IndraLab

Statements


| 4 50 32

sparser
"It is not clear how N536H and N995S allosterically enhance BK channel voltage dependent activation at molecular level."

sparser
"It is also intriguing that even though both N536H and N995S specially promote BK channel voltage dependent activation, the patients carrying these variants do not exhibit identical symptoms."

reach
"Moreover, LRRC26, a regulatory subunit of the Ca - and voltage-activated BK channel, is functionally expressed by the mucin-secreting goblet cells in the GI tract and LRRC26-associated BK channels contribute to the resting transepithelial current across mouse distal colonic mucosa."

sparser
"The BK channel is activated by both voltage and Ca 2+ and is well expressed in the detrusor (Petkov,  xref )."

reach
"This is one of many observations that led to the proposition of an allosteric mechanism for the voltage dependent activation of the BK channel."

sparser
"Thus the current model of the conformational change underlying BK channel voltage sensor activation involves the combined motion of at least the S2–S4 segments."

reach
"Large conductance BK-type K channels (Slo1) are activated by voltage and intracellular Ca 2+, play an important role in synaptic physiology, and are present in parts of the brain that contain synaptic Cu 2+ and Zn 2+."

reach
"The Slo1 core and Slo3 tail construct is completely calcium independent and is only activated by voltage."

reach
"As shown in Fig. 4A–D, salicylate at all concentrations (0.1, 1, 2, 5 mM) significantly altered the voltage-dependent activation of the BK channel."

reach
"Cell membrane voltage and intracellular Ca 2+ activate Slo1 synergistically, making it a central regulator of various physiological processes that couple electrical signaling to Ca 2+ -mediated events such as muscle contraction, hormone secretion, and neuronal excitability XREF_BIBR, XREF_BIBR."

sparser
"The activation of a single BK channel by voltage is shown in Figure xref for voltages ranging from −70 to +100 mV with Ca 2+ fixed at 95 μM Ca 2+ ."

reach
"On the contrary, at micromolar levels (100 muM) tungstate still promotes voltage dependent activation of the vascular (beta 1 subunit containing) BK channel without reducing K + current amplitude."

sparser
"The joint activation of a BK channel by voltage and Ca 2+ is shown in Figure xref ."

sparser
"Hence, the 50 state Scheme 6 is consistent with the voltage and Ca 2+ dependent activation of the BK channel."

reach
"XREF_BIBR, XREF_BIBR We also compare Slo3 pharmacological sensitivity to that of its closely related homologue, the Ca 2+ - and voltage activated Slo1 (or BK-type) K + channel."

reach
"Third, the BK channel can be independently activated by Ca 2+ or voltage, and it can open in the absence of Ca 2+."

eidos
"While it is known that BK channels are activated by voltage and Ca 2 + , and that voltage and Ca 2 + activations interact , less is known about the mechanisms involved ."

reach
"We isolated the effect of Ca 2+ binding on voltage sensor activation from its effect on channel opening by taking advantage of the fact that C-O transition kinetics are much slower than voltage sensor activation in Slo1 channels."

sparser
"This is in parallel with our very limited understanding of the detailed molecular mechanisms underlying BK channel activation by voltage and Ca 2+ , which is partly due to the lack of atomic structure, particularly the structure that includes the channel’s TM domain."

reach
"As a result KCa1.1 channels are typically activated by relatively large voltage responses such as spike discharge, thereby contributing to spike repolarization and a fast AHP (fAHP) [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"Moreover, LRRC26, a regulatory subunit of the Ca 2+ - and voltage-activated BK channel, is functionally expressed by the mucin-secreting goblet cells in the GI tract and LRRC26-associated BK channels contribute to the resting transepithelial current across mouse distal colonic mucosa."

sparser
"Voltage- and Ca 2+ -dependent activation of Slo1 was negatively correlated with the C-linker length ( xref )."

sparser
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage-activated BK channel."

sparser
"To test whether LOP inhibition required activation of the CSD, we measured the effect of LOP on voltage-activated BK channel current in the nominal absence of Ca 2+ ."

