IndraLab
Statements
Pyraclofos activates KCNMA1. 84 / 84
|
4
50
30
reach
"Moreover, LRRC26, a regulatory subunit of the Ca - and voltage-activated BK channel, is functionally expressed by the mucin-secreting goblet cells in the GI tract and LRRC26-associated BK channels contribute to the resting transepithelial current across mouse distal colonic mucosa."
reach
"Cell membrane voltage and intracellular Ca 2+ activate Slo1 synergistically, making it a central regulator of various physiological processes that couple electrical signaling to Ca 2+ -mediated events such as muscle contraction, hormone secretion, and neuronal excitability XREF_BIBR, XREF_BIBR."
sparser
"Moreover, LRRC26, a regulatory subunit of the Ca 2+ - and voltage-activated BK channel, is functionally expressed by the mucin-secreting goblet cells in the GI tract and LRRC26-associated BK channels contribute to the resting transepithelial current across mouse distal colonic mucosa."
sparser
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage-activated BK channel."
sparser
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well-established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner xref , xref ."
reach
"Consistent with this, and in contrast to the Ca 2+ dependence observed for slo-1 transfected cells, we observed robust voltage activated K + currents from cells expressing kcnma1 with 300 nM intracellular Ca 2+ (XREF_FIG; mean peak current at +90 mV of 2.74 +/- 0.11 nA, n = 50; P < 0.001 compared to egfp alone, unpaired Student 's t-test)."
sparser
"Expression of markers associated with inflammation (NFκB p65 [phospho‐nuclear factor kappa B p65] and TNF‐α [tumor necrosis factor alpha]) and with oxidative stress (NADPH oxidases 2 and 4) were lowered and subunits of the voltage and Ca 2+ activated K + BK channel (potassium calcium‐activated channel subfamily M alpha 1 and potassium calcium‐activated channel subfamily M regulatory beta subunit 1) in the carotid artery were modulated."
sparser
"Using the patch-clamp technique and a novel in situ enzymological approach, we measured the rates and extents of changes in BK channel voltage activation from SMC inside-out patch preparations in response to selective activation and inhibition of channel-associated protein phosphatases and kinases (CAPAKs)."
reach
"Intriguingly, myographic analysis revealed that Ca v 1.2 and Ca v 3.3 promote arterial constriction (with the former predominating at higher and the latter at lower pressures), whereas Ca v 3.2 promoted vasodilation through a mechanism involving activation of the Ca 2+ - and voltage activated BK channel."
reach
"These might include any of the signal transduction pathway components downstream of LAT-1 identified previously [58] and depicted in Fig 3 or additional, currently unidentified loci.Taken together, the studies in C. elegans and parasitic nematodes have identified the calcium- and voltage-activated potassium channel SLO-1 as the major receptor mediating emodepside’s anthelmintic action."
reach
"5 ng of cDNA was used along with Power SYBR Green PCR Master Mix (ThermoFisher, # 4367660) and primers designed against large-conductance calcium- and voltage-activated potassium (BK) channel subunit mRNA (Rat Kcnma1: Forward AGCGCGGTTAGTGGAAGAAA, Reverse AGGTTAGGGGAGATGTTGTGA; Rat Kcnmb1: Forward TAGAGCTCCAAGGCCTGACT, Reverse GGCAACAGTCATTTAGTTCCCTG; Rat Kcnmb2: Forward TGAAGATCAATCAAAAGTGCTCC, Reverse GACGACACTCACAAGGGACA; Rat Kcnmb3: Forward CAACCTTAGCCACTCGGGAC, Reverse GTGTGTAAAAGCACTTGGGGT; Rat Kcnmb4: Forward CCTGACTAACCCCAAGTGCTC, Reverse GTGAATGGCTGGGAACCGAT) and compared to a reference transcript (Rat Gapdh: Forward AGTGCCAGCCTCGTCTCATA, Reverse GTAACCAGGCGTCCGATACG)."
reach
"The large-conductance Ca 2+ - and voltage activated K + (MaxiK, BK, BK Ca, Slo1, K Ca 1.1) channel role in cell signalling is becoming apparent as we learn how the channel interacts with a multiplicity of proteins not only at the plasma membrane but in intracellular organelles including the endoplasmic reticulum, nucleus and mitochondria."
sparser
"We found that the interdomain interactions between these two positions not only alter the local conformations near the Mg 2+ -binding site but also change distant conformations including the pore-gate domain, thereby affecting the voltage- and Ca 2+ -dependent activation of the BK channel."
reach
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval XREF_BIBR in a manner similar to that mediated by Cav3 channels in MVN cells."
sparser
"A relatively low voltage activation of KCa1.1 channels by Cav1.3-mediated calcium influx has also been shown in chromaffin cells, where KCa1.1 current contributes to AHPs and modifying the interspike interval xref in a manner similar to that mediated by Cav3 channels in MVN cells."
reach
"The biophysical mechanism of BK channel activation by voltage and Ca 2+ can be described by a well established allosteric gating model, in which the channel pore opening is allosterically regulated by the movement of each voltage sensor and the binding of Ca 2+ at each Ca 2+ sensor on the four subunits in a largely independent manner XREF_BIBR, XREF_BIBR."