IndraLab

Statements


USP15 is modified
37 | 40 5
USP15 is phosphorylated.
37 | 32 5
USP15 is phosphorylated. 10 / 22
| 19 3

sparser
"However, as it is shown here, inhibition of USP15 phosphorylation by curcumin in HeLa cell lysates caused the formation of high-molecular-weight USP15 species, most likely USP15-Ub conjugates ( Figure[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"In that study, phosphorylation of USP15 at Thr149 or Thr219 affected USP15 interaction with its substrates; however, they did not affect intrinsic USP15 catalytic activity ( xref )."

sparser
"Here, we show that USP15 is phosphorylated, and its localization and activity are dependent on the phosphorylation status."

sparser
"As pervasive mitotic phosphorylation often inactivates protein functions [ xref ], USP15 phosphorylation may abrogate its role in stabilising REST at mitosis, allowing REST to degrade."

sparser
"In BRCA, several databases, including GEPIA and UALCAN, describe the upregulation of total protein levels and USP15 phosphorylation."

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."

sparser
"Future structural and biochemical studies will help to inform the precise mechanisms that coordinate the phosphorylation of USP15, the binding of TIFAB, and the conformation of USP15."

sparser
"The phosphorylated USP15 was recruited to DSBs (Fig.  xref and Supplementary Fig.  xref ), while the S678A mutant, which abolished its phosphorylation by ATM, could not be recruited to DSBs (Fig.  xref )."

sparser
"We next wanted to figure out whether USP15 phosphorylation affects its localization in cells."

sparser
"Finally, USP15 is phosphorylated by ATR/ATM and is known to cleave ubiquitin from IκB, thus dampening the NF-κB response (see below)."
USP15 is phosphorylated on S229. 10 / 14
10 | 2 2

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

sparser
"The kinase that phosphorylates USP15 at S229 remains to be experimentally determined."

No evidence text available

rlimsp
"Although USP15 is predominantly cytoplasmic in interphase, we show that both isoforms move into the nucleus at prophase, but that isoform-1 is phosphorylated on its unique S229 residue at mitotic entry. The micronuclei phenotype we observe on USP15 depletion can be rescued by either USP15 isoform and requires USP15 catalytic activity. Importantly, however, an S229D phospho-mimetic mutant of USP15 isoform-1 cannot rescue either the micronuclei phenotype, or accumulation of TOP2A. Thus, S229 phosphorylation selectively abrogates this role of USP15 in maintaining genome integrity in an isoform-specific manner."

No evidence text available
USP15 is phosphorylated on S965. 8 / 8
8 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
USP15 is phosphorylated on S961. 6 / 6
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
USP15 is phosphorylated on S678. 5 / 5
| 5

sparser
"These results clearly indicate that USP15 Ser678 phosphorylation is required for its function in HR."

sparser
"USP15 is phosphorylated at Ser678 and recruited to DSBs."

sparser
"We confirmed that USP15 S678 phosphorylation is essential for its functions in HR and genome stability."

sparser
"As shown in Fig.  xref , mutation at Ser678 abolished ATM-dependent USP15 phosphorylation, indicating that Ser678 is the major ATM phosphorylation site of USP15."

sparser
"Mechanistically, USP15 is recruited to DNA double-strand breaks (DSBs) by MDC1, which requires the FHA domain of MDC1 and phosphorylated Ser678 of USP15."
USP15 is phosphorylated on T149. 3 / 3
| 3

sparser
"Recent studies have also shown the forms of USP15 phosphorylated at Thr149 and Thr219 residues are predominantly localized in the cytoplasm."

sparser
"Nuclear-cytoplasmic fractionation and mass spectrometric analysis revealed that Thr149 and Thr219 of human USP15, which is conserved among different species, are phosphorylated in the cytoplasm."

sparser
"A study employing nuclear-cytoplasmic fractionation and mass spectrometric analysis showed that Thr149 and Thr219 of USP15, which is conserved among different species, are phosphorylated in the cytoplasm."
USP15 is phosphorylated on T219. 3 / 3
| 3

sparser
"A study employing nuclear-cytoplasmic fractionation and mass spectrometric analysis showed that Thr149 and Thr219 of USP15, which is conserved among different species, are phosphorylated in the cytoplasm."

sparser
"Nuclear-cytoplasmic fractionation and mass spectrometric analysis revealed that Thr149 and Thr219 of human USP15, which is conserved among different species, are phosphorylated in the cytoplasm."

sparser
"Recent studies have also shown the forms of USP15 phosphorylated at Thr149 and Thr219 residues are predominantly localized in the cytoplasm."
USP15 is phosphorylated on S244. 3 / 3
3 |

No evidence text available

No evidence text available

No evidence text available
USP15 is phosphorylated on S102. 2 / 2
2 |

No evidence text available

No evidence text available
USP15 is phosphorylated on S242. 2 / 2
2 |

No evidence text available

No evidence text available
USP15 is phosphorylated on Y104. 2 / 2
2 |

No evidence text available

No evidence text available
USP15 is phosphorylated on T226. 2 / 2
2 |

No evidence text available

No evidence text available
USP15 is phosphorylated on S245. 1 / 1
1 |

No evidence text available
USP15 is phosphorylated on S952. 1 / 1
1 |

No evidence text available
USP15 is ubiquitinated.
| 6
USP15 is ubiquitinated. 6 / 6
| 6

sparser
"Both USP15 and Nef were ubiquitylated."

sparser
"Ubiquitylation of USP15 is clearly increased by co-expression of wild-type but not an E2 binding-deficient mutant of myc-BRAP ( xref B , compare lanes 5 with 4 and 12 with 11 )."

sparser
"Moreover, SYVN1 promotes T-cell immunity [ xref ], B-cell immunity [ xref ] and regulates TLR-induced inflammation through K27-linked ubiquitination and inactivation of Usp15 [ xref ]."

sparser
"Co-expression with neither the USP15 C298A mutant nor USP15 variant 2 affected CARD9 ubiquitination, indicating that the removal of ubiquitin is linked to the catalytic activity of USP15."

sparser
"Since Ub attachment to proteins followed by degradation of the proteins by UPS plays an integral role in regulation of the fate of proteins, we investigated the possibility of ubiquitylation of Nef and USP15."

sparser
"Mechanisms to control USP15 activity within cells are suggested by evidence that USP15 is alternatively spliced [ xref , xref ] and can be ubiquitylated or phosphorylated [ xref , xref , xref – xref ]."
USP15 is dephosphorylated.
| 2
USP15 is dephosphorylated. 2 / 2
| 2

sparser
"In contrast, dephosphorylated USP15 relocates to the nucleus and plays an important role in spliceosome dynamics ( xref )."

sparser
"Subsequently, USP15 is dephosphorylated in early G1 as REST re-accumulates [ xref ]."
USP15 affects TRIM25
4 1 | 1 37 18
USP15 binds TRIM25.
4 | 11 18
4 | 11 12

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"USP15 bound to TRIM25 specifically late during infection, removing Lys48-linked ubiquitin chains from TRIM25 and thus stabilizing it [81]."

No evidence text available

No evidence text available

reach
"In contrast, USP15 substantially interacted with TRIM25 at later time points during SeV infection."

sparser
"Moreover, a recent study identified the USP15TRIM25 dyad as a pivotal regulatory complex in proinflammatory and antiviral responses [29]."

reach
"USP15 binds to TRIM25 in viral infections, detaching the K48 linked ubiquitin chains assembled by LUBAC on TRIM25, thereby stabilizing the TRIM25 protein levels and promoting a sustained antiviral response."

sparser
"The E6 oncoproteins of several HPVs (both low-risk and high-risk) form a complex with TRIM25 and USP15, which ultimately prevents the K63-linked ubiquitination of the RIG-I CARDs."

sparser
"Torre et al. validated a functional interaction of a complex of USP15 with TRIM25 in neuroinflammation by showing ECM resistance in double heterozygous Usp15 L749R/+ Trim25 +/− mice."

sparser
"USP15 binds to TRIM25 in viral infections, detaching the K48-linked ubiquitin chains assembled by LUBAC on TRIM25, thereby stabilizing the TRIM25 protein levels and promoting a sustained antiviral response (Figure 3)."
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
USP15 deubiquitinates TRIM25.
1 | 14
USP15 deubiquitinates TRIM25. 10 / 13
1 | 12

reach
"The sfRNA of an epidemic DENV strain bound to TRIM25 in a sequence specific manner, and this interaction prevented TRIM25 deubiquitination and stabilization by USP15, thereby blunting the RIG-I-mediated IFN response [XREF_BIBR]."

reach
"Furthermore, wild-type USP15, but not its catalytically inactive C783A mutant, decreased the polyubiquitylation of TRIM25 that was caused by ectopically expressed HOIL-1L and HOIP (XREF_FIG)."

reach
"The protein levels of TRIM25 may also have to be at a certain level in order for it to productively ubiquitinate RIG-I, as the ubiquitin protease USP15 deubiquitinates TRIM25 at later time points in viral infection (109)."

reach
"Conversely, USP15 and USP4 deubiquitinate TRIM25 and RIG-I, respectively, to stabilize the proteins."

reach
"USP15 was originally identified as a DUB enzyme that interacts with TRIM25, serving to cleave the K48-ubiquitin chain that maintains TRIM25 in an inactive state; thus, de-ubiquitination of TRIM25 by USP15 potentiates TRIM25 dependent activation of RIG-I [XREF_BIBR]."

reach
"We found that upon binding to TRIM25, USP15 deubiquitylated TRIM25, which stabilized the protein and thereby led to a sustained RIG-I-dependent antiviral response (XREF_FIG)."

reach
"We next addressed whether USP15 deubiquitylated endogenous TRIM25 in the context of viral infection."

