IndraLab

Statements


Cre binds SCN10A. 187 / 187
| 187

sparser
"For example: in an earlier study, Daou et al. ( xref ) demonstrated the role of optogenetics in suppressing pain using a binary genetic approach, delivering ChR2 channels to peripheral nociceptors in the Nav1.8-Cre transgenic mouse line."

sparser
"Viewed with TEM, the ultrastructure of pathological Nav1.8 Cre/+ ;ROSA26 lacZ /+afferents ( xref ) was similar to those of theKcna6 lacZ/lacZ mice ( xref ), while normal morphology of primary afferent terminals was observed in Nav1.8-Cre negative littermate controls ( xref ) and in Kcna6 -/- knock-out mice not expressing lacZ ( xref )."

sparser
"Nav1.8-Cre mice are a transgenic mouse line that expresses Cre recombinase under the control of the promoter of Nav1.8, a sensory neuron-specific voltage-gated Na + channel primarily expressed in nociceptors [ xref – xref ]."

sparser
"Conditional DOR knockout (KO) generated using Oprd1 flox/flox and Nav1.8-Cre mice suggests that DORs expressed in Nav1.8-positive DRG neurons are important for the analgesic action of DOR agonists and[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"However, it is unclear if the two are related in our model, or if the anxiety phenotype is a result of the actions of Nav1.8-Cre within the CNS."

sparser
"We also observed Nav1.8-Cre targeted connections in the brain that were localized to regions of affective/emotional function."

sparser
"Nav1.8-Cre mouse line could be used to genetically tag nociceptive C-, Aδ-, and Aβ-fibers [ xref ]."

sparser
"Cold allodynia but not mechanical allodynia induced by pT-ION or by virus-mediated overexpression of Cx36 in the trigeminal ganglion was reversed by the GluK2 antagonist NS102, and knocking down Cx36 expression in Nav1.8-expressing nociceptors by injecting virus into the orofacial skin area of Nav1.8-Cre mice attenuated cold allodynia but not mechanical allodynia."

sparser
"We generated a transgenic mouse model in which Cas9 is selectively expressed in sensory neurons by crossing Cas9 fl/fl mice with mice expressing Cre recombinase under the control of the Scn10a promoter (Nav1.8-Cre) xref , xref ."

sparser
"We then bred Nav1.8-Cre mice with Rosa26 - DTR mice to generate mice lacking Nav1.8 + nociceptors (Nav1.8 DTR mice)."

sparser
"The dsRNA analogue Poly(I:C) led to antinociception with similar kinetics in wild-type, STING gt/gt and Cgas −/− mice, but these effects were abolished in Ifnar1 fl/fl ;Nav1.8-cre ( Ifnar1 -cKO) and RIG-I −/− mice ( xref )."

sparser
"By contrast, the dsDNA analogue poly(dA:dT) resulted in antinociception in wild-type and RIG-I −/− mice, but these effects were abolished in Ifnar1 fl/fl ;Nav1.8-cre, STING gt/gt and Cgas −/− mice, and each of which also exhibited baseline mechanical hypersensitivity ( xref )."

sparser
"Thermal nociception tests (Hargreaves’s test) showed a significant increase in paw withdrawal latency in nociceptor-ablated mice (Nav1.8-DTA) compared to cre-control (Nav1.8-Cre) ( p  = 0.05) (Fig.  xref a) ( n  = 4–5 per group)."

sparser
"Similarly, when a large portion of nociceptive neurons were depleted using Nav1.8-Cre lineage ablation in mice, monocyte recruitment and lymphadenopathy increased in a Staphylococcus aureus subcutaneous infection model; CGRP also decreased TNFα production from macrophages ( xref ) [ xref ]."

sparser
"There was marked reduction in the expression of Nav1.8 ( p  < 0.01) (Fig.  xref c) ( n  = 4–8 per group) and CGRP ( p  = 0.04) (Fig.  xref d) ( n  = 5–9 per group) mRNA in TG from Nav1.8-DTA compared to the Nav1.8-Cre mice."

sparser
"For example, by crossing Nav1.8-Cre mice with Ai32 (RCL-ChR2(H134R)/EYFP) mice, we have generated mice that express channel rhodopsin 2 (ChR2) under the control of Nav1.8-Cre (Nav1.8-ChR2 mice)."

sparser
"Healthy teeth have rich innervation of nociceptors in Nav1.8-Cre mice that is substantially increased 14 days following infection due to neuronal sprouting (Fig.  xref f; left)."

sparser
"To determine novel bacterial mechanisms which may modulate pain-related signaling, we mined our mouse transcriptional dataset of FACS-sorted DRG neuron populations xref and found that Antxr2 was enriched by 5-fold in Na v 1.8 lineage ( Nav1.8-cre Rosa26-Tdtomato +) neurons compared to Parvalbumin lineage ( Pvalb-cre Rosa26-Tdtomato +) proprioceptive neurons ( xref )."

sparser
"In Nav1.8-ChR2 transgenic mice constructed by knocking the ChR2 gene into Nav1.8-cre mice, remote or epidural blue light illumination induces the activation of sensory neurons and central sensitization in the spinal cord, as well as mechanical hypersensitivity, avoidance behavior, and conditioned place aversion in animals [ xref , xref ]."

sparser
"Lineage tracing with Nav1.8-Cre reveals targeted neuronal populations both in the periphery and in the brain."

sparser
"Since then, Nav1.8 has become well established as a marker of peripheral nociceptors and Nav1.8-Cre has been routinely used to target small diameter sensory nerves [ xref ]."

