IndraLab
Statements
Pyraclofos activates KCNMA1. 63 / 63
|
4
37
22
sparser
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage-activated BK channel."
sparser
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well-established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner xref , xref ."
reach
"The large-conductance Ca 2+ - and voltage activated K + (MaxiK, BK, BK Ca, Slo1, K Ca 1.1) channel role in cell signalling is becoming apparent as we learn how the channel interacts with a multiplicity of proteins not only at the plasma membrane but in intracellular organelles including the endoplasmic reticulum, nucleus and mitochondria."
reach
"Cell membrane voltage and intracellular Ca 2+ activate Slo1 synergistically, making it a central regulator of various physiological processes that couple electrical signaling to Ca 2+ -mediated events such as muscle contraction, hormone secretion, and neuronal excitability XREF_BIBR, XREF_BIBR."
reach
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval XREF_BIBR in a manner similar to that mediated by Cav3 channels in MVN cells."
sparser
"Using the patch-clamp technique and a novel in situ enzymological approach, we measured the rates and extents of changes in BK channel voltage activation from SMC inside-out patch preparations in response to selective activation and inhibition of channel-associated protein phosphatases and kinases (CAPAKs)."
sparser
"We found that the interdomain interactions between these two positions not only alter the local conformations near the Mg 2+ -binding site but also change distant conformations including the pore-gate domain, thereby affecting the voltage- and Ca 2+ -dependent activation of the BK channel."
reach
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage activated BK channel."
reach
"Consistent with this, and in contrast to the Ca 2+ dependence observed for slo-1 transfected cells, we observed robust voltage activated K + currents from cells expressing kcnma1 with 300 nM intracellular Ca 2+ (XREF_FIG; mean peak current at +90 mV of 2.74 +/- 0.11 nA, n = 50; P < 0.001 compared to egfp alone, unpaired Student 's t-test)."
reach
"5 ng of cDNA was used along with Power SYBR Green PCR Master Mix (ThermoFisher, # 4367660) and primers designed against large-conductance calcium- and voltage-activated potassium (BK) channel subunit mRNA (Rat Kcnma1: Forward AGCGCGGTTAGTGGAAGAAA, Reverse AGGTTAGGGGAGATGTTGTGA; Rat Kcnmb1: Forward TAGAGCTCCAAGGCCTGACT, Reverse GGCAACAGTCATTTAGTTCCCTG; Rat Kcnmb2: Forward TGAAGATCAATCAAAAGTGCTCC, Reverse GACGACACTCACAAGGGACA; Rat Kcnmb3: Forward CAACCTTAGCCACTCGGGAC, Reverse GTGTGTAAAAGCACTTGGGGT; Rat Kcnmb4: Forward CCTGACTAACCCCAAGTGCTC, Reverse GTGAATGGCTGGGAACCGAT) and compared to a reference transcript (Rat Gapdh: Forward AGTGCCAGCCTCGTCTCATA, Reverse GTAACCAGGCGTCCGATACG)."
sparser
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval xref in a manner similar to that mediated by Cav3 channels in MVN cells."
reach
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner XREF_BIBR, XREF_BIBR."
reach
"These might include any of the signal transduction pathway components downstream of LAT-1 identified previously [58] and depicted in Fig 3 or additional, currently unidentified loci.Taken together, the studies in C. elegans and parasitic nematodes have identified the calcium- and voltage-activated potassium channel SLO-1 as the major receptor mediating emodepside’s anthelmintic action."