reach
"In contrast, USP15 deubiquitylates TRIM25, preventing the LUBAC dependent degradation of TRIM25 [XREF_BIBR]."

reach
"A study has demonstrated that USP15 deubiquitinates TRIM25, thus counteracting the LUBAC dependent degradation of TRIM25."
Modified USP15 leads to the deubiquitination of TRIM25. 2 / 2
| 2

reach
"In contrast, expression of wild-type USP15, but not its catalytically inactive mutant, reduced the Lys (48)-linked ubiquitylation of TRIM25, leading to its stabilization."

reach
"Furthermore, ectopic expression of USP15 substantially decreased the extent of ubiquitylation of endogenous TRIM25 in virus infected cells (XREF_FIG)."
USP15 activates TRIM25.
| 9
USP15 activates TRIM25. 9 / 12
| 9

reach
"Ubiquitin specific peptidase 15 (USP15) could enhance the stabilization of TRIM25 by counteracting its K48 linked ubiquitylation and thereby positively regulate the TRIM25-RIG-I signaling pathway."

reach
"Furthermore, ectopic expression of USP15 enhanced the TRIM25- and RIG-I-dependent production of type I IFN and suppressed RNA virus replication."

reach
"Through a combination of biochemical and molecular assays, we further found that USP15 removed Lys 48 -linked ubiquitin moieties from TRIM25, thereby preventing TRIM25 degradation by the proteasome."

reach
"In addition, the ectopic expression of USP15 enhances the TRIM25- and RIG-I-mediated production of type I IFN and thus suppresses RNA virus replication, whereas the depletion of USP15 causes decreased IFN production and markedly enhanced viral replication (85)."

reach
"Our study also revealed some of the details about how and when during viral infection USP15 modulates TRIM25 activity."

reach
"USP15 deubiquitinates LUBACmediated K48-linked ubiquitination of TRIM25 and promotes the protein stability of TRIM25, there by promoting K63-linked ubiquitination of RIG-I and potentiating virus-triggered expression of type I IFN genes [82] ."

reach
"On the other hand, USP4 and USP15 enhance the stability of RIG-I and TRIM25, respectively, by proteolytically cleaving K48 linked ubiquitylation from these molecules XREF_BIBR, XREF_BIBR."

reach
"Ubiquitin specific protease 15 (USP15) prevents LUBAC-dependent degradation of TRIM25 which also promotes RIG-I signaling pathways [151]."
| PMC

reach
"In contrast, endogenous TRIM25 protein abundance did not change in USP15 expressing cells, suggesting that USP15 prevented the degradation of TRIM25."
USP15 inhibits TRIM25.
| 1 1
USP15 inhibits TRIM25. 2 / 5
| 1 1

reach
"During human papillomavirus (HPV) infection, the E6 oncoprotein interacts with TRIM25 and ubiquitin-specific peptidase 15 (USP15), which enhances TRIM25 degradation and subsequently inhibits RLR/MAVS signaling."

eidos
"The DENV and human papillomavirus Type 16 ( HPV16 ) suppress TRIM25 activity by USP15 to attenuate RIG-I signaling ."
USP15 ubiquitinates TRIM25.
| 2
USP15 leads to the ubiquitination of TRIM25. 2 / 2
| 2

reach
"Knockdown of endogenous USP15 by specific small interfering RNA markedly enhanced the ubiquitylation of TRIM25."

reach
"Depletion of USP15 in HEK 293T and primary NHLF cells markedly enhanced the mono- and polyubiquitylation of exogenous and endogenous TRIM25, respectively, and efficient knockdown of USP15 was confirmed by Western blotting analysis (XREF_FIG and XREF_SUPPLEMENTARY)."
USP15 affects DDX58
2 1 | 24 12
USP15 binds DDX58.
2 | 8 12
2 | 8 10

reach
"We hypothesized that USP15 interacts with RIG-I and the interaction is independent of the DUB activity, and the coimmunoprecipitation assay proved the credibility."

reach
"Data are means ± SD from three independent experiments.Figure 7: (a) The interaction between USP15 and RIG-I was independent of the DUB activity of USP15."

sparser
"Our result showed that the presence of GST-RIG-I-N retained USP15 C250 (Fig. 7e), indicating that the interaction of RIG-I with USP15 is due to a direct physical association."

sparser
"Mechanistically, the interaction between RIG-I and USP15 suggests the model that USP15 prevents the access of a downstream target to the RIG-I complex."

sparser
"We used a coimmunoprecipitation experiment to map the domain of USP15 that facilitates its interaction with RIG-I. As demonstrated in Fig. 7c, RIG-I interacted with USP15-WT and the C-terminal UCH domain (USP15-C250), but not with the N-terminal DUSP domain (USP15-N249)."

reach
"Mechanistically, the interaction between RIG-I and USP15 suggests the model that USP15 prevents the access of a downstream target to the RIG-I complex."

sparser
"Figure 7: (a) The interaction between USP15 and RIG-I was independent of the DUB activity of USP15."

sparser
"Together, these results demonstrate that USP15 and RIG-I form a complex through the UCH domain of USP15, and that the N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."

No evidence text available

sparser
"We hypothesized that USP15 interacts with RIG-I and the interaction is independent of the DUB activity, and the coimmunoprecipitation assay proved the credibility."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
USP15 deubiquitinates DDX58.
1 | 7
USP15 deubiquitinates DDX58. 5 / 5
1 | 4

reach
"USP15 specifically deubiquitinates RIG-I by direct physical association and does not interact with other signaling mediators like interferon-beta promoter stimulator 1 (IPS-1), TRAF3, and TBK1 in HEK293 cells."

reach
"Conversely, USP15 and USP4 deubiquitinate TRIM25 and RIG-I, respectively, to stabilize the proteins."

reach
"To further confirm USP15 deubiquitinates polyubiquitination of RIG-I, USP15 siRNAs were transfected into HEK293T cells to knockdown endogenous USP15 expression."

"USP15 specifically removed lysine 63-linked polyubiquitin chains from RIG-I among the essential components in RIG-I-like receptor-dependent pathway."

reach
"Coimmunoprecipitation analysis showed that compared with control siRNA transfected cells, knockdown of USP15 substantially increased RIG-I polyubiquitination in WT ubiquitin and mutant Lys63 transfected cells (XREF_FIG)."
Ubiquitinated USP15 leads to the deubiquitination of DDX58. 2 / 2
| 2

reach
"As shown in Fig. 5g, USP15 knockdown greatly enhanced SEV-induced WT and K63-linked polyubiquitination of RIG-I, further confirming USP15-mediated deubiquitination of RIG-I under physiological conditions."

reach
"As shown in XREF_FIG, USP15 knockdown greatly enhanced SEV induced WT and K63 linked polyubiquitination of RIG-I, further confirming USP15 mediated deubiquitination of RIG-I under physiological conditions."
Modified USP15 leads to the deubiquitination of DDX58. 1 / 1
| 1

reach
"The overexpression of USP15-WT, but not of the deubiquitinase deficient mutants (USP15-C269A and USP15-H862A), significantly decreased the ubiquitination of RIG-I (XREF_FIG) and did not block ubiquitination of IPS-1 (XREF_FIG), TRAF3 (XREF_FIG) and TBK1 XREF_FIG), illustrating that USP15 has deubiquitination activity for RIG-I."
USP15 inhibits DDX58.
| 5
USP15 inhibits DDX58. 5 / 7
| 5

reach
"USP21 and USP15 remove K63 linked polyubiquitin chains from RIG-I and block the ability of RIG-I to induce IFN-beta XREF_BIBR XREF_BIBR."

reach
"The knockdown of USP15 increases RIG-I K63 linked polyubiquitination, enhancing the IFN production, whereas the overexpression of USP15 decreases the type I IFN by blocking the transcription of IFN-beta in HEK293T infected with SeV."

reach
"USP21 and USP15 remove K63-linked polyubiquitin chains from RIG-I and block the ability of RIG-I to induce IFN-β 24,25 ."

reach
"For example, the deubiquitinating enzyme USP15 negatively regulates virusinduced IFN-I production by targeting RIG-I (84)."

reach
"In particular, USP3, USP21, USP25 and USP15 have all been shown to directly inhibit RIG-I."
USP15 activates DDX58.
| 1
USP15 activates DDX58. 1 / 4
| 1

reach
"On the other hand, USP4 and USP15 enhance the stability of RIG-I and TRIM25, respectively, by proteolytically cleaving K48 linked ubiquitylation from these molecules XREF_BIBR, XREF_BIBR."
USP15 ubiquitinates DDX58.
| 3
USP15 ubiquitinates DDX58. 3 / 3
| 3

reach
"USP15 mediated GLTSCR2 removal of RIG-I ubiquitination."

reach
"To the best of our knowledge, at least nine DUBs, A20, CYLD, USP3, USP5, USP14, USP15, USP21, USP25, and USP27X, have been proposed to counteract the K63linked ubiquitination of RIG-I and, thereby attenuate downstream signaling and IFN-b production ( Table 1 and Figure 3 ) (58, 76, 93) ."

reach
"Consistent with the negative regulatory role of USP15 in RIG-I-mediated signaling, USP15 substantially reduced RIG-I polyubiquitination in cells transfected with plasmid encoding the WT ubiquitin and Lys63 mutant (Fig. 5a,b), but not in the mutant-Lys48-transfected cells (Fig. 5c), indicating that USP15 has DUB activity directed specifically towards the Lys63-linked polyubiquitin chains of RIG-I."
USP4 affects USP15
3 | 13 23
USP4 binds USP15.
3 | 11 23
3 | 10 11

sparser
"To examine the effect of endogenous SART3, the interaction between USP4 and USP15 was examined by immunoprecipitation after depletion of SART3 using siRNA."

sparser
"A USP15USP4 amino acid sequence alignment in the SL region reveals the only difference to be a cysteine residue (USP15 Cys 352 ), which replaces a serine (Ser 394 ) in USP4 ( xref D and)."

sparser
"These findings suggest SART3 binds to both USP15 and USP4, and this may lead to deubiquitination of PRP31 and PRP3 simultaneously."