sparser
"Our lineage tracing results with Nav1.8-Cre confirmed this expression."

sparser
"This is similar to two prior reports of Nav1.8-Cre lineage tracing that identified a small population of Nav1.8+ cells in the autonomic superior cervical ganglion [ xref , xref ]."

sparser
"Our results are consistent with prior reports showing that Nav1.8-Cre targets >90% of neurons expressing markers of nociceptors in addition to at least two types of low-threshold mechanoreceptors [ xref ]."

sparser
"In addition to peripheral nerves, we also identified several regions in the brain that were targeted by Nav1.8-Cre."

sparser
"This conflicts with a previous study using the same Nav1.8-Cre model, though with a different β-galactosidase-based reporter assay, which failed to detect Nav1.8+ neurons in the brain or spinal cord [ xref ]."

sparser
"The implications of this finding remain unclear but suggest that prior results obtained with the Nav1.8-Cre model that were attributed solely to the actions of peripheral nerves may need to be re-examined."

sparser
"This also supports the future investigation of Nav1.8-Cre targeted neurons in the brain."

sparser
"Chronic mTORC1 activation in A-fibers has also been implicated in the pathogenesis of itch and ∼40% of A-fibers are targeted by Nav1.8-Cre [ xref , xref ]."

sparser
"This suggests a direct contribution of mTORC1 activation in the Nav1.8-Cre targeted peripheral nerves to the onset of the itch phenotype in our model."

sparser
"However, Nav1.8-Cre mice exhibited greater expression of CD68 + cells after 14 days ( p  < 0.001)."

sparser
"The withdrawal responses or avoidance behavior were therefore interpreted as nociceptive responses, which agrees with other studies using optogenetic transgenic mice, where channelrhodopsin was directed to peripheral nociceptive neurons via Nav1.8-Cre [ xref ], also known as SNS-Cre [ xref ] (encoded by Scn10a ), or via transient receptor potential, TRPV1-Cre [ xref ]."

sparser
"However, Nav1.8-DTA animals had significantly larger lesions at day 14 than Nav1.8-Cre animals (Fig.  xref a, b) ( p  < 0.001)."

sparser
"After 14 days post pulp exposure (infection), there were no differences in tumor necrosis factor alpha (TNF⍺) gene expression in the periapical lesion between Nav1.8-Cre and Nav1.8-DTA mice with both showing approximately a five-fold increase compared to healthy tissues ( p  = 0.35) (Fig.  xref c) ( n  = 3 per group)."

sparser
"Also, the expression of interleukin 1 alpha (IL-1α) and interleukin 6 (IL-6) were increased approximately two-fold compared to healthy tissues in Nav1.8-Cre mice (Fig.  xref c)."

sparser
"Mice heterozygously expressing Cre recombinase under the control of the Na V 1.8 promoter ( SNS-Cre ; xref ) were crossed with homozygous mice carrying the Nedd4-2 floxed allele (Nedd4L fl/fl ; xref )."

sparser
"While no significant difference in the RANKL/OPG ratio was found between the two groups at 7 days ( p  = 0.15) (Fig.  xref e), Nav1.8-DTA mice showed downregulation in the RANKL/OPG ratio compared to Nav1.8-Cre mice (~ two-fold) at 14 days ( p  < 0.01) (Fig.  xref e)."

sparser
"Nevertheless, there was a significant lower expression of CD68 mRNA expression within AP in Nav1.8-DTA mice at day 7 ( p  < 0.01) with no significant difference ( p  = 0.81) in the early time point (3 days) compared to Nav1.8-Cre mice (Fig.  xref b, c) ( n  = 11–19 per group)."

sparser
"Indeed, we found that scratching elicited by repetitive treatment with MC903 was diminished in Nav1.8-Cre Stat3 fl/fl mice ( Figures 7 A and 7B )."

sparser
"As expected, nuclear accumulation of activated STAT3 in sensory neurons was diminished in DRGs of MC903-treated Nav1.8-Cre Stat3 fl/fl mice ( Figures S7 A and S7B)."

sparser
"In addition, Nav1.8-Cre Stat3 fl/fl mice had normal frequencies of DRG neurons expressing somatostatin (an NP3 marker), GFRα1 (an NP2 marker when combined with Nav1.8-tdTomato), and GFRα2 (an NP1/Th m[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Nav1.8-Cre targets peripheral sensory nerves, a subpopulation of autonomic neurons in the sympathetic chain, and several regions of the brain."

sparser
"Therefore, it is highly possible that oncostatin M-dependent itch was also reduced in MC903-treated Nav1.8-Cre Stat3 fl/fl mice."

sparser
"To further assess the role of Piezo2 in nociceptor mechanosensing, we generated Piezo2 conditional knockout (Piezo2 cKO ) mice in which Piezo2 was deleted specifically from nociceptors; Piezo2 intact Nav1.8-Cre +/- mice (Piezo2 wt ) served as genetic control (Fig.  xref )."

sparser
"Nav1.8-cre +/− mice were bred with diphtheria toxin A (DTA) reporter mice to generate animals deficient in Nav1.8-lineage neurons ( Nav1.8-Cre +/− ; Dta ) xref ."

sparser
"After MRSA infection, we observed a trend toward higher survival ( P = 0.09) and lower bacterial burden ( P = 0.07) in Nav1.8-Cre +/− ; Dta mice than in control littermates ( xref )."

