, HLA-J, RND1, CFB, XDH, MMP13, TRIM31, SAA2, SPRR2A, PTGS2, MTNR1A, AKAP2, ACHE, DEFB4A, ICAM1, EREG, SPRR2F, CH25H, IL1RN, NEXN, CSF1, HSPA6, LOC554223, APOL1, SLAMF7, LIF, MEF2C, SSC5D, TGM2, ZDHHC14, CXCL13, ERAP2, ANGPTL4, SH2D1B, THSD1, PLA2G4E Downregulated C20orf195, FAM13C, HPX, INHBB, GPATCH11, PTGFR, PRR18, SLC16A14, SLC47A2 Differential expression of data between infection and control. (A) Differential expression of data between RVA and control; (B) Differential expression of data between RVC and control; (C) The intersection of RVA and RVC DEGs."
USP30 affects SF3A1
1 |
1 |

No evidence text available
USP30 affects SCN3B
1 |
1 |

No evidence text available
USP30 affects RHOT1
1 |
USP30 deubiquitinates RHOT1. 1 / 1
1 |

No evidence text available
USP30 affects RFTN2
1 |
1 |

No evidence text available
USP30 affects QKI
1 |
1 |

No evidence text available
USP30 affects Parkin-dependent ubiquitylation several proteins associated translocon
| 1
USP30 inhibits Parkin-dependent ubiquitylation several proteins associated translocon. 1 / 1
| 1

eidos
"In iNeurons , while loss of USP30 promoted Parkin-dependent ubiquitylation of several proteins associated with the translocon , the majority of ubiquitylation events were unaffected ."
USP30 affects PVR
1 |
1 |

No evidence text available
USP30 affects PTPN6
| 1

sparser
"Notably, USP30-AS1, HCP5, PSMB8-AS1, and LINC01506 were “IH-specific” lncRNAs, and AL133264.2, LINC01684 were “Constitutive” lncRNAs."
USP30 affects PSMB8
| 1
USP30 binds PSMB8 and AS1. 1 / 1
| 1

sparser
"An EMT-related lncRNA signature consisting of TTC28-AS1, LINC02446, AL662844.4, AC105942.1, AL049840.3, SNHG26, USP30-AS1, PSMB8-AS1, AL031775.1, AC073534.1, U62317.2, C5orf56, AJ271736.1, and AL139385.1 was constructed."
USP30 affects PLA2G10
1 |
1 |

No evidence text available
USP30 affects PINK1-dependent mitophagic flux
| 1
USP30 inhibits PINK1-dependent mitophagic flux. 1 / 1
| 1

eidos
"However , at sub-threshold levels of depolarization , the absence of USP30 results in a modest acceleration in pS65-Ub accumulation and rate of PINK1-dependent mitophagic flux , as measured using new genetically encoded flux reporters in iNeurons ."
USP30 affects PINK1 dependent mitophagy
| 1
USP30 inhibits PINK1 dependent mitophagy. 1 / 1
| 1

eidos
"Overall , our results demonstrate the pharmacological inhibition of USP30 by ST-539 modulates PINK1 / Parkin dependent mitophagy , and efficiently induces cardiac mitophagy ."
USP30 affects PCDHGB1
1 |
1 |

No evidence text available
USP30 affects PCDHB11
1 |
1 |

No evidence text available
USP30 affects PARP1
| 1
USP30 decreases the amount of PARP1. 1 / 1
| 1

reach
"Indeed, knockdown of USP30 by using siRNA increased the levels of PARP cleavage in aumdubin-treated A549 and H1299 cells (Fig. 5C, D)."
USP30 affects PARKIN feed-forward activation mechanism
| 1
USP30 inhibits PARKIN feed-forward activation mechanism. 1 / 1
| 1

eidos
"However , whether USP30 also comprises specificity at the level of primary ubiquitylation sites in MOM substrates , and the extent to which USP30 activity suppresses the PARKIN feed-forward activation mechanism via pS65-Ub has not been examined in more physiological systems such as neurons ."
USP30 affects PACC1
1 |
1 |