No evidence text available

reach
"USP4 can form stable homodimers and can also interact with USP11 and USP15."

sparser
"Furthermore, they demonstrate that AKT phosphorylation of USP4 enhances the binding of USP4 to USP15 and that overexpression of USP15 increases USP4 stability."

reach
"We found that USP15 interacts with both overexpressed and endogenous USP4."

sparser
"The depletion of SART3 hampered the interaction between USP15 and USP4 (Figure xref and  xref )."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"To examine the effect of endogenous SART3, the interaction between USP4 and USP15 was examined by immunoprecipitation after depletion of SART3 using siRNA."
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal "domain present in ubiquitin specific proteases" (DUSP) and "ubiquitin-like" (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."
USP4 activates USP15.
| 2
USP4 activates USP15. 2 / 3
| 2

reach
"The overexpression of USP4 has been immunohistochemically detected in small cell tumors and adenocarcinomas, supporting the oncogenic potential of USP15 [XREF_BIBR]."

reach
"These data suggest that complex formation of USP15 and USP4 stimulates the enzymatic activity of USP15 and possibly USP4."
USP15 affects USP4
3 | 13 23
USP15 binds USP4.
3 | 11 23
3 | 10 11

sparser
"To examine the effect of endogenous SART3, the interaction between USP4 and USP15 was examined by immunoprecipitation after depletion of SART3 using siRNA."

sparser
"A USP15USP4 amino acid sequence alignment in the SL region reveals the only difference to be a cysteine residue (USP15 Cys 352 ), which replaces a serine (Ser 394 ) in USP4 ( xref D and)."

sparser
"These findings suggest SART3 binds to both USP15 and USP4, and this may lead to deubiquitination of PRP31 and PRP3 simultaneously."

No evidence text available

reach
"USP4 can form stable homodimers and can also interact with USP11 and USP15."

sparser
"Furthermore, they demonstrate that AKT phosphorylation of USP4 enhances the binding of USP4 to USP15 and that overexpression of USP15 increases USP4 stability."

reach
"We found that USP15 interacts with both overexpressed and endogenous USP4."

sparser
"The depletion of SART3 hampered the interaction between USP15 and USP4 (Figure xref and  xref )."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"To examine the effect of endogenous SART3, the interaction between USP4 and USP15 was examined by immunoprecipitation after depletion of SART3 using siRNA."
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal "domain present in ubiquitin specific proteases" (DUSP) and "ubiquitin-like" (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."
USP15 activates USP4.
| 2
USP15 activates USP4. 2 / 3
| 2

reach
"Furthermore, they demonstrate that AKT phosphorylation of USP4 enhances the binding of USP4 to USP15 and that overexpression of USP15 increases USP4 stability."

reach
"These data suggest that complex formation of USP15 and USP4 stimulates the enzymatic activity of USP15 and possibly USP4."
USP15 affects SART3
13 | 13 10
USP15 binds SART3.
13 | 11 10
13 | 10 4

No evidence text available

sparser
"Taken together, these data show that USP15 interacts with SART3 directly through the DUSP-UBL domains."

No evidence text available

sparser
"As shown in xref , SART3 interacted with USP15 1–226 but not with USP15 230–952 ."

reach
"Moreover, as a substrate recruiting factor of USP15 either, SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3."

sparser
"USP15 interacts with SART3."

reach
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"USP15 interacts with SART3."

No evidence text available
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
USP15 inhibits SART3.
| 2
USP15 inhibits SART3. 2 / 4
| 2

reach
"Taken together, these results provide insights into the regulatory mechanism of human Tip110 degradation by USP15."

reach
"Regulation of ubiquitin-proteasome system mediated Tip110 protein degradation by USP15."
SART3 affects USP15
13 | 14 10
SART3 binds USP15.
13 | 11 10
13 | 10 4

No evidence text available

sparser
"Taken together, these data show that USP15 interacts with SART3 directly through the DUSP-UBL domains."

No evidence text available

sparser
"As shown in xref , SART3 interacted with USP15 1–226 but not with USP15 230–952 ."

reach
"Moreover, as a substrate recruiting factor of USP15 either, SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3."

sparser
"USP15 interacts with SART3."

reach
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"USP15 interacts with SART3."

No evidence text available
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
SART3 activates USP15.
| 3
SART3 activates USP15. 3 / 3
| 3

reach
"However, the overexpression of SART3 induced the nuclear localization of USP15, consequently leading to colocalization of USP15 with PRP31."

reach
"in which overexpression of SART3 enhanced localization of USP15 to the nucleus."

reach
"Tip110/SART3-Mediated Regulation of NF-κB Activity by Targeting IκBα Stability Through USP15."
USP15 affects TP53
2 | 25 9
USP15 binds TP53.
2 | 9 9
2 | 9 7

reach
"The GST-USP15 : His 6 -p53 complex co and precipitated by glutathione-Sepharose, suggesting that USP15 directly associates with p53 (XREF_FIG)."

reach
"The interaction between USP15 and p53 was verified by GST pull-down assays."

reach
"In this study, we have demonstrated that USP15 binds to p53 (XREF_FIG)."

sparser
"To evaluate whether the impaired function of TIFAB-deficient AML cells is associated with the USP15-p53 axis, we examined the expression of p53 target genes."

reach
"Recently, it has been demonstrated that USP15 binds to and stabilizes the transcription factor p53 [89]."

sparser
"The interaction between USP15 and p53 was verified by GST pull-down assays."

reach
"19 We wished to determine whether USP15 also binds to p53."

No evidence text available

reach
"In the current study, we identify that USP15 binds to and stabilizes p53 through deubiquitination in U2OS and HEK293 cells."

reach
"Taken together, the results suggest that USP15 can bind to p53 and regulate its stability."
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
USP15 activates TP53.
| 11
USP15 activates TP53. 9 / 10
| 9

reach
"Conversely, whereas USP4 and USP15 target p53 inhibiting ligases ARF-BP1 [XREF_BIBR] and MDM2 [XREF_BIBR], respectively, USP11 stabilizes p53 [XREF_BIBR] as well as several other tumor suppressors including PML [XREF_BIBR], BRCA2 [XREF_BIBR] and Mre11 complex members MRE11 & RAD50 [XREF_BIBR]."

reach
"USP15 can stabilize p53 through deubiquitination (XREF_FIG) and upregulate the p53 transcriptional activity, in turn promoting the expression of p21 (XREF_FIG)."

reach
"29 USP15 knockdown abolished p53 stabilization by TGF-beta signaling (XREF_FIG) and suppressed the transcriptional activity of p53 (XREF_FIG)."

reach
"Our results confirmed a previous report that overexpression of USP15 can upregulate the transcriptional activity of p53."

reach
"Overexpression of USP15 increased the half-life of endogenous p53, but overexpression of the inactive USP15 C269S failed to increase the half-life of p53 (XREF_FIG)."

reach
"Crucially, ectopic expression of either p53 R175H or USP15 promoted p53 triggered apoptosis in human cervical cancer cells."

reach
"Western blot analysis indicated that overexpression of Flag-USP15 increased the stability of p53, in turn leading to an increased expression of p21, a p53 regulated target gene (XREF_FIG)."

reach
"TIFAB Regulates USP15 Mediated p53 Signaling during Stressed and Malignant Hematopoiesis."

reach
"USP15 knockdown disrupted p53 stability and p21 synthesis mediated by TGF-beta, indicating that TGF-beta modulated p53 stability through upregulation of USP15 synthesis (XREF_FIG)."
USP15-C269S activates TP53. 2 / 2
| 2

reach
"Overexpression of an inactive USP15 C269S did not increase the stability of p53 (XREF_FIG)."

reach
"Overexpression of USP15 increased the half-life of endogenous p53, but overexpression of the inactive USP15 C269S failed to increase the half-life of p53 (XREF_FIG)."
USP15 deubiquitinates TP53.
| 3
USP15 deubiquitinates TP53. 3 / 3
| 3

reach
"USP15 deubiquitinates p53."

reach
"To examine whether USP15 can deubiquitinate p53, the effect of USP15 on p53 that had been ubiquitinated by overexpressed MDM2 was determined."

reach
"The mechanism for USP15 to block p53 ubiquitination mediated by MDM2 was analyzed."
USP15 increases the amount of TP53.
| 2
Modified USP15 increases the amount of TP53. 2 / 2
| 2

reach
"However, co-overexpression of USP15 in the p53 knockdowned cells can increase the levels of p53 (XREF_FIG)."

reach
"In addition, co-overexpression of shRNA-insensitive USP15 cDNA in USP15 knockdowned cells can increase the levels of the recombinant USP15 and, in turn, upregulate the levels of the cellular p53 (XREF_FIG)."
TRIM25 affects USP15
4 | 12 18
TRIM25 binds USP15.
4 | 11 18
4 | 11 12

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"USP15 bound to TRIM25 specifically late during infection, removing Lys48-linked ubiquitin chains from TRIM25 and thus stabilizing it [81]."