sparser
"In Nav1.8-Cre +/− ; Dta mice, compared with control littermates, we also observed significantly greater bacterial dissemination to the blood, which was accompanied by greater spleen size ( xref )."

sparser
"RNA-expression of Il31ra and Osmr was also reduced in sensory neurons of Nav1.8-Cre Stat3 fl/fl mice ( Figure S4 B)."

sparser
"We found a similar increase in γδ T cells in Nav1.8-Cre +/− ; Dta mice compared with control littermates ( xref ). γδ T cells reside within epithelial layers of the lungs, skin, and gut, where they act as first responders to infection xref ."

sparser
"By crossing Meis1 F mice with transgenic Nav1.8-Cre mice, in which Cre recombinase is driven from a genomic fragment derived from the Nav1.8 promoter region and is selectively expressed in most nociceptive neurons, we generated Meis1 conditional knockout mice (referred to as Meis1cko )."

sparser
"Cre expression is first detected in Nav1.8-Cre mice at E16.5."

sparser
"Nav1.8-cre ; Dta mice, in which an overlapping though distinct nociceptor subset is targeted, showed a milder protective phenotype."

sparser
"Another study has shown that Nav1.8-Cre ; Dta mice still possess CGRP + neurons expressing TRPV1 (ref. xref )."

sparser
"Nav1.8-Cre mice were bred with Rosa26-tdRFP reporter mice to generate Nav1.8Cre Rosa26-tdRFP mice."

sparser
"Here, we generated Nav1.8-Cre;Ci1 mice and harvested the forepaw from adult mice aged 6–8 weeks."

sparser
"Whole-mount immunostaining of ing-scWAT from sensory nerve reporter mice ( Nav1.8-Cre x TdTomato ) validated the presence of small, distinct sensory axons innervating adipocytes in the parenchyma, and also supported earlier findings of sensory fibers within larger nerve bundles in ing-scWAT."

sparser
"In the skin from Nav1.8-Cre R26CAG-floxStop-tdTomato Il31ra fl/fl mice, IL-31RA signals were not observed on Nav1.8-tdTomato + nerve fibers ( Figure 1 B)."

sparser
"These results show that IL-31RA is expressed on sensory neurons that have nerve endings at the dermal-epidermal junction, and that IL-31RA expression is abolished in sensory neurons of Nav1.8-Cre Il31[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Depletion of nociceptive nerves using resiniferatoxin (RTX) or Nav1.8-Cre transgenic mice blunted G-CSF-induced HSC mobilization, and these mobilization defects were ameliorated by CGRP supplementation."

sparser
"We then bred Nav1.8-Cre mice with Rosa26 - DTA mice to generate mice lacking Nav1.8 + nociceptors (Nav1.8 DTA mice) ( xref ) ( xref ; xref )."

sparser
"Nevertheless, the well‐characterized SNSCre line allows us to consider that the SNS‐ArchT line is not strictly limited to nociceptors, but highly enriched in this population."

sparser
"To mirror this in mice, we bred Nav1.8-Cre with TSC2 fl/fl animals to conditionally delete TSC2 in Nav1.8-expressing neurons."

sparser
"To investigate whether activating nociceptors is sufficient to promote mucus growth, we bred Nav1.8-Cre mice with hM3Dq reporter mice to drive expression of both mCitrine and hM3Dq, a designer receptor exclusively activated by designer drugs (DREADD) whose ligand is clozapine N-oxide (CNO) (Nav1.8 hM3Dq ) ( xref ) ( xref )."

sparser
"It is of note that the in vivo time window for this requirement is likely brief, because conditional knockout of either Gp130 (gene name IL6st ) or Jak1 with Nav1.8-Cre, which is active perinatally, has little effect on DRG neuron survival ( xref , xref )."

sparser
"The study of Aβ-LTMRs and Aβ-HTMRs has been facilitated by using Nav1.8-Cre mice."

sparser
"An alternative germline model of sensory nerve Y2R knockdown was generated using Nav1.8-Cre mice crossed with the Y2R-flox strain (Nav1.8-Y2R-KD)."
| PMC

sparser
"To determine the function of FGF13 in inflammatory pain, we generated Fgf13 conditional knockout mice by mating the Fgf13-loxP mice with a mouse line expressing SNS-Cre recombinase using Cre-loxP mediated recombination system."

sparser
"Nav1.8-Cre is expressed in numerous functional classes of afferents, including C-LTMRs ( xref )."

sparser
"The Nav1.8-Cre mouse was generated in 2005 and is routinely used to selectively target the small diameter peripheral sensory neurons, including A and C fiber nociceptors [ xref , xref , xref ]."

sparser
"To validate this for our study, we bred the Nav1.8-Cre mouse with Rosa26-ZsGreen (Ai6) or Rosa26-tdTomato (Ai9) reporter mice prior to analysis of the peripheral nervous system, brain, and common metabolic tissues in adult animals [ xref ]."

sparser
"This transgenic mouse line expresses Cre recombinase under the control of the promoter of Nav1.8, a sensory neuron-specific voltage-gated Na + channel primarily expressed in nociceptors. xref xref – xref Nav1.8-Cre mouse line could be used to genetically tag nociceptive C-, Aδ-, and Aβ-fibers. xref For example, by crossing Nav1.8-Cre mice with Ai32 (RCL-ChR2(H134R)/EYFP) mice, we have generated mice that express channel rhodopsin 2 (ChR2) under the control of Nav1.8-Cre (Nav1.8-ChR2 mice)."