reach
"This is in parallel with our very limited understanding of the detailed molecular mechanisms underlying BK channel activation by voltage and Ca 2+, which is partly due to the lack of atomic structure, particularly the structure that includes the channel 's TM domain."

reach
"Both intracellular calcium and voltage activate Slo1, a high-conductance potassium channel, linking calcium with electrical excitability."

reach
"Low voltage activation of KCa1.1 current by Cav3-KCa1.1 complexes."

reach
"This scheme is analogous to the postulated mechanisms of coupling of voltage sensor activation and Ca 2+ binding in the BK channel in which the interaction occurs only in the same subunit."

sparser
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well-established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner xref , xref ."

reach
"It is interesting to note that LRR proteins, such as LRRC26, are also known to modulate large conductance, calcium- and voltage-activated potassium channel, also known as BK Ca , Maxi-K, K Ca 1.1, or [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Fungal metabolites include a variety of indole alkaloids, among which are the most potent nonpeptidergic blockers of Ca 2+ - and voltage-activated Slo1 (KCNMA1) large-conductance Ca 2+ -activated K + (BK)-type K + channels yet identified."

reach
"Consistent with this, and in contrast to the Ca 2+ dependence observed for slo-1 transfected cells, we observed robust voltage activated K + currents from cells expressing kcnma1 with 300 nM intracellular Ca 2+ (XREF_FIG; mean peak current at +90 mV of 2.74 +/- 0.11 nA, n = 50; P < 0.001 compared to egfp alone, unpaired Student 's t-test)."

eidos
"When the pipette solution without any Ca2 + , the BK channel ( alpha + beta1 ) is activated only by voltage ."

reach
"Therefore, we revisited the possibility that LRRC26 modulates the Ca 2+ sensitivity by measuring the voltage-dependent activation of Slo1 and Slo1-LRRC26 complexes under 1 μM CaCl 2 condition ( Figure[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The tremorogenic fungal metabolite, paxilline, is widely used as a potent and relatively specific blocker of Ca 2+ - and voltage activated Slo1 (or BK) K + channels."

reach
"The BK channel can be activated by a depolarizing voltage and increases in intracellular Ca ."

reach
"The voltage activation of Ce SLO-1 and hum KCNMA1 was tested before and during the peak of the emodepside facilitation (i.e. after 12 min application of 100 nM emodepside for Ce SLO-1 and after 5 min application of 100nM emodepside for hum KCNMA1; XREF_FIG)."

reach
"In this study, we find that benzbromarone is an activator of the large-conductance Ca 2+ - and voltage-activated K + channel (BK channel) that serves numerous cellular functions including control of smooth muscle contraction."

reach
"Fungal metabolites include a variety of indole alkaloids, among which are the most potent nonpeptidergic blockers of Ca 2+ - and voltage activated Slo1 (KCNMA1) large-conductance Ca 2+ -activated K + (BK)-type K + channels yet identified."

sparser
"Expression of markers associated with inflammation (NFκB p65 [phospho‐nuclear factor kappa B p65] and TNF‐α [tumor necrosis factor alpha]) and with oxidative stress (NADPH oxidases 2 and 4) were lowered and subunits of the voltage and Ca 2+ activated K + BK channel (potassium calcium‐activated channel subfamily M alpha 1 and potassium calcium‐activated channel subfamily M regulatory beta subunit 1) in the carotid artery were modulated."

eidos
"BK channel activation by voltage and Ca2 + can be well described by the HA allosteric model ( Horrigan and Aldrich , 2002 ; Figure 8a ) ."

reach
"Such a mutation in the RCK2 domain increases BK channel currents by increasing voltage sensitivity but does not affect Ca -dependent activation."

sparser
"The voltage-activated BK channel, a potassium channel, delivers K + into the lysosomal lumen from the cytosol."

sparser
"BK channel activation by voltage and Ca 2+ can be well described by the HA allosteric model ( xref ;  xref )."