No evidence text available

No evidence text available

reach
"In contrast, USP15 substantially interacted with TRIM25 at later time points during SeV infection."

sparser
"Moreover, a recent study identified the USP15TRIM25 dyad as a pivotal regulatory complex in proinflammatory and antiviral responses [29]."

reach
"USP15 binds to TRIM25 in viral infections, detaching the K48 linked ubiquitin chains assembled by LUBAC on TRIM25, thereby stabilizing the TRIM25 protein levels and promoting a sustained antiviral response."

sparser
"The E6 oncoproteins of several HPVs (both low-risk and high-risk) form a complex with TRIM25 and USP15, which ultimately prevents the K63-linked ubiquitination of the RIG-I CARDs."

sparser
"Torre et al. validated a functional interaction of a complex of USP15 with TRIM25 in neuroinflammation by showing ECM resistance in double heterozygous Usp15 L749R/+ Trim25 +/− mice."

sparser
"USP15 binds to TRIM25 in viral infections, detaching the K48-linked ubiquitin chains assembled by LUBAC on TRIM25, thereby stabilizing the TRIM25 protein levels and promoting a sustained antiviral response (Figure 3)."
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
TRIM25 activates USP15.
| 1
TRIM25 activates USP15. 1 / 2
| 1

reach
"In cells, the UbVs inhibited the deubiquitination of two USP15 substrates, SMURF2 and TRIM25, and the diUbV inhibited the effects of USP15 on the transforming growth factor beta pathway."
Nef affects USP15
| 26 10
Nef binds USP15.
| 11 10
| 11 10

sparser
"Our data showed that Nef was detected in lane 2 together with USP15, but not in lane 1 ( xref ), indicating that Nef associated with USP15 and suggesting that Nef could be important to UPS-mediated proteosomal degradation processes."

sparser
"Accordingly, we constructed two deletion mutants of USP15, USP15ΔN and USP15ΔC ( xref ), and examined binding of Nef to the mutant USP15 and its consequence to the reciprocal decay of mutant USP15 and Nef."

sparser
"We next investigated whether direct interactions between Nef and USP15 are essential for the observed reciprocal decay of the proteins."

sparser
"We then investigated whether the interaction between USP15 and Nef is required for the observed mutual degradation. xref showed that the amounts of the expressed USP15 and USP15ΔN which interact with Nef gradually declined as the amount of Nef was increased."

reach
"Direct interaction between Nef and USP15 was essential for the observed reciprocal decay of the proteins."

sparser
"Direct interaction between Nef and USP15 was essential for the observed reciprocal decay of the proteins."

reach
"Immunoprecipitation of USP15 and its mutant proteins with anti-Myc antibody, followed by WB with anti-GFP antibody for the detection of Nef.GFP and GFP, showed that Nef.GFP, not GFP, was detected only[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Similarly, the amount of Nef was least in the cells transfected with pUSP15, as well as less in the cells transfected with pUSP15ΔN than in the cells transfected with pUSP15ΔC ( xref ), establishing that interaction of USP15 and Nef is essential for the reciprocal protein decay."

reach
"Similarly, the amount of Nef was least in the cells transfected with pUSP15, as well as less in the cells transfected with pUSP15DeltaN than in the cells transfected with pUSP15DeltaC, establishing th[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The interaction between Nef and USP15 leads to reciprocal decay of the proteins, and the balance of USP15/Nef interplay underlines the dynamic competition between the virus and the infected host cells [101]."
Nef inhibits USP15.
| 9
Nef inhibits USP15. 9 / 9
| 9

reach
"These data collectively demonstrated that stability of Nef and USP15 is regulated reciprocally, and that USP15 mediated degradation of Nef was more pronounced than Nef mediated degradation of USP15."

reach
"These data indicate that Nef expressed from the wt-HIV-1-, but not from Deltanef-HIV-1-replicating cells, degraded USP15, lowering the amount of intracellular USP15, which in turn vitiated USP15 induc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These data indicate that Nef expressed from the wt-HIV-1-, but not from Deltanef-HIV-1-replicating cells, degraded USP15, lowering the amount of intracellular USP15, which in turn vitiated USP15 induced degradation of viral proteins and thereby HIV-1 replication, where Nef degrades USP15, but USP15 mediated Nef degradation is more potent (XREF_FIG)."

reach
"Taken together, the results show that Nef and USP15 declines were due to expressed protein degradation, and USP15 mediated degradation of Nef was much stronger than Nef mediated USP15 degradation (XREF_FIG)."

reach
"Further, while the amount of intracellular Nef and USP15 was mutually regulated, USP15 mediated degradation of Nef was stronger than Nef mediated USP15 degradation, implying that USP15 could be employed to knock out Nef, a molecule essential to pathogenicity, within HIV-1 infected cells."

reach
"Further, while the amount of intracellular Nef and USP15 was mutually regulated, USP15 mediated degradation of Nef was stronger than Nef mediated USP15 degradation, implying that USP15 could be employ[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Further, Nef, but not Gag, degraded USP15, suggesting that reciprocal degradation of Nef and USP15 could play a central role in coordinating decay of viral proteins and hence HIV-1 replication, underlining the dynamic competition between the molecular determinants of the infecting HIV-1 and the infected host cells."

reach
"Taken together, the results show that Nef and USP15 declines were due to expressed protein degradation, and USP15 mediated degradation of Nef was much stronger than Nef mediated USP15 degradation."

reach
"These data establish that USP15 mediated p24 degradation is achieved via both endosomal and proteosomal degradation.These data collectively demonstrated that stability of Nef and USP15 is regulated re[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
Nef activates USP15.
| 6
Nef activates USP15. 6 / 6
| 6

reach
"The above data demonstrated that Nef and USP15 degraded reciprocally and that USP15 mediated degradation of Nef was very pronounced, compared with Nef mediated decay of USP15."

reach
"Accordingly, USP15 degraded key intracellular viral proteins, such as Nef and Gag in the HIV-1-replicating cells and thereby significantly impaired HIV-1 replication, and Nef induced decay of USP15 which is known to stabilize cellular proteins."

reach
"Our data showed that as the amount of pHNef was increased from 0 to 4 mug, the USP15 levels gradually decreased in a dose dependent manner without changes to the amount of beta-actin, indicating that [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Our data showed that as the amount of pHNef was increased from 0 to 4 mug, the USP15 levels gradually decreased in a dose dependent manner (XREF_FIG) without changes to the amount of beta-actin (XREF_FIG), indicating that Nef expression caused the intracellular USP15 diminution."

reach
"Accordingly, USP15 degraded key intracellular viral proteins, such as Nef and Gag in the HIV-1-replicating cells and thereby significantly impaired HIV-1 replication, and Nef induced decay of USP15 wh[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"However, we did not detect significant amounts of USP15 in the nucleus.The above data demonstrated that Nef and USP15 degraded reciprocally and that USP15 mediated degradation of Nef was very pronounc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP15 affects nef
| 25 10
USP15 binds nef.
| 11 10
| 11 10

sparser
"Our data showed that Nef was detected in lane 2 together with USP15, but not in lane 1 ( xref ), indicating that Nef associated with USP15 and suggesting that Nef could be important to UPS-mediated proteosomal degradation processes."

sparser
"Accordingly, we constructed two deletion mutants of USP15, USP15ΔN and USP15ΔC ( xref ), and examined binding of Nef to the mutant USP15 and its consequence to the reciprocal decay of mutant USP15 and Nef."

sparser
"We next investigated whether direct interactions between Nef and USP15 are essential for the observed reciprocal decay of the proteins."

sparser
"We then investigated whether the interaction between USP15 and Nef is required for the observed mutual degradation. xref showed that the amounts of the expressed USP15 and USP15ΔN which interact with Nef gradually declined as the amount of Nef was increased."

reach
"Direct interaction between Nef and USP15 was essential for the observed reciprocal decay of the proteins."

sparser
"Direct interaction between Nef and USP15 was essential for the observed reciprocal decay of the proteins."

reach
"Immunoprecipitation of USP15 and its mutant proteins with anti-Myc antibody, followed by WB with anti-GFP antibody for the detection of Nef.GFP and GFP, showed that Nef.GFP, not GFP, was detected only[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Similarly, the amount of Nef was least in the cells transfected with pUSP15, as well as less in the cells transfected with pUSP15ΔN than in the cells transfected with pUSP15ΔC ( xref ), establishing that interaction of USP15 and Nef is essential for the reciprocal protein decay."

reach
"Similarly, the amount of Nef was least in the cells transfected with pUSP15, as well as less in the cells transfected with pUSP15DeltaN than in the cells transfected with pUSP15DeltaC, establishing th[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The interaction between Nef and USP15 leads to reciprocal decay of the proteins, and the balance of USP15/Nef interplay underlines the dynamic competition between the virus and the infected host cells [101]."
USP15 inhibits nef.
| 14
USP15 inhibits nef. 10 / 14
| 14

reach
"Further, USP15 degraded not only Nef but also HIV-1 structural protein, Gag, thereby substantially inhibiting HIV-1 replication."

reach
"However, we did not detect significant amounts of USP15 in the nucleus.The above data demonstrated that Nef and USP15 degraded reciprocally and that USP15 mediated degradation of Nef was very pronounc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Our data indicated that USP15 clearly induced degradation of Nef and other viral structural protein, Gag, in the repeated experiments."

reach
"Nef could also cause decay of USP15, although Nef mediated degradation of USP15 was weaker than USP15 mediated Nef degradation."

reach
"The above data demonstrated that Nef and USP15 degraded reciprocally and that USP15 mediated degradation of Nef was very pronounced, compared with Nef mediated decay of USP15."

reach
"These data indicate that Nef expressed from the wt-HIV-1-, but not from Deltanef-HIV-1-replicating cells, degraded USP15, lowering the amount of intracellular USP15, which in turn vitiated USP15 induc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"USP15 degraded not only Nef but also Gag, and the USP15 mediated inhibitory effect on wt-HIV-1 replication was more pronounced than on Deltanef-HIV-1 replication (XREF_FIG)."