sparser
"Next, we used Nav1.8-Cre; Rosa26 LSL-DTR mice to ablate Nav1.8 + neurons by expressing human diphtheria toxin (DTX) receptor (DTR) in these neurons."

sparser
"43 To this end, mice with protein Tmc7 exon6 floxed were crossed with a mouse line expressing Cre recombinase controlled by the promoter elements of Nav1.8 ( SNS-cre ) 43 ( Figure 3C1 )."

sparser
"Although it is possible that Cre expression in dorsal root ganglia in the Nav1.8-Cre mice may not be restricted to nociceptors and may also affect low threshold mechanoreceptor sensory neurons ( xref ), it remains unclear whether deletion of DORs solely on nociceptors is responsible for the enhancement of mechanical pain."

sparser
"In an elegant study, DREADDs were used to manipulate the activity of sensory neurons in a Nav1.8-Cre mouse model of melanoma."

sparser
"Furthermore, mouse models more specific to sensory nerves can be used for comparison, such as Nav1.8Cre mice."

sparser
"To study cell-specific pathways, we generated mice expressing an HA-tagged ribosomal protein (RPL22-HA) in the sensory neurons (RiboTag+/+:Nav1.8Cre+/–; RiboTag-Nav) by crossing RiboTag mice with hemizygous Nav1.8-Cre mice (RiboTag mice procedure; xref )."

sparser
"Although further studies are warranted to investigate whether the residual TRPV4 in sensory neurons (~20%), most likely outside of Nav1.8-cre + neuronal population, plays a functional role in CGRP release, it is plausible that deletion of Trpv4 from Nav1.8-cre + neurons can have a dramatic effect on secretion of CGRP because CGRP is exclusively expressed within a subset of Nav1.8-cre + neurons xref ."

sparser
"However, most of these tools drive expression either in SCP, and therefore iSch and both RSC and MSC ( P0-Cre ; xref ; PLP-CreER T2 ; Leone et al., 20023; xref ), mostly but not exclusively in RSC ( Nav1.8-Cre ; xref ), or in small numbers of RSC ( Egr1-CreER T2 ; xref )."

sparser
"CNO treatment of Nav1.8-Cre(+/-) mice did not cause p-CREB up-regulation in DRG."

sparser
"The expression of Tmc7 was significantly reduced in the DRG of Nav1.8-cre , Tmc7 fl/fl mice, as determined by quantitative PCR ( Figure 3C2 )."

sparser
"To study leptin resistance in the peripheral nervous system, we have previously reported the mice (Nav1.8-Cre X LepR fl/fl , VAN LepRΔ ) with deletion of leptin receptor in sensory neurons, primarily vagal afferent neurons (VAN) [ xref ]."

sparser
"Subsequently, up-down von Frey and Hargreaves tests were conducted on Nav1.8-cre , Tmc7 fl/fl mice, as depicted in Figures 3 D1 and 3D2."

sparser
"We have crossed Nav1.8Cre mice with a mouse line conditionally expressing TdTomato. xref In Nav1.8Cre/TdTomato mice, upon removal of loxP‐stop‐loxP cassette by Cre recombination, TdTomato is expressed only in Nav1.8‐sensory neurons."

sparser
"To explore the role of Nav1.8+ sensory nerves within the tumour microenvironment, we have induced targeted diphtheria toxin‐based cell ablation. xref We crossed Nav1.8Cre mice with inducible diphtheria toxin A (iDTA) transgenic mice to specifically deplete all sensory neurons. xref Nav1.8Cre/iDTA mice were previously shown to be devoid of all Nav1.8‐expressing nociceptors, xref and have no response to mechanical stimuli, noxious heat or capsaicin. xref Genetic depletion of sensory nerves was confirmed by immunohistochemistry to Nav1.8 in the dorsal root ganglions of these animals (Figure xref C,D)."

sparser
"Using a ZW mouse crossed with a Nav1.8-Cre mouse (Cre would be thus expressed only in voltage-gated sodium channels expressing a population of DRG neurons) the authors not only demonstrated the feasib[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Therefore, we analyzed Nav1.8-Cre Rosa26DTA mice ( Chiu et al., 2013 ), which are systemically deficient in nociceptors (hereafter referred to as pain-free mice), to examine the role of the nociceptiv[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Both male and female Nav1.8-cre , Tmc7 fl/fl mice exhibited increased sensitivity to mechanical stimuli and comparable sensitivity with heat stimuli."

sparser
"Compared with control mice, male Nav1.8-cre , Tmc7 fl/fl mice displayed significantly lower baseline mechanical thresholds and worsening of mechanical allodynia in both the CCI and CFA models ( Figure[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"This finding aligns with the results of previous functional studies in conditional MOR (Nav1.8-Cre x Oprm1-/-) [ xref ] or conditional DOR (Nav1.8-Cre x Oprd1fl/fl) knockout mice [ xref ]."

sparser
"To do this, we bred mice heterozygous for a Cre driver ( Nav1.8-Cre ) specific for nociceptive sensory neurons ( xref ) and homozygous for a floxed allele of Insr ( xref ), the locus that encodes the mouse insulin receptor."

sparser
"Only mice bearing the Nav1.8-Cre driver generated a PCR band specific for the Cre gene (also xref A)."

sparser
"In peripheral tissues, the Nav1.8-Cre reporter was restricted to axons within all tissues analyzed, including liver, kidney, pancreas, spleen, adrenal gland, adipose, muscle, ligament, bone, and associated vasculature and fascia ( xref and xref )."