reach
"The well-studied large-conductance Ca 2+ - and voltage-activated K + Slo1 (BK, Maxi-K, or KCa1.1) channels are dually activated by membrane depolarization and intracellular Ca 2 + ( 2 )."

reach
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage activated BK channel."

reach
"The study of Pietrzykowski et al. (2008) , demonstrated the regulation of calcium- and voltage-activated potassium channel (BK channel), whose splice variant stability provided by miR-9 underlies neur[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"In contrast, voltage dependent steady-state activation of the Slo1 channel was markedly altered by BOXes (XREF_FIG)."

sparser
"The large-conductance, calcium- and voltage-activated potassium channel, or BK channel, is a conserved target of ethanol."

sparser
"Using the patch-clamp technique and a novel in situ enzymological approach, we measured the rates and extents of changes in BK channel voltage activation from SMC inside-out patch preparations in response to selective activation and inhibition of channel-associated protein phosphatases and kinases (CAPAKs)."

reach
"This peptide was shown to upmodulate the Ca and voltage-activated BK currents (KCa1.1) measured from rat adrenal chromaffin cells and did not affect other voltage-gated channels."

reach
"These might include any of the signal transduction pathway components downstream of LAT-1 identified previously [58] and depicted in Fig 3 or additional, currently unidentified loci.Taken together, the studies in C. elegans and parasitic nematodes have identified the calcium- and voltage-activated potassium channel SLO-1 as the major receptor mediating emodepside’s anthelmintic action."

reach
"Diethylcarbamazine increases voltage activated SLO-1 currents and hyperpolarizes V 50."

reach
"Low Voltage Activation of KCa1.1 Current by Cav3-KCa1.1 Complexes."

reach
"The predominant potassium channel in these cells is the calcium- and voltage activated maxi-K channel with a single-channel conductance greater than 100 pS."

reach
"The increase in intracellular Ca concentration or the change in voltage activates the BK channel so that the intracellular K flows out through the pore of the channel composed of the α subunit, thereby dilating blood vessels and maintaining a balance of vascular tension [14]."

reach
"The voltage dependent activation of SLO-1 and SLO-2 channels is modulated by calcium (for SLO-1 and SLO-2) and chloride (for SLO-2) [XREF_BIBR, XREF_BIBR]."

sparser
"We observed decreased expression of Slob , an auxiliary subunit of the Slo (BK) voltage and Ca 2+ activated K + channel ( xref , xref ), but this only occurred in the Rbp knockdown ( xref and)."

sparser
"We found that the interdomain interactions between these two positions not only alter the local conformations near the Mg 2+ -binding site but also change distant conformations including the pore-gate domain, thereby affecting the voltage- and Ca 2+ -dependent activation of the BK channel."

sparser
"Expression was also reduced in Slob , an auxiliary subunit of the Slo (BK) voltage and Ca 2+ activated K + channel ( xref ), but this only occurred in the Rbp knockdown ( xref and)."

reach
"KCa1.1 channels can be activated by voltage alone, but coincident calcium entry shifts the voltage dependence of activation of KCa1.1 channels into a physiologically relevant range XREF_BIBR, XREF_BIBR - XREF_BIBR."

sparser
"When the pipette solution without any Ca 2+ , the BK channel (α+β1) is activated only by voltage."

reach
"5 ng of cDNA was used along with Power SYBR Green PCR Master Mix (ThermoFisher, # 4367660) and primers designed against large-conductance calcium- and voltage-activated potassium (BK) channel subunit mRNA (Rat Kcnma1: Forward AGCGCGGTTAGTGGAAGAAA, Reverse AGGTTAGGGGAGATGTTGTGA; Rat Kcnmb1: Forward TAGAGCTCCAAGGCCTGACT, Reverse GGCAACAGTCATTTAGTTCCCTG; Rat Kcnmb2: Forward TGAAGATCAATCAAAAGTGCTCC, Reverse GACGACACTCACAAGGGACA; Rat Kcnmb3: Forward CAACCTTAGCCACTCGGGAC, Reverse GTGTGTAAAAGCACTTGGGGT; Rat Kcnmb4: Forward CCTGACTAACCCCAAGTGCTC, Reverse GTGAATGGCTGGGAACCGAT) and compared to a reference transcript (Rat Gapdh: Forward AGTGCCAGCCTCGTCTCATA, Reverse GTAACCAGGCGTCCGATACG)."

