IndraLab

Statements



reach
"The 22-base pair MB sequence, 5′-[FAM] CGCG A TTAGTTCAGTCCAATTCATGCC T CGCG [DABCYL]-3′, was designed to be complementary to a coding region from the inner capsid protein VP6 gene from HuRVA and was s[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"To analyze gene expression changes after usp9 antisense morpholino MO knockdown in zebrafish for the target genes usp9, and the zebrafish MAPT paralogs mapta and maptb, titrated microinjections were performed with 4.8 and 8ng/injection of an e2i2 splice blocking usp9 MO in one to two cell-stage zebrafish embryos."