sparser
"18 Therefore, it is possible that differentiation of the sensory neurons was altered in Nav1.8-Cre Stat3 fl/fl mice."

sparser
"Because Nav1.8 ( Scn10a ) is predominantly expressed in the DRG (Fig. S1,) and nociceptive fibers, xref , xref we used Nav1.8-Cre mice xref to perform sensory neuron–selective depletion of AR."

sparser
"Notably, Shank3 expression was substantially reduced in CKO mice (Nav1.8-cre; Shank3 f/f mice) as compared toShank3 f/f mice ( p = 0.0017, xref )."

sparser
"These data indicated that combining the Nav1.8-Cre transgene with the floxed allele of Insr leads to a tissue-specific deletion of a portion of the mouse Insr locus."

sparser
"We did not find significant differences in LPS-induced hypothermia (F (2, 124) = 0.1497, p = 0.8611, two-way ANOVA, xref ) and survival rate ( xref ) between littermate control mice (Shank2 f/f ) and CKO mice (Nav1.8-cre; Shank2 f/+ andNav1.8-cre; Shank2 f/f )."

sparser
"Similar to GDX males and normal females, the mechanical pain thresholds in AR-cKO males was significantly lower than in wild-type (WT; AR flox/y ) males (Fig. xref B), whereas Nav1.8-Cre males exhibited normal pain thresholds (Fig. S3,)."

sparser
"Conditional deletion of Dicer in the dorsal root ganglion by using Nav1.8-Cre mice leads to the attenuation of nociception-related gene expression and the reduction of inflammatory pain while maintaining intact acute nociception [ xref ]."

sparser
"In addition, we also identified a subpopulation of postganglionic autonomic neurons within the thoracic sympathetic chain and localized populations of neurons within several brain regions that trace with Nav1.8-Cre."

sparser
"The observation of mechanical hypersensitivity is consistent with reports that Nav1.8-Cre expresses in at least a subset of mechanically responsive sensory neurons ( xref ; xref )."

sparser
"This raises the possibility that the metabolic effects observed previously were mediated either by sensory neurons not targeted by the Nav1.8-Cre driver used here or by enteric neurons or gut endocrine cells that express Advillin ."

sparser
"In a lethal model of Staphylococcus aureus pneumonia ( xref ), depletion of TRPV1+ nociceptive neurons through Trpv1-Dtr, Nav1.8-cre;Dta or resiniferatoxin administration significantly improves survival and bacterial clearance, demonstrating nociceptor suppression of protective immunity."

sparser
"REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit plyclonal anti-GS Proteintech Cat#11037-2-AP; RRID: AB_2110650 Rabbit plyclonal anti-beta III Tubulin [2G10] Abcam Cat#ab18207; RRID: AB_444319 [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"As TRPV1 functions in immune cells, such as macrophages [ xref ], we investigated whether the nociceptive system plays an important role in sepsis [ xref ] using Nav1.8-Cre Rosa26DTA nociceptor-deficient mice [ xref ]."

sparser
"Therefore, this strategy was not specific to a fiber subtype, using a constitutive strategy composed by a homozygous Nav1.8Cre mice crossed with a heterozygous Ai32 mice, which carry the ChR2(H134R)–EYFP gene in their Gt(ROSA)26Sor locus receiving Nav1.8-ChR2 ( xref )."

sparser
"Knockout of TSC2 with Nav1.8-Cre drives activation of mTORC1 pathways in peripheral sensory neurons."

sparser
"Consistent with prior reports, Nav1.8-Cre traced to peripheral sensory nerve cell bodies within the DRG and corresponding axons within the sensory laminae of the spinal cord ( xref A–C)."

sparser
"In addition, Nav1.8-Cre traced a subpopulation of neurons within the paravertebral ganglia of the sympathetic chain ( xref D)."

sparser
"On the other hand, in Nav1.8-Arch mice, obtained with heterozygous Nav1.8-Cre mice crossed with homozygous Ai35 mice carrying the floxed stop-Arch-EGFP gene in the ROSA26, the mechanical and thermal sensitization was completely prevented with the stimulation of yellow light ( xref )."

sparser
"The administration of LPS to Nav1.8-Cre Rosa26DTA mice induced death earlier than in controls."

sparser
"Interestingly, Nav1.8-Cre based Toll-like receptor 4 (TLR4) deletion attenuates acutely (day 1–5 post SNI) but not chronically (day 7 post SNI) the mechanical hypersensitivity in female mice, but has no effects on mechanical pain in male mice; conversely, TLR4 conditional deletion reduces cold allodynia up to day 7 post SNI as measured in male mice but not in female mice [ xref ]."

sparser
"GGCTGTATTCCCCTCCATCG and CCAGTTGGTAACAATGCCATGT Nav1.8-Cre genotyping Integrated DNA Technologies, Inc."

sparser
"The mice were bred with Nav1.8-Cre 18 or K5-Cre mice 19 to delete the Il31ra gene in C- and Aδ-fiber sensory neurons or keratinocytes."

sparser
"Strong staining signals for IL-31RA were largely colocalized with OSMR signals in a fraction of tdTomato + neurons in DRGs from Nav1.8-Cre Rosa26-CAG-floxStop-tdTomato (Nav1.8-Cre R26CAG-floxStop-tdTo[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"In DRGs from Nav1.8-Cre R26CAG-floxStop-tdTomato Il31ra fl/fl mice, IL-31RA signals but not OSMR signals were greatly diminished on tdTomato + neurons ( Figures 1 A and S1 B)."