reach
"These data evinced that Nef and USP15 are key players in governing intracellular viral and cellular protein stability and thus the HIV-1 and host cell competition, determining the course of disease.Ou[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These data indicate that Nef expressed from the wt-HIV-1-, but not from Deltanef-HIV-1-replicating cells, degraded USP15, lowering the amount of intracellular USP15, which in turn vitiated USP15 induced degradation of viral proteins and thereby HIV-1 replication, where Nef degrades USP15, but USP15 mediated Nef degradation is more potent (XREF_FIG)."

reach
"In parallel, replication of wt- and Deltanef-HIV-1 was significantly impaired by USP15, indicating that USP15 degraded not only Nef but also Gag and thus hampered HIV-1 replication."
USP15 affects TGFB
| 6 25
USP15 activates TGFB.
| 6 17
USP15 activates TGFB. 10 / 25
| 6 17

eidos
"Besides ALK3 , USP15 also interacts with and deubiquitinates monoubiquitinated R-SMADs , causing enhanced TGF-beta and BMP responses in both mammalian cells and Xenopus embryos ."

reach
"These observations shed light on the function and mechanisms of USP15 mediated modulation of the TGF-beta signalling pathway during wound healing, thus providing a novel potential target for the treatment of refractory wounds."

reach
"Taken together, USP15 can enhance TGFbeta signaling by opposing both TGFbeta receptor polyubiquitination and R-SMAD monoubiquitination, which may contribute to tumor progression."

reach
"38, 39, 40, 41 For example, USP15 upregulates the TGF-beta pathway to promote cell proliferation in glioblastoma pathogenesis."

reach
"Although the mechanisms by which USP15 acts on TGFbeta and BMP signalling proposed in this study differ from those described above, the fundamental observations that USP15 enhances both TGFbeta and BMP signalling are consistent with studies described above XREF_BIBR."

reach
"By enhancing TGF-β signaling, USP15 promotes oncogenesis (27)."

reach
"In this study USP15 was found to potentiate both the TGF-beta pathway and the related BMP pathway by targeting mono-ubiquitinated R-SMADs for deubiquitination."

reach
"Our results indicated that USP15 stimulated TGF-beta and SMAD2 signaling and the cartilage phenotype."

reach
"It has been shown that knockdown of USP15 in immortalized HaCaT keratinocytes can impair TGF-beta and Smad-dependent growth arrest."

reach
"USP15 was reported to enhance TGFbeta signalling by binding to the SMAD7 and SMURF2 complex and deubiquitylating ALK5 in the process XREF_BIBR (XREF_FIG A)."
USP15 inhibits TGFB.
| 3
USP15 inhibits TGFB. 3 / 5
| 3

reach
"USP15 mediated activation of the TGF-beta pathway is inhibited by a catalytically inactive mutant of SMURF2."

reach
"In this context, to achieve a certain biological outcome, the same DUB can regulate the pathway at different levels (e.g., USP15 and USP4 promote signaling by targeting the TGF-beta receptor and the effector SMADs) or multiple DUBs can act on the same target (e.g., USP15 and OTUB1 promote signaling through stabilizing R-SMADs)."

reach
"Downregulation or inhibition of USP15 in a patient derived orthotopic mouse model of glioblastoma decreases TGF-beta activity."
USP15 deubiquitinates TGFB.
| 5
USP15 deubiquitinates TGFB. 5 / 5
| 5

reach
"For example, they are involved in the TGF-beta signaling pathway; USP15 deubiquitinates and stabilizes TGF-beta receptor I or receptor activated SMADs, while USP4 regulates the signaling pathway of TGF-beta receptor I and is associated with a poor prognosis in breast cancer."

reach
"For example, the closely related DUBs USP4, USP11 and USP15 have been reported to modulate TGFbeta signalling by deubiquitylating the type I TGFbeta receptor ALK5 [XREF_BIBR - XREF_BIBR]."

reach
"Moreover, Seoane and colleagues reported that the USP15 gene is amplified in breast cancer, ovarian cancer, and glioblastoma, and that USP15 deubiquitinates and stabilizes type I TGFbeta receptor, thereby enhancing TGFbeta signaling and tumor growth [XREF_BIBR] (XREF_FIG)."

reach
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-beta receptor (TbetaR-I), leading to an enhanced TGF-beta signal."

reach
"USP15 in this trimeric complex deubiquitinates and stabilizes type 1 TGF-beta receptor, upregulating the TGF-beta signaling and providing a critically pathogenic factor for glioblastoma."
USP15 affects MDM2
1 1 | 17 5
USP15 binds MDM2.
1 | 3 5
1 | 3 3

reach
"First, USP15 interacts with MDM2, inhibits ubiquitination, and stabilizes MDM2, an important E3 ligase that mediates the ubiquitination and proteolysis of NFATc2 members of the NFAT family and negatively regulates TCR signals."

reach
"When co-expressed in HEK293 cells, USP15 interacted with MDM2, as detected by co-IP assays (XREF_FIG)."

sparser
"When co-expressed in HEK293 cells, USP15 interacted with MDM2, as detected by co-IP assays ( xref )."

sparser
"USP15 physically interacts with MDM2 and inhibits the ubiquitination and degradation of MDM2."

No evidence text available

reach
"These results suggest that USP15 physically interacts with MDM2 in a p53 independent manner."

sparser
"First, USP15 interacts with MDM2, inhibits ubiquitination, and stabilizes MDM2, an important E3 ligase that mediates the ubiquitination and proteolysis of NFATc2 members of the NFAT family and negatively regulates TCR signals."
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
USP15 activates MDM2.
| 5
USP15 activates MDM2. 5 / 8
| 5

reach
"These results suggest that USP15 prevents the ubiquitin dependent degradation of MDM2 in activated T cells."

reach
"We next examined whether USP15 directly targets MDM2."

reach
"We found that USP15 mediates the stability of MDM2 in both T cells and cancer cells."

reach
"Because of the ubiquitin dependent degradation, together with TCR and CD28 stimulation, MDM2 can be transiently down-regulated, and the loss of USP15 greatly promotes the degradation of MDM2 in T cells."

reach
"In both activated T cells and cancer cells, loss of USP15 caused MDM2 degradation."
USP15 inhibits MDM2.
| 3
USP15 inhibits MDM2. 3 / 6
| 3

reach
"Such suicidal MDM2 auto-ubiquination can be blocked by USP15 deubiquitinase that prevents activation of NFATc2 mediated cytokine expression such as production of IFNgamma by Th1 effector T cells.Culli[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Conversely, whereas USP4 and USP15 target p53 inhibiting ligases ARF-BP1 [XREF_BIBR] and MDM2 [XREF_BIBR], respectively, USP11 stabilizes p53 [XREF_BIBR] as well as several other tumor suppressors including PML [XREF_BIBR], BRCA2 [XREF_BIBR] and Mre11 complex members MRE11 & RAD50 [XREF_BIBR]."

reach
"In resting T cells, MDM2 was stable even in the absence of USP15; however, the TCR+CD 28 signals stimulated ubiquitin dependent degradation of MDM2, which was negatively regulated by USP15."
USP15 deubiquitinates MDM2.
1 | 4
USP15 deubiquitinates MDM2. 5 / 5
1 | 4

reach
"USP15 deubiquitylates MDM2, an E3 ligase that ubiquitylates and degrades P53 as well as NFATc2."

reach
"Considering the USP15-MDM2 direct association and the role of USP15 in stabilizing MDM2 and inhibiting MDM2 ubiquitination in activated T cells (XREF_FIG), we examined whether USP15 directly deubiquitinates MDM2."

reach
"By specifically antagonizing MDM2 auto-ubiquitination, the DUB USP15 prevents NFATc2 dependent gene activation, including IFN-gamma production."

reach
"Under normal condition, a DUB, Usp15, deubiquitinates MDM2 to inhibit MDM2 degradation, thereby negatively regulating the generation of IFN-gamma-producing Th1 effector T cells."
USP15 ubiquitinates MDM2.
| 2
Modified USP15 leads to the ubiquitination of MDM2. 2 / 2
| 2

reach
"Loss of USP15 in melanoma and colorectal cell lines caused spontaneous ubiquitination and degradation of MDM2, suggesting that the amount of MDM2 in cancer cells is maintained by a dynamic balance between ubiquitination and deubiquitination."

reach
"In colorectal cell lines, loss of USP15 caused ubiquitination and degradation of MDM2, which indicated that the amount of MDM2 is maintained by the dynamic balance between ubiquitination and deubiquitination XREF_BIBR."
USP15 affects SMURF2
3 1 | 13 10
USP15 binds SMURF2.
3 | 5 10
3 | 5 1

reach
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

reach
"Furthermore, recent reports have identified a number of shared substrates of SMURF2 and USP15 including MDM2, SMAD3, and RNF20, suggesting that the association between SMURF2 and USP15 may serve as a common regulatory method to control multiple analogous cellular protein complexes XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR."

No evidence text available

reach
"As shown in XREF_FIG, mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

No evidence text available

reach
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-beta receptor complex, where it deubiquitinates and stabilizes TbetaRI XREF_BIBR."

