IndraLab

"Based on previous studies in which interaction of nNOS with SCN5A was identified [ xref ; xref ; xref ], we hypothesized that there might be endogenous nNOS activity in HEK-293 cells which might underlie the increased late I Na for Cav3-F97C. We performed RT-PCR assay using nNOS-specific primers (forward: 5 acgtcttcctcatgtctaagttca; reverse: 5 ctgtgacaactcccgctaca) to detect the nNOS mRNA in the cell lysates."

"A257G-SNTA1 can functionally interact with SCN5A in HEK293 cells without requiring nNOS or PMCA4b."

"Like other syntrophin isoforms (β1, β2, γ1, and γ2), SNTA1 (α1) comprises four conserved domains, two pleckstrin homology domains (PH1 and PH2) which are involved in the recruitment of proteins to the sarcolemma, xref a PDZ domain which inserts within PH1 and has been shown to bind to nNOS and SCN5A, xref , xref and a syntrophin unique COOH-terminal domain (SU) which binds SNTA1 to dystrophin. xref The fact that there are up to four SNTA1 binding sites in close proximity within a single dystrophin complex xref suggests that SNTA1 probably brings several signaling molecules together to form a large signaling complex. xref "