sparser
"Nav1.8; YFP mice were generated by crossing Nav1.8-Cre +/+ mice (a line that was created by Dr."

sparser
"We then analyzed IL-31RA expression in the skin by whole-mount immunofluorescence staining of the ear skin from Nav1.8-Cre R26CAG-floxStop-tdTomato mice."

sparser
"The sequences of primers for genotyping Nav1.8-Cre (13Salt and Cre 5a) and wildtype (13Salt and 12A) alleles were: 13Salt: GGAATGGGATGGAGCTTCTTAC; 12A: TTAC CCGGTGTGTGCTGTAGAAAG; CRE 5a: CAAATGTTGCTGG[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Metabolomic analysis revealed that the KYN pathway was activated in Nav1.8-Cre Rosa26DTA mice following LPS administration."

sparser
"Reverse transcription quantitative PCR (RT-qPCR) analysis revealed that Il31ra was efficiently deleted in DRGs from Nav1.8-Cre Il31ra fl/fl mice and in epidermal sheets but not in DRGs from K5-Cre Il3[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"As mentioned above, early mortality in Nav1.8-Cre Rosa26DTA nociceptor-deficient mice during LPS-induced shock has been attributed to increased brain QUIN levels, and mortality in these mice is ameliorated by the central administration of an IDO1 inhibitor, suggesting that the peripheral influx of QUIN and other KYN metabolites into the brain during sepsis has a negligible effect on survival [ xref ] ( xref )."

sparser
"We found that IL-31-elicited scratching was absent in Nav1.8-Cre Il31ra fl/fl mice ( Figures 1 C and 1D), while compound 48/80 or chloroquine elicited intact scratching behavior in these mice ( Figure[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"27 Then, we analyzed pruritus development associated with MC903-induced dermatitis ( Figure 2 C) and found that Nav1.8-Cre Il31ra fl/fl mice showed less intense scratching behavior than control mice ([MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"The above results led us to examine the role for STAT3 in sensory neurons in IL-31-induced itch by generating Nav1.8-Cre Stat3 fl/fl mice."

sparser
"As expected, Stat3 expression was significantly reduced ( Figure 4 G), although the deletion efficiency might be lower than that of Il31ra in Nav1.8-Cre Il31ra fl/fl mice ( Figure S1 I)."

sparser
"Consistently, the frequency of somatostatin-expressing DRG neurons was not decreased in Nav1.8-Cre Stat3 fl/fl mice ( Figures S4 C and S4D)."

sparser
"The frequencies of Nav1.8-tdTomato + neurons expressing GFRα2 and GFRα1, which are encoded by Gfra2 and Gfra1 expressed in the NP1/Th subset and NP2 subset, respectively ( Figure 3 D), were comparable[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Axonal labeling is expected based on the labeling of peripheral sensory neurons by Nav1.8-Cre, and the projection of these neurons to the brain."

sparser
"Nav1.8-Cre mice were reported to express Cre in small-diameter neurons in DRGs from embryonic day 14."

sparser
"However, the same loss of Npy2r expression and impairment of pinprick-evoked responses were found in Nfia F/F ;Nav1.8-Cre mice (Fig.  xref A–D), in which the Cre recombinase is confined to DRG neurons, not in spinal neurons [ xref , xref ]."

sparser
"To understand which STAT genes are expressed in the sensory neuronal subsets, we performed scRNA-seq analysis of tdTomato + DRG neurons from Nav1.8-Cre R26CAG-floxStop-tdTomato mice ( Figures 3 A and [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Our analysis revealed that IL-31-elicited scratching behavior was virtually absent in Nav1.8-Cre Stat3 fl/fl mice ( Figures 4 A and 4B ), indicating that STAT3 in sensory neurons is required for IL-31[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"15 Scratching behavior elicited by compound 48/80, chloroquine, or N-methyl leukotriene C4 (mLTC4), a nonhydrolyzable form of leukotriene C4, which was reported to induce itch by acting on CysLTR2 exp[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"By immunofluorescence staining of DRG sections, we found that sensory neuronal expression of IL-31RA and OSMR was markedly diminished in Nav1.8-Cre Stat3 fl/fl mice ( Figures 4 E and 4F)."

sparser
"As expected, pSTAT3 staining signals were significantly diminished in DRGs of Nav1.8-Cre Stat3 fl/fl R26CAG-floxStop-tdTomato mice injected with IL-31 ( Figures S5 C and S5D)."

sparser
"Therefore, differentiation of non-peptidergic DRG neurons might not be grossly changed in Nav1.8-Cre Stat3 fl/fl mice."

sparser
"Future studies should address this possibility by comprehensive analysis such as scRNA-seq of DRG neurons from Nav1.8-Cre Stat3 fl/fl mice."

sparser
"By lineage tracing, Nav1.8-Cre targeted peripheral sensory neurons, a subpopulation of postganglionic sympathetics, and several regions of the brain."

sparser
"As previously described, the ZBTB20 gene is deleted specifically in nociceptors at E14 using Nav1.8-Cre, but deletion of this gene does not affect the formation, survival or diversification of nociceptors ( xref )."

sparser
"We selected the Nav1.8-Cre model for our study based on its relative specificity for the sensory nervous system and its capacity to modify the mTOR-mediated interoceptive pathways controlling the metabolic responses to diet."

