Other Services

This Service

A database built with INDRA combining content from numerous readers and databases. This page allows you to curate the loaded statements. For more information please see the manual.

This Project

INDRA is developed by indralabs, a part of the Harvard Medical School Laboratory of Systems Pharmacology.

This project, indra_db, is also developed by the indralab team. For more information on how we procure our sources, you can go here. This work was funded by ARO grant W911NF‐15‐1‐0544 under the DARPA Communicating with Computers program.

IndraLab

Statements

Ribonuclease activates USP9X. 1 / 1

| 1

➶

reach

"The FOXC2 probe was 5 ' GGTCCAGTAACTGCCCTTGCCGGGCTTCTTGTCGT3 ' modified by 3 ' FAM +5 ' FAM.As previously described, each RNA sample was treated with ribonuclease A+T (Sigma-Aldrich), which digests si[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

28323030

Our Sources:

INDRA allows us to combine the results from a multitude of sources. In particular, the INDRA Database draws on the following...