No evidence text available
USP30 affects P2RX5
1 |
1 |

No evidence text available
USP30 affects Neoplasms
| 1
| 1

reach
"In diethylnitrosamine (DEN)/CCl -induced liver tumors in mice, USP30 deletion attenuated lipogenesis, inflammation, and tumor growth (Gu et al., 2020)."
USP30 affects NLRP3 inflammasome
| 1
USP30 activates NLRP3 inflammasome. 1 / 1
| 1

eidos
"Mechanistically , we demonstrate that USP30 activates the NLRP3 inflammasome by deubiquitinating NLRP3 ."
USP30 affects MPPE1
1 |
1 |

No evidence text available
USP30 affects MPND
1 |
1 |

No evidence text available
USP30 affects LRFN4
1 |
1 |

No evidence text available
USP30 affects KRT7
| 1

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."
USP30 affects IKB
| 1
| 1

sparser
"Co-immunoprecipitation experiments conducted in HepG2 cell lines verified that the IκB kinase β (IKKβ) interacts with USP30 ( xref )."
USP30 affects HSD11B1
| 1

sparser
"The result implies that PD-L1 was significantly associated with some FRlncRNAs, such as LINC02328, LINC01871, LMNTD2-AS1, LINC00702, LINC02384, AP001434.1, TRG-AS1, LIPE-AS1, HSD11B1-AS1, USP30-AS1, LINC02446, AC099329.2, PRKAR1B-AS1, and LINC02084."
USP30 affects H3K4Me3
| 1
USP30 activates H3K4Me3. 1 / 1
| 1

reach
"The results showed that in USP30-AS1 (KD) cells, the enrichment of USP30 and ANKRD13A promoters in H3K4me3 and H3K27Ac proteins significantly reduced."
USP30 affects GRPR
1 |
1 |

No evidence text available
USP30 affects FASN
| 1
USP30 increases the amount of FASN. 1 / 1
| 1

reach
"We, therefore, screened a panel of DUBs by transfecting the cDNA plasmids of 36 DUBs into 293T cells, and found USP2, USP14, USP22, and USP30 upregulated FASN levels (Fig. S2A)."
USP30 affects FAM126A
| 1
USP30 deubiquitinates FAM126A. 1 / 1
| 1

reach
"In addition, IKKβ-phosphorylated ACLY binds to IKKβ-phosphorylated and stabilized ubiquitin-specific protease–30 (USP30), which deubiquitinates and stabilizes ACLY in HCC cells (Gu et al., 2020)."
USP30 affects EXT2
1 |
1 |

No evidence text available
USP30 affects E3-ubiquitin ligases
| 1
USP30 inhibits E3-ubiquitin ligases. 1 / 1
| 1

reach
"A second study shows that USP30 also antagonizes the effect of E3-ubiquitin ligases other than Parkin to regulate distinct mitochondrial functions."
| PMC
USP30 affects Death
| 1
USP30 inhibits Death. 1 / 1
| 1

reach
"In contrast, a systematic analysis of DUB knockdown phenotypes in Drosophila highlighted a protective role for USP30 during development : even incomplete suppression of USP30 expression caused developmental lethality or early death in adulthood [XREF_BIBR]."
USP30 affects DENR
| 1
USP30 deubiquitinates DENR. 1 / 1
| 1

reach
"USP30 can deubiquitinate and stabilize mitochondrial division protein DRP1, promote mitochondrial morphology, and thus regulate lipid metabolism and the occurrence of liver cancer [21]."
| 1

reach
"After USP30-AS1 knockdown in AML cells, forced USP30 gene can rescue the decreased cell viability and increased cell apoptosis."

eidos
"The depletion of USP30 was shown to enhance the degradation of mitochondria in neuronal and HeLa cell cultures [ 106,109 ] ."
USP30 affects CYLD
| 1
| 1

reach
"Superposition of USP30 and CYLD complexes shows how especially the proximal binding sites diverge, to enable either enzyme to target distinct linkage types (XREF_FIG, XREF_SUPPLEMENTARY)."
USP30 affects CLPB
1 |
1 |