sparser
"By contrast, TSC2 knockout with either Advillin-Cre or Nav1.8-Cre did not impact survival and improved axon regeneration after injury [ xref , xref , xref ]."

sparser
"To test this hypothesis, we bred Nav1.8-Cre mice with TSC2 fl/fl animals to conditionally deplete TSC2 in Nav1.8-expressing neurons."

sparser
"To determine the role of nociceptors in host defence, we bred Nav1.8-Cre mice with Cre-dependent diphtheria toxin A (DTA) mice to create Nav1.8-DTA (Nav1.8-Cre + DTA + ) nociceptor ablated mice and Cre − control littermates ( xref )."

sparser
"However, in addition to this, we observed regions of Nav1.8-Cre traced neural cell bodies in the superior olivary complex, hypothalamus, amygdala, bed nucleus of the stria terminalis, and caudoputamen ( xref E and xref )."

sparser
"We repeated these analyses using bone as a negative control since it is not targeted by Nav1.8-Cre."

sparser
"Crossing Ogt floxed mice with Nav1.8-Cre mice (which express Cre in sensory neurons in the dorsal root ganglia and trigeminal ganglia) resulted in decreased body weight, improved glucose tolerance, decreased epidermal innervation, and deficits in sensory behavior ( xref )."

sparser
"As a second approach for meningeal nerve ablation, Nav1.8-Cre mice were bred with CGRPα–GFP-DTR flox mice xref , in which Cre induces diphtheria toxin receptor (DTR) expression under Calca and enables DTX-mediated ablation of Nav1.8 + CGRP + neurons."

sparser
"If one phenotype can be attributed to the deletion of Asic1a at the DRG level, TRPV1-Cre ( Cavanaugh et al., 2011 ) or Nav1.8-Cre ( Stirling et al., 2005 ) would be useful to selectively target ASIC1a[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Therefore, the Nav1.8Cre mouse line is a valuable tool for analysing the effects of deleting floxed genes on pain behaviour and has, in fact, been successfully used for this purpose (Huang et al.  xref ; Nassar et al.  xref , xref )."

sparser
"Analysis of gene expression by RNAscope within the periapical lesion demonstrated that there is greater expression of Runx2 mRNA (expressed in osteoblasts) in Nav1.8-DTA mice 3 days following pulp exposure compared to Nav1.8-Cre ( p  = 0.01), whereas there is not a significant difference at 7 days ( p  = 0.46) (Fig.  xref d, f) ( n  = 8–11 per group)."

sparser
"There was also a reduced expression of osteocalcin at 3 days in Nav1.8-DTA compared to Nav1.8-Cre mice ( p  = 0.03), but no significant differences at day 7 ( p  = 0.95) (Fig.  xref b, d, e) ( n  = 7–10 per group)."

sparser
"Co-culture of IDG-SW3 osteoblast precursor cells with TG neurons from Nav1.8-DTA mice resulted in decreased expression of DMP1 compared to cultures with Nav1.8-Cre TG neurons ( p  < 0.01) and with no neurons ( p  < 0.01) (Fig.  xref f, g)."

sparser
"This inhibition is further and significantly greater when osteoblasts were co-cultured with primary trigeminal cultures from Nav1.8-DTA mice (27 ± 6.8% of control; p  = 0.04) (Fig.  xref a, b), whereas there were no significant differences between Nav1.8-cre and Nav1.8-DTA TG culture for Alizarin Red staining ( p  = 0.88) (Fig.  xref c, d)."

sparser
"To further complicate the issue, it has been recently reported that many transgenic lines that are thought to have sensory neuron specific transgene expression, such as Advillin-Cre, Nav1.8-Cre, and P[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Co-culture of murine osteoclast precursor cells (RAW264.7) with primary TG neurons inhibited resorption activities compared to control (67 ± 6.1% of control; p  < 0.001) This inhibition was partially reversed by co-culture with neurons from Nav1.8-DTA mice (85 ± 10% of control; p  < 0.01) but was still lower compared to Nav1.8-Cre ( p  = 0.04) (Fig.  xref g) ( n  = 6–7 per group)."

sparser
"Upon counting the number of multinucleated osteoclast-like cells, co-cultures with control and Nav1.8-DTA TG neurons had a reduced number of multinucleated cells compared to Nav1.8-Cre ( p  = 0.01, 0.02, respectively) (Fig.  xref h)."

sparser
"To exclude the possibility of any confounding TRPV1 expression on non-neuronal cells we crossed Nav1.8-Cre mice to conditional DTA mice (Nav1.8Cre DTA )."

sparser
"Nav1.8 expression is restricted to neuronal cell subsets xref , and the use of the Nav1.8-Cre mouse line allowed efficient targeting of CGRP expressing neurons xref , xref ."

sparser
"Of note, while there is a significant overlap between TRPV1-Cre genetic targeting and that of Nav1.8-Cre mice, Nav1.8-Cre recombination also targets some low threshold mechano-receptor (LTMR) neuronal subpopulations, which are not captured by the TRPV1-Cre line xref , xref ."

sparser
"Interestingly, only Nav1.8-Cre, not Nav1.8-DTA, cultures exhibited the upregulation of genes in “Regulation of Bone Remodeling” (11 genes)."

sparser
"Within downregulated genes, co-culture with Nav1.8-DTA TG neurons exhibited greater numbers of genes in biological processes including “Biomineralization” (17 vs. 8 genes) compared to Nav1.8-Cre cultures."