No evidence text available

sparser
"USP15 binds to Smurf2 complex and deubiquitinates and stabilizes TRβ1, and that apparently leads to boosting of TGF-β-mediated signaling."

reach
"USP15 binds to Smurf2 complex and deubiquitinates and stabilizes TRbeta1, and that apparently leads to boosting of TGF-beta-mediated signaling."
| 9

sparser
"As shown in xref , mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

sparser
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

sparser
"On the contrary, when the level of TGF β in the body is too low, USP15 associates with smad7 and smurf2 to form a complex to deubiquitinate the type I TGF β receptor and further increase the expression level of the intracellular signaling of TGF β [ xref , xref ]."

sparser
"At the receptor level USP15 forms a complex with SMAD7 and SMURF2 with USP15 opposing the effects of the SMURF2 ligase on TβR stabilization ."

sparser
"USP15 binds to the Smad7SMURF2 complex, which recruits USP15 to TGFβ receptor I and stabilizes it without direct binding [ xref ]."

sparser
"USP15 forms a complex with SMAD7 and SMURF2 and opposes the SMURF2-mediated ubiquitination of TβRI when the level of active TGF-β is low [ xref ]."

sparser
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-β receptor complex, where it deubiquitinates and stabilizes TβRI xref ."

sparser
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-β receptor (TβR-I), leading to an enhanced TGF-β signal."

sparser
"USP15 binds to the Smad7-Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-β type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-β signalling."
USP15 deubiquitinates SMURF2.
1 | 8
USP15 deubiquitinates SMURF2. 7 / 7
1 | 6

"USP15 regulates SMURF2 kinetics through C-lobe mediated deubiquitination"

reach
"In light of the data presented so far we reasoned that USP15 may also directly deubiquitinate SMURF2."

reach
"We now establish that USP15 also directly deubiquitinates the E3 ligase SMURF2, opposing the activity of SMURF2 towards the TbetaR complex."

reach
"Here, we demonstrate that apart from targeting the TbetaR complex directly, USP15 also deubiquitinates SMURF2 resulting in enhanced TbetaR stability and downstream pathway activation."

reach
"Our results indicate that USP15 directly deubiquitinates SMURF2 potentially resulting in the inhibition of SMURF2 catalytic activity."

reach
"Eichhorn and co-workers found that USP15 not only targets the TGF-beta type I receptor complex but also deubiquitinates Smurf2."

reach
"To see if USP15 deubiquitinated SMURF2 in vitro, we purified USP15 and Ub-SMURF2 from extracts of HEK293T cells and proteins were mixed under conditions supporting SMURF2 deubiquitination."
USP15 deubiquitinates SMURF2 on K734. 2 / 2
| 2

reach
"USP15 deubiquitinates Smurf2 at Lys734, a residue required for Smurf2 transthiolation and catalytic activity."

reach
"These authors performed proteomic analysis and found that USP15 deubiquitinates Smurf2 on Lys734, a residue required for Smurf2 catalytic activity, leading to enhanced TGF-beta signalling (Iyengar et [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP15 affects IFNB1
| 26
USP15 inhibits IFNB1.
| 16
| 14

reach
"Depletion of endogenous USP15 reduced the extent of IFN-beta promoter activation stimulated by GST-RIG-I (2CARD) alone or together with TRIM25 (XREF_FIG)."

reach
"The result showed that USP15 caused the dose-dependent inhibition of IFN-β promoter activity (Fig. 2a)."

reach
"Cellular ubiquitin specific proteases, USP21, USP3 and USP15, a subfamily of deubiqutinase, remove K63 linked polyubiquitin chains from RIG-I and block it to induce IFN-beta."

reach
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-β (Supplementary Fig. S5)."

reach
"HEK293T cells were transfected with USP15-specific siRNAs or control siRNAs for 24 h. Cells were further infected with SEV or mock infected for 16 h before immunoblots with the indicated antibodies were performed.Figure 2: (a) USP15 inhibited the SEV-induced activation of the IFN-β promoter."

reach
"(b) USP15 inhibited SEV-induced IFN-β mRNA and protein levels."

reach
"In conclusion, our results provide clear evidence that USP15 deconjugates the Lys63-linked polyubiquitin chains from RIG-I.Since the activation of RIG-I signaling requires Lys63-linked ubiquitination, then we investigated whether the overexpression of USP15, which removes the Lys63-linked polyubiquitin from RIG-I, will decreases the RIG-I-mediated activation of IFN-β promoter activity and the activation mediated by its constitutively active mutant, RIG-I-N."

reach
"(c) Effects of USP15 knockdown on SEV-induced activation of the IFN-β promoter, IFN-β mRNA and protein levels."

reach
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-beta."

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."
USP15-C269A inhibits IFNB1. 2 / 2
| 2

reach
"The catalytic mutants USP15 C269A and -H862A, especially USP15-H862A, still dose-dependently inhibited the IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."

reach
"The catalytic mutants USP15-C269A and -H862A, especially USP15-H862A, still dose-dependently inhibited the IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities."
USP15 decreases the amount of IFNB1.
| 5
USP15 decreases the amount of IFNB1. 2 / 5
| 2

reach
"Through real-time RT-PCR, we also found that USP15-WT, USP15-C269A and USP15-H862A inhibit the transcription of endogenous IFNB1 gene and the SEV induced expression of ISGs."

reach
"Through real-time RT-PCR, we also found that USP15-WT, USP15-C269A and USP15-H862A inhibit the transcription of endogenous IFNB1 gene and the SEV-induced expression of ISGs (Supplementary Fig. S4)."
Modified USP15 decreases the amount of IFNB1. 3 / 3
| 3

reach
"Overexpression of USP15 inhibited the transcription of IFN-beta."

reach
"The knockdown of USP15 increases RIG-I K63 linked polyubiquitination, enhancing the IFN production, whereas the overexpression of USP15 decreases the type I IFN by blocking the transcription of IFN-beta in HEK293T infected with SeV."

reach
"Overexpression of USP15 inhibited the transcription of IFN-β."
USP15 activates IFNB1.
| 5
USP15 activates IFNB1. 5 / 5
| 5

reach
"However, we also found that co-expression of increasing amounts of USP15-HA and USP15-Myc further enhanced the IFN-β promoter activation stimulated by RIG-I-N and TRIM25 as a function of the dose, in line with the result described by Pauli (Supplementary Fig. S5)."

reach
"However, we also found that co-expression of increasing amounts of USP15-HA and USP15-Myc further enhanced the IFN-beta promoter activation stimulated by RIG-I-N and TRIM25 as a function of the dose, in line with the result described by Pauli."

reach
"Through the comparison we found under the condition that co-expressed with TRIM25, USP15 enhanced the activation of IFN-beta."

reach
"Coexpression of increasing amounts of Myc tagged USP15 further enhanced the IFN-beta and NF-kappaB promoter activation stimulated by GST-RIG-I (2CARD) and TRIM25 in a dose dependent manner (XREF_FIG)."

reach
"Through the comparison we found under the condition that co-expressed with TRIM25, USP15 enhanced the activation of IFN-β."
USP15 affects REST
1 | 15
USP15 inhibits REST.
| 4
USP15 inhibits REST. 4 / 12
| 4

reach
"Indeed, USP15 depletion impaired the normal periodic accumulation of REST in early G 1, suggesting that it plays an important role in cellular REST homeostasis."

reach
"We conclude that depletion of USP15 reduced the level of nuclear 220 kDa REST in both HEK-293T and A549 cells, not through accelerating its degradation, but rather through diminishing the supply of newly synthesized REST available to replenish its levels."

reach
"However, USP15 depletion does not destabilize pre-existing REST, but rather specifically impairs de novo REST synthesis."

reach
"Although one USP15 targeting sequence did diminish the REST transcript, importantly this was not observed with another individual siRNA that also reduced REST protein abundance, or with the siRNA pool used in the initial screen."
USP15 activates REST.
| 8
USP15 activates REST. 8 / 11
| 8

reach
"While USP15 does not antagonize beta-TrCP-mediated REST degradation, is required for the rapid replenishment of REST upon mitotic exit for the beginning of the new cell cycle."

reach
"We show that USP15 does not antagonize degradation of pre-existing REST or protect phosphorylated REST at mitosis."

reach
"DUBs " found in translation " : USP15 controls stability of newly synthesized REST."

reach
"Instead, the physiological role of USP15 is to promote new REST synthesis to restore its cellular level at mitotic exit."

reach
"To establish whether the deubiquitylase activity of USP15 could rescue REST, we employed HEK-293T cells, which, unlike A549 cells, are amenable to high efficiency plasmid transfection."

reach
"The other key observation was that in conditions where translation was inhibited, USP15 knockdown failed to accelerate REST degradation."

reach
"Through reversing the ubiquitylation of newly synthesized REST, USP15 allows nuclear REST to be replenished in early G 1 after mitotic exit."

reach
"Depletion of USP15 failed to accelerate the turnover of REST under conditions where translation was inhibited (XREF_FIG)."
USP15 increases the amount of REST.
| 2
USP15 increases the amount of REST. 2 / 3
| 2

reach
"Inhibition of the proteasome with epoxomicin could rescue REST levels following USP15 depletion with two independent siRNAs (XREF_FIG, compare lane 5 with 6, and lane 7 with 8), suggesting this was indeed an effect on protein turnover."

reach
"However, we noticed that the level of 220 kDa REST was not restored by GFP-USP15, suggesting that the degradation of this mature form was not directly antagonized."
USP15 deubiquitinates REST.
1 | 1
USP15 deubiquitinates REST. 2 / 2
1 | 1

reach
"XREF_BIBR Changes in the efficiency with which USP15 deubiquitylates nascent REST, and in the cellular availability of REST during interphase, may influence expression of the broader palette of REST target genes."
USP15 affects PRKN
| 21 4
USP15 inhibits PRKN.
| 12
USP15 inhibits PRKN. 8 / 9
| 8

reach
"Interestingly, USP15 strongly inhibited Parkin-mediated Human Molecular Genetics, 2014, Vol."

reach
"In PD cases with diminished but non-zero Parkin activity, USP15 inhibition could enable residual Parkin to exert its neuroprotective function more effectively."

reach
"In this regard, USP15 and USP30 were found to antagonize Parkin activity by competing for the common substrates on OMM."