No evidence text available
USP30 affects CD79A
1 |
1 |

No evidence text available
USP30 affects CD164L2
1 |
1 |

No evidence text available
USP30 affects CCCP
| 1
| 1

reach
"Amongst the mitochondrial proteins we analysed, only TOM20 and TOM22 showed strongly enhanced CCCP induced degradation in USP30 depleted cells and both associate with USP30-GFP as well as its catalytically inactive mutant in a pull-down assay (Fig XREF_FIG D and E and XREF_SUPPLEMENTARY)."
USP30 affects AS
| 1

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."
USP30 affects APC
1 |
1 |

No evidence text available
USP30 affects ANKRD13A
| 1
| 1

reach
"The overexpression of ASH2L increased USP30 and ANKRD13A expression (***p < 0.001) and attenuated the reduction USP30 and ANKRD13A after USP30-AS1 knockdown."
USP30 affects ADAM30
1 |
1 |

No evidence text available
UBD affects monoubiquitin
| 1
UBD binds USP30 and monoubiquitin. 1 / 1
| 1

sparser
"Encouragingly, the crystal structure of human USP30 bound to monoubiquitin and Lys6-linked di-ubiquitin was reported recently xref , providing insights into the activity and regulation of USP30 to facilitate drug design against this enzyme."
UBC affects USP30
1 |
1 |

No evidence text available
TIMM8A affects USP30
1 |
1 |

No evidence text available
ST7 affects VPS9D1
| 1

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."
SS18L1 affects USP30
1 |
1 |

No evidence text available
SOD2 affects USP30
| 1
SOD2 binds USP30 and AS1. 1 / 1
| 1