reach
"As a difference with Ca 2+ and voltage activated BK channel subunit (Kcnma1), mGluR2 and mGluR3 expression, the deficit in Kv3.4 expression was detected late into the epileptogenenic process (more than 1 month following SE)."

reach
"The large-conductance Ca 2+ - and voltage activated K + (MaxiK, BK, BK Ca, Slo1, K Ca 1.1) channel role in cell signalling is becoming apparent as we learn how the channel interacts with a multiplicity of proteins not only at the plasma membrane but in intracellular organelles including the endoplasmic reticulum, nucleus and mitochondria."

sparser
"We further characterized the effects of the β1 and β2 subunits on the calcium and voltage sensitivity of the channel, analyzing the data in the context of an allosteric model for BK channel activation by calcium and voltage ( xref )."

reach
"The Slo1 channel is activated by both voltage and intracellular Ca 2+ while the IK and SK channels are gated by intracellular Ca 2+ alone."

reach
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval XREF_BIBR in a manner similar to that mediated by Cav3 channels in MVN cells."

sparser
"The Slo family includes the Maxi-K (or BK) channel, or Slo1, which is activated by both voltage and Ca 2+ [ xref ]."

sparser
"Third, the BK channel can be independently activated by Ca 2+ or voltage, and it can open in the absence of Ca 2+ ."

sparser
"The KvAP channel is from the thermophilic archaebacteria Aeropyrum pernix while the HsapBK channel is the Human calcium and voltage-activated BK channel."

sparser
"The leftward shift in G–V relation could be attributed to an action of NS11021 on voltage-dependent BK channel activation, deactivation, or both."

reach
"Low voltage activation of KCa1.1 current by Cav3-KCa1.1 complexes."

sparser
"As shown in Fig.  xref A–D, salicylate at all concentrations (0.1, 1, 2, 5 mM) significantly altered the voltage-dependent activation of the BK channel."

sparser
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval xref in a manner similar to that mediated by Cav3 channels in MVN cells."

reach
"Reports of voltage dependent activation of BK channel currents at very low Ca 2+ concentrations and after treatment to remove Ca 2+ sensitivity suggest the possibility of an intrinsic voltage dependence as well."

reach
"The Slo family includes the Maxi-K (or BK) channel, or Slo1, which is activated by both voltage and Ca 2+ [XREF_BIBR]."

reach
"To test whether LOP inhibition required activation of the CSD, we measured the effect of LOP on voltage-activated BK channel current in the nominal absence of Ca ."

sparser
"We measured the voltage-dependent activation of the D369A/D370A mutant of Slo1 in the nominal absence of [Ca 2+ ] i with the excised inside-out patch recordings ( Figure 3 C; Table S1 )."

sparser
"Therefore, we revisited the possibility that LRRC26 modulates the Ca 2+ sensitivity by measuring the voltage-dependent activation of Slo1 and Slo1-LRRC26 complexes under 1 μM CaCl 2 condition ( Figure[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

eidos
"BK channels are activated by voltage and intracellular calcium in a cooperative manner [ 30 ] ."

reach
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner XREF_BIBR, XREF_BIBR."

reach
"BK channel activation by voltage and Ca 2+ can be well described by the HA allosteric model."

reach
"When the pipette solution without any Ca , the BK channel (α+β1) is activated only by voltage."

reach
"The KvAP channel is from the thermophilic archaebacteria Aeropyrum pernix while the HsapBK channel is the Human calcium and voltage-activated BK channel."

reach
"The large-conductance calcium- and voltage-activated potassium (BK; also known as MaxiK, K 1.1, Slo1) channel, encoded by the KCNMA1 gene, is a transmembrane protein with a large conductance and exceptional selectivity for potassium."