reach
"The OMM localized DUB ubiquitin specific processing proteases USP30 and USP15 antagonize PARKIN activity by cleaving ubiquitin chains on mitochondria."

reach
"More in detail, USP15 was shown to inhibit CCCP induced mitophagy in Parkin transfected Hela cells depending on its DUB activity and RNAi mediated silencing of USP15 enhanced Parkin mediated mitophagy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"It was recently shown that knockdown of USP15 enhanced Parkin dependent mitophagy and global upregulation of mitochondrial ubiquitylation upon CCCP [XREF_BIBR]."

reach
"We wondered whether USP15 knockdown would promote Parkin function in PARK2 mutant PD patient cells with reduced but non-zero Parkin activity."

reach
"In contrast, a recent report demonstrated that in Drosophila the age dependent increase in mitophagy in both muscle and dopaminergic neurons is dependent on PINK1 and Parkin, and the knockdown of USP15 and USP30 rescues mitophagy in Parkin deficient organisms."
USP15 inhibits mutated PRKN. 4 / 4
| 4

reach
"USP15 knockdown rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts As demonstrated above in HeLa cells ( Fig. 2A) , USP15 knockdown does not enhance mitophagy in the complete absence of Parkin."

reach
": Knockdown of USP15 rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts."

reach
"These data were also confirmed in vivo in Drosophila, where silencing of Usp15 homolog rescued parkin mutant phenotype, thus showing a genetic interaction between the two genes [XREF_BIBR]."

reach
"USP15 knockdown rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts."
USP15 binds PRKN.
| 1 4
| 1 4

sparser
"We then asked if there was a functional interaction between Parkin and USP15."

sparser
"As we were unable to coimmunoprecipitate USP15 with endogenous Parkin in HEK293 cells, we assumed that the binding of Parkin and USP15 is weak and not detectable at endogenous Parkin expression levels."

sparser
"Coimmunoprecipitation and western blotting confirmed the interaction of overexpressed Parkin with USP15 (Supplementary Material, Fig. S1 ), but not USP11."

sparser
"Coimmunoprecipitation and western blotting confirmed the interaction of overexpressed Parkin with USP15 (Supplementary Data), but not USP11."

reach
"As we were unable to coimmunoprecipitate USP15 with endogenous Parkin in HEK293 cells, we assumed that the binding of Parkin and USP15 is weak and not detectable at endogenous Parkin expression levels.We then asked if there was a functional interaction between Parkin and USP15."
USP15 deubiquitinates PRKN.
| 4
USP15 deubiquitinates PRKN. 4 / 4
| 4

reach
"However, we found no evidence that USP15 deubiquitinates Parkin in basal conditions or after exposure to valinomycin (Fig. 5A and B)."

reach
"At present, the negative regulatory mechanisms against Parkin-mediated ubiquitination have been reported, with the discovery of several deubiquitinases including USP8, USP15 and USP30 that are able to cause the deubiquitination of Parkin and/or OMM proteins."

reach
"USP15 does not deubiquitylate Parkin under basal conditions or when cells are treated with mitochondrial depolarizing agents."

reach
"USP15 has been shown to deubiquitinate receptor-activated SMADs and TRIM25 and antagonize Parkin-mediated mitochondrial ubiquitination, and USP15 regulates the TGF-β pathway and is a key factor in glioblastoma pathogenesis (Eichhorn et al., 2012; Pauli et al., 2014; Inui et al., 2011)."
USP15 activates PRKN.
| 3
USP15 activates PRKN. 3 / 3
| 3

reach
"Furthermore, USP15 KD was able to rescue the mitophagy defect of Parkin and PINK1 mutant PD patient fibroblasts."

reach
"We considered the possibility that USP15 might modulate Parkin function by deubiquitinating Parkin itself."

reach
"Knockdown of the Drosophila homologs of USP15 (CG8334, hereafter called dUSP15) and USP30 (CG3016, hereafter dUSP30) largely rescues the mitochondrial defects of parkin deficient fly muscle in vivo."
USP15 increases the amount of PRKN.
| 1
USP15 increases the amount of PRKN. 1 / 1
| 1

reach
"Moreover, knockdown of USP15 rescues the mitophagy defect of PD patient fibroblasts with PARK2 mutations and decreased Parkin levels."
USP15 affects BMPR1A
3 1 | 12 2
USP15 binds BMPR1A.
3 | 5 2
3 | 5 2

No evidence text available

reach
"The strong interaction between USP15 and ALK3 and their co-localization at the plasma membrane suggested that USP15 could act as a DUB for ALK3."

reach
"We show that USP15 interacts with SMAD6 and ALK3 and enhances BMP signalling by deubiquitylating ALK3 and rescuing it from proteasomal destruction."

reach
"Next, we tested how SMAD6 affected the interaction between GFP-USP15 and FLAG-ALK3 (XREF_FIG b)."

sparser
"The strong interaction between USP15 and ALK3 and their co-localization at the plasma membrane suggested that USP15 could act as a DUB for ALK3."

No evidence text available

sparser
"SMAD6 overexpression disrupts the association of USP15 with ALK3 and potently inhibits BMP signalling."

reach
"It was shown that USP15 interacts with type I BMP receptors, including ALK3, co-localises with ALK3 at the membrane and deubiquitylates ALK3, thereby countering the inhibition of the BMP pathway caused by SMAD6 XREF_BIBR."

No evidence text available

reach
"Here, we demonstrate that USP15 interacts with and deubiquitylates the type I BMP receptor ALK3."
USP15 deubiquitinates BMPR1A.
1 | 6
USP15 deubiquitinates BMPR1A. 7 / 7
1 | 6

reach
"We next asked whether USP15 can deubiquitylate ALK3 in cells."

reach
"USP15 deubiquitylates ALK3."

reach
"Here, we demonstrate that USP15 interacts with and deubiquitylates the type I BMP receptor ALK3."

reach
"Here, we demonstrate that USP15 enhances BMP signalling by associating with and deubiquitylating the BMP type I receptor ALK3."

reach
"It was shown that USP15 interacts with type I BMP receptors, including ALK3, co-localises with ALK3 at the membrane and deubiquitylates ALK3, thereby countering the inhibition of the BMP pathway caused by SMAD6 XREF_BIBR."

reach
"We hypothesized that USP15 deubiquitylates ALK3, thereby opposing the effect of SMAD6 and its associated E3 ubiquitin ligases."
USP15 activates BMPR1A.
| 1
USP15 activates BMPR1A. 1 / 6
| 1

reach
"USP15 targets ALK3 and BMPR1A for deubiquitylation to enhance bone morphogenetic protein signalling."
USP15 affects BARD1
| 13 13
USP15 binds BARD1.
| 5 13
| 5 12

reach
"USP15 interacts with BARD1 via its C-terminal region."

sparser
"Furthermore, cancer-associated USP15 mutations, with decreased USP15-BARD1 interaction, increases PARP inhibitor sensitivity in cancer cells."

sparser
"Interestingly, USP15BARD1 interaction was increase after IR, HU, MMC, or CPT treatment (Fig.  xref )."

sparser
"Moreover, USP15 C-terminal is mutated in breast cancer patients, disrupting USP15BARD1 interaction and resulting in HR defect."

sparser
"USP15 deletion mutant (deletion residues 740–981) abolished the binding of USP15 with BARD1."

sparser
"As shown in Fig.  xref , endogenous USP15 and BARD1 associated with each other in cells."

sparser
"More interestingly, patients carried USP15 mutations that disrupted USP15-BARD1 interaction, and the cancer cell is more sensitive to PARP inhibitor."

sparser
"Since USP15 interacts with BARD1 and this interaction is important for HR, we hypothesized that BARD1 is the prime target of USP15."

sparser
"Furthermore, the interaction between USP15 and BARD1 was confirmed by in vitro glutathione S -transferase (GST) pull-down assay (Supplementary Fig.  xref )."

sparser
"Importantly, USP15BARD1 interaction is essential for HR and cancer cell response to PARP inhibitor (Fig.  xref and Supplementary Fig.  xref )."
USP15 binds CBX3 and BARD1. 1 / 1
| 1

sparser
"As shown in Fig.  xref , knockout of USP15 decreased BARD1HP1γ interaction in cells, and this effect is dependent on USP15 deubiquitinating enzyme activity."
USP15 deubiquitinates BARD1.
| 8
USP15 deubiquitinates BARD1. 7 / 7
| 7

reach
"Other epigenetic modifications associated with PARPi resistance includ de-ubiquitination of the BARD1 BRCT1 domain by the USP15 enzyme (52)."

reach
"Subsequently, USP15 deubiquitinates BARD1 BRCT domain, and promotes BARD1-HP1gamma interaction, resulting in BRCA1 and BARD1 retention at DSBs."

reach
"XREF_FIG, USP15 deubiquitinated the BRCT domain of BARD1 in vitro."

reach
"USP15 deubiquitinates BARD1 BRCT domain."

reach
"XREF_FIG, USP15 deubiquitinated BARD1 BRCT domain in vitro, and promoted BARD1-HP1gamma interaction."

reach
"Deubiquitination of BARD1 BRCT domain by USP15 assisted BRCA1 retention at DSBs and causes PARPi resistance [116]."

reach
"Because the C terminal of BARD1 is important for its functions in HR, we then investigated if USP15 deubiquitinates BARD1 BRCT domain in vitro and in vivo."
USP15-D967H deubiquitinates BARD1. 1 / 1
| 1

reach
"At the molecular level, USP15 M861V and D967H disrupted USP15-BARD1 interaction and failed to deubiquitinate BARD1 at the BRCT domain."
TP53 affects USP15
2 | 9 9
2 | 9 7

reach
"The GST-USP15 : His 6 -p53 complex co and precipitated by glutathione-Sepharose, suggesting that USP15 directly associates with p53 (XREF_FIG)."

reach
"The interaction between USP15 and p53 was verified by GST pull-down assays."

reach
"In this study, we have demonstrated that USP15 binds to p53 (XREF_FIG)."

sparser
"To evaluate whether the impaired function of TIFAB-deficient AML cells is associated with the USP15-p53 axis, we examined the expression of p53 target genes."

reach
"Recently, it has been demonstrated that USP15 binds to and stabilizes the transcription factor p53 [89]."

sparser
"The interaction between USP15 and p53 was verified by GST pull-down assays."

reach
"19 We wished to determine whether USP15 also binds to p53."