sparser
"DEGs GenesUpregulated IRF7, MX2, CMPK2, TRIM25, OAS3, IFIT5, DDX60L, RSAD2, MX1, IFI16, ADAR, USP18, STAT1, PNPT1, TRIM14, OAS1, OAS2, XAF1, IFIT1, DHX58, DDX58, CMTR1, RTP4, PARP12, SP100, EPSTI1, IFIT2, PARP9, IFI35, HERC6, LAMP3, UBE2L6, SAMD9L, PLSCR1, HERC5, OASL, IFIT3, C19orf66, IFI44, TRANK1, SP110, HSH2D, DTX3L, ISG15, IFIH1, ZC3HAV1, PARP10, TRIM21, DDX60, PARP14, IFITM1, NMI, SLC25A28, ISG20, ETV7, STAT2, NLRC5, TRIM5, MYD88, TDRD7, SMCHD1, XRN1, TRIM22, PHF11, SAMD9, GTPBP2, RNF213, NT5C3A, LAP3, ZCCHC2, FAM46A, IFI44L, TREX1, SCO2, GTPBP1, PML, FBXO6, TOR1B, PLEKHA4, UBA7, AIM2, TNFSF10, TAP1, NUB1, GBP4, LMO2, MOV10, APOL6, TAPSAR1, GBP1, SCAMP1-AS1, STARD5, EIF2AK2, N4BP1, BST2, TYMP, IFITM3, IRF9, HELZ2, RNF19B, HLA-E, MOB3C, LGALS9, CNP, SPATS2L, ZNFX1, GMPR, OPTN, CXCL10, C5orf56, RBCK1, APOBEC3G, HDX, CSRNP1, SECTM1, PRKD2, PSMB8, FBXO39,TTC39B, PSMB9, WARS, IRF1, BATF2, TRIM38, LGALS17A, LY6E, IFI6, JAK2, CLEC7A, SAMHD1, SP140L, EXOC3L1, PI4K2B, NUPR1, SIDT1, PCGF5, IFNL3, CASP1, ACSL1, EHD4, CD68, TAP2, SLFN5, TLR3, LOC101927027, TRIB2, LIFR, GRIP2, ACE2, MASTL, BCL2L14, TRAFD1, PRICKLE4, APOL2, BCL3, GBP5, BTC, PIK3AP1, SLC15A3, NFE2L3, ZBP1, ZFYVE26, RASGRP3, TMEM140, ZC3H12A, KIAA1551, CTRL, MLKL, NFKBIA, LYSMD2, MAB21L2, GNB4, C17orf67, GBP1P1, DUOX2, PMAIP1, USP30-AS1, SOD2, CIITA, OGFR, LYPD5, APOBEC3A, IFNL1, AKAP7, ACKR4, TNFAIP3, RBMS2, HESX1, HTR2B, MXD1, IL4I1, BLZF1, DUOXA2, NCOA7, RBM11, HRASLS2, SUSD3, FGD2, CCL5, IFI27, TICAM1, CCDC109B, APOBEC3F, GCH1, IL22RA1, TNFSF13B, C19orf38, IKBKE, IFNL2, CASP10, LRRN2, PPM1K, CD7, APOL3, IRAK2, NFKBIZ, UBQLNL, C21orf91, IL7, HLA-F, CD38, RELB, GCNT4, RHBDF2, CX3CL1, CD83, TNFRSF6B, PPM1J, TAGAP, BTN3A3, TMEM229B, FFAR2, CARD16, SOCS1, STX11, OVOL1, IL19, BIRC3, GLRX, CPNE5, MAFF, CXorf49, CXorf49B, CEACAM1, SEC16B, PRDM1, ADCY4, ATF3, LINC00623, TLR2, IFITM2, NRG2, BBC3, SOCS3, KIAA0226, CXCL11, CXCL9, IL15RA, LAG3, STARD4, IDO1, SOCS2, ICOSLG, C1GALT1, FANCA, KCNQ4, NCF1, C10orf105, AP5B1, TMEM171, GBP2, HK2, BRIP1, RAB43, MUC13, IFI30, NCF1C, SP140, HAPLN3, ARID5A, SLC16A1, CD274, KLHDC7B, CACNA1A, CSF3, MAP2, CCL20, TMEM106A, SERPING1, TNFAIP2, CLCA3P, TNIP3, DLG2, CXCL8, MAPK8IP2, IL17C, PLAUR, NEURL3, PROX1, APOBEC3B, TNF, MB21D1, THEMIS2, FRMD3, HBEGF, BRCA2, DUXAP10, TMEM92, DUSP5, EXOC3L4, APOL4, C11orf82, RIMS2, C15orf48, C2CD4B, NOV, ADAM8, SLFN12, MICB, GBP3, GRIN3A, C1R, LOC102724163, SEMA3D, IL2RG, LOC645638, FGF2, FAM169B, LOC100294362, MT2A, ABCD1, ZNF618, LRRC3, SAA4, CYP21A1P, SLC26A4-AS1, SERPINB9, SERPINB9P1, BATF, LOC388692, TLDC2, IL36G, PRRX2, TGM1, ELOVL7, CXCL3, TNFRSF10A, RTKN2, CCL22, HDAC9, ATP10A, IL6, SBK1, BCL2A1, DOC2B, C2CD4A, C1S, ADM, HCG4B, PTPRH, HCAR3, PDCD1LG2, C8orf4, CXCL2, STS, RET, NOS2, SLC26A4, SLCO4A1, SELL, NTNG2, HLA-J, RND1, CFB, XDH, MMP13, TRIM31, SAA2, SPRR2A, PTGS2, MTNR1A, AKAP2, ACHE, DEFB4A, ICAM1, EREG, SPRR2F, CH25H, IL1RN, NEXN, CSF1, HSPA6, LOC554223, APOL1, SLAMF7, LIF, MEF2C, SSC5D, TGM2, ZDHHC14, CXCL13, ERAP2, ANGPTL4, SH2D1B, THSD1, PLA2G4E Downregulated C20orf195, FAM13C, HPX, INHBB, GPATCH11, PTGFR, PRR18, SLC16A14, SLC47A2 Differential expression of data between infection and control. (A) Differential expression of data between RVA and control; (B) Differential expression of data between RVC and control; (C) The intersection of RVA and RVC DEGs."
SF3A1 affects USP30
1 |
1 |