sparser
"Using ChR2 floxed to Nav1.8-Cre to label the DRG neurons, it is found that these Nav1.8-ChR2-positive neurons cover Aβ-, Aδ-, and C-fiber mechanoreceptors (low-threshold mechanoreceptors, LTMRs) [ xref ]."

sparser
"Experiments in Nav1.8cre mice showed that gut sensory innervation facilitated neuronal communication with intestinal goblet cells via the interaction of CGRP with the receptor activity-modifying prot[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Corneal axons were visualized using Nav1.8-Cre;tdTomato reporter mice."

sparser
"Innervation of the cornea was visualized in whole-mounted corneas using a tdTomato fluorescent reporter expressed with the Nav1.8-Cre promoter."

sparser
"Nav1.8-Cre; tdTomato labeling of corneal innervation was validated using PGP9.5 as a pan-neuronal marker in a naïve Nav1.8-Cre; tdTomato animal."

sparser
"As most corneal axons were labeled with tdTomato, subsequent studies quantified innervation density using the Nav1.8-Cre;tdTomato reporter, conducting an overlayed Sholl analysis on the max projection z-stack images."

sparser
"Using Nav1.8-Cre;tdTomato mice to examine corneal innervation, we observed an almost complete loss of axon terminals through superficial layers of the corneal epithelium to the subbasal nerve plexus at 7-days following LGE in both male and female mice."

sparser
"A previous study, also using Nav1.8-Cre;tdTomato mice, found no difference in innervation density at 14-days after excision of only the extraorbital lacrimal gland ( xref ), indicating that the severity of dry eye likely contributed to the amount of denervation observed in the present study."

sparser
"Nav1.8-Cre mice were bred with tdTomato reporter mice to label sensory neurons."

sparser
"The use of the Nav1.8-Cre;tdTomato reporter appeared to label the vast majority of corneal afferents, with the likely exception of autonomic neurons and up to 80% of cool sensing neurons that do not express Nav1.8, indicating that use of this mouse could be a valuable tool in longitudinal studies to track corneal sensory innervation ( xref ; xref )."

sparser
"In our experiments, attempts to breed Ai140 mice with Wnt1-Cre or Nav1.8-Cre mice were similarly unsuccessful, likely due to embryonic lethality (data not shown)."

sparser
"Using Nav1.8-cre;tdTomato mice, corneal innervation was investigated and analyzed using Sholl and pixel analysis."

sparser
"Robust labeling of the subbasal nerve plexus and intraepithelial terminals were observed in the corneas of Nav1.8-cre;tdTomato mice (Fig.  xref A)."

sparser
"However, the large reduction in tearing quantified in the Nav1.8-cre;tdTomato mice after single LGE in both female and male mice is consistent with our previous study using this model xref ."

sparser
"To examine corneal innervation, the Nav1.8-cre;tdTomato reporter mouse line was utilized, since the voltage-gated sodium channel Nav1.8 is preferentially expressed in C-fibers, including > 90% of IB4-binding neurons (nonpeptidergic C-fibers) and CGRP-positive neurons (peptidergic C-fibers) xref ."

sparser
"Characterization of Nav1.8-cre;tdTomato mice showed robust corneal afferent neuronal labeling, including the subbasal nerve plexus and intraepithelial nerve terminals."

sparser
"In a melanoma model, Nav1.8-Cre mice, which express Cre only in Nav1.8 + (also known as SCN10A + ) sensory neurons, were crossed with mice expressing mutant G protein-coupled receptors that can either induce or inhibit sensory neuron activity."

sparser
"Conditional knockout of DOR from peripheral nociceptors was achieved by crossing floxed DOR mice with a Nav1.8-Cre line, as was previously described ( xref )."

sparser
"On the other hand, DRG neurons targeted in this study (YFP (+) after crossing with Nav1.8-Cre mice) are >90% nociceptors, but not all nociceptors express Nav1.8 in vivo."

sparser
"Sperm from Nav1.8-Cre mice (B6;129-Scn10atm(cre)Jnw/H, stock ID EM:04582) was purchased from the European Mouse Mutant Archive, and in vitro fertilization was performed."

sparser
"To determine whether Ci1 mice are compatible with other Cre lines besides Wnt1-Cre , we crossed Ci1 mice with Nav1.8-Cre, Vgat-Cre , and MrgprD-CreER T2 strains."

sparser
"In Nav1.8-Cre;Ci1 mice, nociceptive axons in glabrous, hairy skin and DRG were clearly visualized (Fig. xref A–C)."

sparser
"Our findings are further reinforced by a previous study showing that peripheral CB1 antagonism via spinal sensory neurons induces hypophagia through a leptin-melanocortin-dependent pathway in the hypothalamus. xref Moreover, another study highlighted a significant role of Nav1.8 expressing neurons in communicating energy signals across the gut-brain axis by regulating periodic food intake and microbial interaction with the host. xref The Nav1.8-Cre mouse model, used as a specific sensory neuron marker, shows minimal alterations in neuronal functions when crossed with other p-loxed strains. xref , xref Although several studies have shown that vagal afferent fibers are essential for regulating other meal termination and reward-related feeding behaviors, xref , xref , xref our findings suggest that spinal sensory pathways mediate the selective effects of peripheral CB1 signaling on food intake, possibly by affecting other feeding behavior aspects such as meal initiation or interval periods between meals."

sparser
"To demonstrate the usefulness of Ci1 in embryonic studies, we examined Nav1.8-Cre;Ci1 mice at E18.5."