No evidence text available
SCN3B affects USP30
1 |
1 |

No evidence text available
Result ST-539 affects USP30
| 1
Result ST-539 inhibits USP30. 1 / 1
| 1

eidos
"Result ST-539 inhibits USP30 and promotes mitophagy The enzymatic activity of Parkin is to function as an E3 ubiquitin ligase12 ,31 ."
RNAi affects USP30
| 1
RNAi inhibits USP30. 1 / 1
| 1

reach
"Their study also showed that the downregulation of USP30 by RNAi leads to elongated and interconnected mitochondria; thus, it can be deduced that the DUB plays a direct or indirect role in regulating mitochondrial dynamics."
RFTN2 affects USP30
1 |
1 |

No evidence text available
QKI affects USP30
1 |
1 |

No evidence text available
1 |
Phthalic Acids decreases the amount of USP30. 1 / 1
1 |

No evidence text available
Pharmacological characterization tool affects USP30
| 1
Pharmacological characterization tool inhibits USP30. 1 / 1
| 1

eidos
"Pharmacological characterization of additional tool compounds that selectively inhibit USP30 are reported ."
Park affects USP30
| 1
Park inhibits USP30. 1 / 1
| 1

reach
"We suggest that Usp30 activity is suppressed by the increased levels of Park and Mul1, which restore the correct mitophagy."
PVR affects USP30
1 |
1 |

No evidence text available
PTPN6 affects USP30
| 1

sparser
"Notably, USP30-AS1, HCP5, PSMB8-AS1, and LINC01506 were “IH-specific” lncRNAs, and AL133264.2, LINC01684 were “Constitutive” lncRNAs."
PSMB8 affects USP30
| 1
USP30 binds PSMB8 and AS1. 1 / 1
| 1

sparser
"An EMT-related lncRNA signature consisting of TTC28-AS1, LINC02446, AL662844.4, AC105942.1, AL049840.3, SNHG26, USP30-AS1, PSMB8-AS1, AL031775.1, AC073534.1, U62317.2, C5orf56, AJ271736.1, and AL139385.1 was constructed."
PLA2G10 affects USP30
1 |
1 |

No evidence text available
PK/PD affects USP30
| 1
PK/PD inhibits USP30. 1 / 1
| 1

reach
"Additionally, the PK/PD and toxicity profiles of ST-539 should allow further preclinical assessment of USP30 inhibition as a therapeutic strategy for a wide variety of diseases."
PINK1 affects USP30
| 1
PINK1 activates USP30. 1 / 1
| 1

reach
"We further reconstitute USP30 regulatory mechanisms in vitro, and show how even incomplete PINK1 kinase mediated ubiquitin chain phosphorylation impacts USP30 activity."
PCDHGB1 affects USP30
1 |
1 |

No evidence text available
PCDHB11 affects USP30
1 |
1 |

No evidence text available
PACC1 affects USP30
1 |
1 |

No evidence text available
P2RX5 affects USP30
1 |
1 |

No evidence text available
Niclosamide affects USP30
1 |
Niclosamide increases the amount of USP30. 1 / 1
1 |

No evidence text available
MUL1 affects USP30
| 1
MUL1 inhibits USP30. 1 / 1
| 1

reach
"We suggest that Usp30 activity is suppressed by the increased levels of Park and Mul1, which restore the correct mitophagy."
MPPE1 affects USP30
1 |
1 |

No evidence text available
MPND affects USP30
1 |
1 |

No evidence text available
MFN1 affects USP30
| 1
MFN1 inhibits USP30. 1 / 1
| 1

reach
"Enhancement of MFN1 activity by S3 mediated inhibition of USP30 (mitochondria localized deubiquitinase) restored mitochondrial morphology and ATP levels in fusion deficient mouse embryo fibroblasts (Yue etal., 2014)."
MF-094 nanodelivery affects USP30
| 1
MF-094 nanodelivery inhibits USP30. 1 / 1
| 1

reach
"MF-094 nanodelivery inhibits oral squamous cell carcinoma by targeting USP30."
MARCHF5 affects atpD
| 1
| 1

sparser
"Ubiquitinated intramitochondrial proteins including ATPB lead to the reduction of the TOM (translocase of the outer membrane) complex in USP30‐knockdown cells. xref Therefore, we performed co‐IP assays to determine whether FABP4 affects the interaction between ATPB and March5 or USP30."
LRFN4 affects USP30
1 |
1 |

No evidence text available
KRT7 affects USP30
| 1

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."
HSD11B1 affects USP30
| 1

sparser
"The result implies that PD-L1 was significantly associated with some FRlncRNAs, such as LINC02328, LINC01871, LMNTD2-AS1, LINC00702, LINC02384, AP001434.1, TRG-AS1, LIPE-AS1, HSD11B1-AS1, USP30-AS1, LINC02446, AC099329.2, PRKAR1B-AS1, and LINC02084."
GRPR affects USP30
1 |
1 |

No evidence text available
EXT2 affects USP30
1 |
1 |

No evidence text available
| 1
E3_Ub_ligase ubiquitinates USP30. 1 / 1
| 1

reach
"Such is the case with USP30, which is monoubiquitinated at three sites near its substrate interaction domain by the E3 Parkin (183, 184, 185)."

sparser
"Using a web for RNA–Protein Interaction Prediction (), we analyzed whether there are potential interactions of USP30-AS1 with some PcG and TrxG proteins."

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."

sparser
"Using a web for RNA–Protein Interaction Prediction (), we analyzed whether there are potential interactions of USP30-AS1 with some PcG and TrxG proteins."
Delta-actitoxin-Avd1a affects ST7, USP30, and VPS9D1
| 1

sparser
"We found USP30-AS1, ST7-AS1, VPS9D1-AS1, OTUB6DB-AS1, LINC01087, and MAPT-AS1 were correlated to the OS in breast cancer patients."
| 1

sparser
"Notably, USP30-AS1, HCP5, PSMB8-AS1, and LINC01506 were “IH-specific” lncRNAs, and AL133264.2, LINC01684 were “Constitutive” lncRNAs."

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."

sparser
"The result implies that PD-L1 was significantly associated with some FRlncRNAs, such as LINC02328, LINC01871, LMNTD2-AS1, LINC00702, LINC02384, AP001434.1, TRG-AS1, LIPE-AS1, HSD11B1-AS1, USP30-AS1, LINC02446, AC099329.2, PRKAR1B-AS1, and LINC02084."

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."
CYLD affects USP30
| 1
| 1

reach
"Superposition of USP30 and CYLD complexes shows how especially the proximal binding sites diverge, to enable either enzyme to target distinct linkage types (XREF_FIG, XREF_SUPPLEMENTARY)."
CLPB affects USP30
1 |
1 |

No evidence text available
CD79A affects USP30
1 |
1 |

No evidence text available
CD164L2 affects USP30
1 |
1 |

No evidence text available
CCCP affects USP30
| 1
| 1

reach
"Amongst the mitochondrial proteins we analysed, only TOM20 and TOM22 showed strongly enhanced CCCP induced degradation in USP30 depleted cells and both associate with USP30-GFP as well as its catalytically inactive mutant in a pull-down assay (Fig XREF_FIG D and E and XREF_SUPPLEMENTARY)."
Antirheumatic Agents increases the amount of USP30. 1 / 1
1 |

No evidence text available
AS1 affects SOD2, and USP30
| 1
SOD2 binds USP30 and AS1. 1 / 1
| 1

sparser
"DEGs GenesUpregulated IRF7, MX2, CMPK2, TRIM25, OAS3, IFIT5, DDX60L, RSAD2, MX1, IFI16, ADAR, USP18, STAT1, PNPT1, TRIM14, OAS1, OAS2, XAF1, IFIT1, DHX58, DDX58, CMTR1, RTP4, PARP12, SP100, EPSTI1, IFIT2, PARP9, IFI35, HERC6, LAMP3, UBE2L6, SAMD9L, PLSCR1, HERC5, OASL, IFIT3, C19orf66, IFI44, TRANK1, SP110, HSH2D, DTX3L, ISG15, IFIH1, ZC3HAV1, PARP10, TRIM21, DDX60, PARP14, IFITM1, NMI, SLC25A28, ISG20, ETV7, STAT2, NLRC5, TRIM5, MYD88, TDRD7, SMCHD1, XRN1, TRIM22, PHF11, SAMD9, GTPBP2, RNF213, NT5C3A, LAP3, ZCCHC2, FAM46A, IFI44L, TREX1, SCO2, GTPBP1, PML, FBXO6, TOR1B, PLEKHA4, UBA7, AIM2, TNFSF10, TAP1, NUB1, GBP4, LMO2, MOV10, APOL6, TAPSAR1, GBP1, SCAMP1-AS1, STARD5, EIF2AK2, N4BP1, BST2, TYMP, IFITM3, IRF9, HELZ2, RNF19B, HLA-E, MOB3C, LGALS9, CNP, SPATS2L, ZNFX1, GMPR, OPTN, CXCL10, C5orf56, RBCK1, APOBEC3G, HDX, CSRNP1, SECTM1, PRKD2, PSMB8, FBXO39,TTC39B, PSMB9, WARS, IRF1, BATF2, TRIM38, LGALS17A, LY6E, IFI6, JAK2, CLEC7A, SAMHD1, SP140L, EXOC3L1, PI4K2B, NUPR1, SIDT1, PCGF5, IFNL3, CASP1, ACSL1, EHD4, CD68, TAP2, SLFN5, TLR3, LOC101927027, TRIB2, LIFR, GRIP2, ACE2, MASTL, BCL2L14, TRAFD1, PRICKLE4, APOL2, BCL3, GBP5, BTC, PIK3AP1, SLC15A3, NFE2L3, ZBP1, ZFYVE26, RASGRP3, TMEM140, ZC3H12A, KIAA1551, CTRL, MLKL, NFKBIA, LYSMD2, MAB21L2, GNB4, C17orf67, GBP1P1, DUOX2, PMAIP1, USP30-AS1, SOD2, CIITA, OGFR, LYPD5, APOBEC3A, IFNL1, AKAP7, ACKR4, TNFAIP3, RBMS2, HESX1, HTR2B, MXD1, IL4I1, BLZF1, DUOXA2, NCOA7, RBM11, HRASLS2, SUSD3, FGD2, CCL5, IFI27, TICAM1, CCDC109B, APOBEC3F, GCH1, IL22RA1, TNFSF13B, C19orf38, IKBKE, IFNL2, CASP10, LRRN2, PPM1K, CD7, APOL3, IRAK2, NFKBIZ, UBQLNL, C21orf91, IL7, HLA-F, CD38, RELB, GCNT4, RHBDF2, CX3CL1, CD83, TNFRSF6B, PPM1J, TAGAP, BTN3A3, TMEM229B, FFAR2, CARD16, SOCS1, STX11, OVOL1, IL19, BIRC3, GLRX, CPNE5, MAFF, CXorf49, CXorf49B, CEACAM1, SEC16B, PRDM1, ADCY4, ATF3, LINC00623, TLR2, IFITM2, NRG2, BBC3, SOCS3, KIAA0226, CXCL11, CXCL9, IL15RA, LAG3, STARD4, IDO1, SOCS2, ICOSLG, C1GALT1, FANCA, KCNQ4, NCF1, C10orf105, AP5B1, TMEM171, GBP2, HK2, BRIP1, RAB43, MUC13, IFI30, NCF1C, SP140, HAPLN3, ARID5A, SLC16A1, CD274, KLHDC7B, CACNA1A, CSF3, MAP2, CCL20, TMEM106A, SERPING1, TNFAIP2, CLCA3P, TNIP3, DLG2, CXCL8, MAPK8IP2, IL17C, PLAUR, NEURL3, PROX1, APOBEC3B, TNF, MB21D1, THEMIS2, FRMD3, HBEGF, BRCA2, DUXAP10, TMEM92, DUSP5, EXOC3L4, APOL4, C11orf82, RIMS2, C15orf48, C2CD4B, NOV, ADAM8, SLFN12, MICB, GBP3, GRIN3A, C1R, LOC102724163, SEMA3D, IL2RG, LOC645638, FGF2, FAM169B, LOC100294362, MT2A, ABCD1, ZNF618, LRRC3, SAA4, CYP21A1P, SLC26A4-AS1, SERPINB9, SERPINB9P1, BATF, LOC388692, TLDC2, IL36G, PRRX2, TGM1, ELOVL7, CXCL3, TNFRSF10A, RTKN2, CCL22, HDAC9, ATP10A, IL6, SBK1, BCL2A1, DOC2B, C2CD4A, C1S, ADM, HCG4B, PTPRH, HCAR3, PDCD1LG2, C8orf4, CXCL2, STS, RET, NOS2, SLC26A4, SLCO4A1, SELL, NTNG2, HLA-J, RND1, CFB, XDH, MMP13, TRIM31, SAA2, SPRR2A, PTGS2, MTNR1A, AKAP2, ACHE, DEFB4A, ICAM1, EREG, SPRR2F, CH25H, IL1RN, NEXN, CSF1, HSPA6, LOC554223, APOL1, SLAMF7, LIF, MEF2C, SSC5D, TGM2, ZDHHC14, CXCL13, ERAP2, ANGPTL4, SH2D1B, THSD1, PLA2G4E Downregulated C20orf195, FAM13C, HPX, INHBB, GPATCH11, PTGFR, PRR18, SLC16A14, SLC47A2 Differential expression of data between infection and control. (A) Differential expression of data between RVA and control; (B) Differential expression of data between RVC and control; (C) The intersection of RVA and RVC DEGs."
AS1 affects PSMB8, and USP30
| 1
USP30 binds PSMB8 and AS1. 1 / 1
| 1

sparser
"An EMT-related lncRNA signature consisting of TTC28-AS1, LINC02446, AL662844.4, AC105942.1, AL049840.3, SNHG26, USP30-AS1, PSMB8-AS1, AL031775.1, AC073534.1, U62317.2, C5orf56, AJ271736.1, and AL139385.1 was constructed."
AS affects USP30
| 1

sparser
"These six IR-lncRs were used in the prognostic model construction, and they were KRT7-AS, USP30-AS1, AC011445.1, AP005205.2, DNM3OS and AC027348.1, and the corresponding coefficients were also given (Table  xref )."
APC affects USP30
1 |
1 |

No evidence text available
ANKRD13A affects USP30
| 1
| 1

reach
"The overexpression of ASH2L increased USP30 and ANKRD13A expression (***p < 0.001) and attenuated the reduction USP30 and ANKRD13A after USP30-AS1 knockdown."
ADAM30 affects USP30
1 |
1 |

No evidence text available
3g affects USP30
| 1
3g inhibits USP30. 1 / 1
| 1

eidos
"Among all compounds investigated , 3g and 3f inhibited USP30 at IC 50 of 5.12 and 8.43 muM , respectively ."
3f affects USP30
| 1
3f inhibits USP30. 1 / 1
| 1

eidos
"Among all compounds investigated , 3g and 3f inhibited USP30 at IC 50 of 5.12 and 8.43 muM , respectively ."
1 |
(-)-anisomycin increases the amount of USP30. 1 / 1
1 |

No evidence text available