No evidence text available

reach
"In the current study, we identify that USP15 binds to and stabilizes p53 through deubiquitination in U2OS and HEK293 cells."

reach
"Taken together, the results suggest that USP15 can bind to p53 and regulate its stability."
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
DDX58 affects USP15
2 | 8 12
2 | 8 10

reach
"We hypothesized that USP15 interacts with RIG-I and the interaction is independent of the DUB activity, and the coimmunoprecipitation assay proved the credibility."

reach
"Data are means ± SD from three independent experiments.Figure 7: (a) The interaction between USP15 and RIG-I was independent of the DUB activity of USP15."

sparser
"Our result showed that the presence of GST-RIG-I-N retained USP15 C250 (Fig. 7e), indicating that the interaction of RIG-I with USP15 is due to a direct physical association."

sparser
"Mechanistically, the interaction between RIG-I and USP15 suggests the model that USP15 prevents the access of a downstream target to the RIG-I complex."

sparser
"We used a coimmunoprecipitation experiment to map the domain of USP15 that facilitates its interaction with RIG-I. As demonstrated in Fig. 7c, RIG-I interacted with USP15-WT and the C-terminal UCH domain (USP15-C250), but not with the N-terminal DUSP domain (USP15-N249)."

reach
"Mechanistically, the interaction between RIG-I and USP15 suggests the model that USP15 prevents the access of a downstream target to the RIG-I complex."

sparser
"Figure 7: (a) The interaction between USP15 and RIG-I was independent of the DUB activity of USP15."

sparser
"Together, these results demonstrate that USP15 and RIG-I form a complex through the UCH domain of USP15, and that the N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."

No evidence text available

sparser
"We hypothesized that USP15 interacts with RIG-I and the interaction is independent of the DUB activity, and the coimmunoprecipitation assay proved the credibility."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
USP15 affects E6
2 | 9 13
USP15 binds E6.
2 | 4 13
2 | 4 7

reach
"As TRIM25 protein stability is regulated by the balance between degradative K48 linked ubiquitination and USP15 mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6, TRIM25, and USP15 complex."

sparser
"The Gaussia princeps luciferase protein complementation assay shows that USP15 interacts with the key oncoprotein human papillomavirus (HPV) E6, while USP29 and USP33 bind to E7 protein, suggesting that cellular DUBs impact HPV tumorigenesis by regulating the stability of the viral proteins [ xref ]."

sparser
"This study focuses on the functional consequences of the interaction of E6 with USP15."

sparser
"In addition, a recent study has found that the interaction between USP15 and E6 contributes to viral immune evasion by suppressing RIG-I-mediated immune activation ( xref ), suggesting a complex relationship between the viral oncoprotein and host factors."

No evidence text available

sparser
"The Gaussia princeps luciferase protein complementation assay shows that USP15 interacts with the key oncoprotein human papillomavirus (HPV) E6, while USP29 and USP33 bind to E7 protein, suggesting that cellular DUBs impact HPV tumorigenesis by regulating the stability of the viral proteins [45]."

No evidence text available

sparser
"The ubiquitin-specific peptidase USP15, a member of the largest subfamily of deubiquitinating enzymes (DUBs), binds to HPV E6 and regulates E6 protein stability ( xref ; xref )."

sparser
"In addition, putative mechanisms modulating E6-mediated degradation have been proposed, which include proteasome-mediated degradation of both E6 ( xref ) and E6AP ( xref ), stabilization of E6 by E6AP ( xref ), E6 interaction with the deubiquitinating enzyme USP15 ( xref ) and inhibition of the E6/E6AP activity by the EDD ubiquitin ligase ( xref )."

reach
"In addition, putative mechanisms modulating E6 mediated degradation have been proposed, which include proteasome mediated degradation of both E6 and E6AP, stabilization of E6 by E6AP, E6 interaction with the deubiquitinating enzyme USP15 and inhibition of the E6/E6AP activity by the EDD ubiquitin ligase."
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
USP15 increases the amount of E6.
| 3
USP15 increases the amount of E6. 3 / 3
| 3

reach
"Overexpression of USP15 resulted in increased levels of the E6 protein, and the small interfering RNA mediated knockdown of USP15 decreased E6 protein levels."

reach
"Our results indicate that USP15 could increase the level of HPV16 E6 by inhibiting E6 degradation."

reach
"Knockdown of USP15 by siRNA approach demonstrated that silencing of USP15 decreases the protein levels of E6 significantly."
USP15 activates E6.
| 2
USP15 activates E6. 2 / 2
| 2

reach
"In addition, HPV16 E6 mRNA was not induced by USP15; therefore, HPV16 E6 appears to be post-translationally regulated."

reach
"USP15 inhibited the degradation of HPV16 E6 in dose dependent manner."
SMURF2 affects USP15
3 | 8 10
SMURF2 binds USP15.
3 | 5 10
3 | 5 1

reach
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

reach
"Furthermore, recent reports have identified a number of shared substrates of SMURF2 and USP15 including MDM2, SMAD3, and RNF20, suggesting that the association between SMURF2 and USP15 may serve as a common regulatory method to control multiple analogous cellular protein complexes XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR."

No evidence text available

reach
"As shown in XREF_FIG, mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

No evidence text available

reach
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-beta receptor complex, where it deubiquitinates and stabilizes TbetaRI XREF_BIBR."

No evidence text available

sparser
"USP15 binds to Smurf2 complex and deubiquitinates and stabilizes TRβ1, and that apparently leads to boosting of TGF-β-mediated signaling."

reach
"USP15 binds to Smurf2 complex and deubiquitinates and stabilizes TRbeta1, and that apparently leads to boosting of TGF-beta-mediated signaling."
| 9

sparser
"As shown in xref , mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

sparser
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

sparser
"On the contrary, when the level of TGF β in the body is too low, USP15 associates with smad7 and smurf2 to form a complex to deubiquitinate the type I TGF β receptor and further increase the expression level of the intracellular signaling of TGF β [ xref , xref ]."

sparser
"At the receptor level USP15 forms a complex with SMAD7 and SMURF2 with USP15 opposing the effects of the SMURF2 ligase on TβR stabilization ."

sparser
"USP15 binds to the Smad7SMURF2 complex, which recruits USP15 to TGFβ receptor I and stabilizes it without direct binding [ xref ]."

sparser
"USP15 forms a complex with SMAD7 and SMURF2 and opposes the SMURF2-mediated ubiquitination of TβRI when the level of active TGF-β is low [ xref ]."

sparser
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-β receptor complex, where it deubiquitinates and stabilizes TβRI xref ."

sparser
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-β receptor (TβR-I), leading to an enhanced TGF-β signal."

sparser
"USP15 binds to the Smad7-Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-β type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-β signalling."
SMURF2 activates USP15.
| 2
SMURF2 activates USP15. 2 / 2
| 2

reach
"Our results show that SMURF2 is a critical target of USP15 in the TGF-beta pathway and may also explain how USP15 and SMURF2 target multiple complementary protein complexes in other pathways."

reach
"In cells, the UbVs inhibited the deubiquitination of two USP15 substrates, SMURF2 and TRIM25, and the diUbV inhibited the effects of USP15 on the transforming growth factor beta pathway."
SMURF2 inhibits USP15.
| 1
SMURF2 inhibits USP15. 1 / 1
| 1

reach
"Surprisingly, co-expression of catalytically inactive SMURF2 completely abolished the ability of USP15 to activate this reporter (XREF_FIG)."
USP15 affects SMAD7
1 | 3 14
1 | 2 4

sparser
"To investigate how USP15 irregulates TGF- β /smad signaling in breast cancer, we first identified a strong protein interaction between USP15 and smad7, a kinase substrate of the TGF- β receptor, by experiments of coimmunoprecipitation. ( xref )."

sparser
"USP15 directly interacts with SMAD7 and other SMAD family members to deubiquitinate and stabilize type 1 TGF-β receptors, promoting TGF-β signaling ( xref , xref )."

sparser
"USP15 also binds to SMAD7, forming a complex with SMURF2 that negatively regulates TGF-β."

reach
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-beta receptor complex, where it deubiquitinates and stabilizes TbetaRI XREF_BIBR."

No evidence text available

sparser
"Similar to TGF-β type I receptor associated with USP15, rather than binding to the receptor directly, USP15 binds to the receptor by SMAD7, a scaffold that also recruits SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2)."

reach
"Moreover, Smad7 can simultaneously bind Smurf2 and the protein deubiquitinase USP15, recruiting both enzymes to the TGF-beta receptor complex for an integrated control of receptor polyubiquitination as a function of ligand concentration."
| 9

sparser
"As shown in xref , mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

sparser
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

sparser
"On the contrary, when the level of TGF β in the body is too low, USP15 associates with smad7 and smurf2 to form a complex to deubiquitinate the type I TGF β receptor and further increase the expression level of the intracellular signaling of TGF β [ xref , xref ]."

sparser
"At the receptor level USP15 forms a complex with SMAD7 and SMURF2 with USP15 opposing the effects of the SMURF2 ligase on TβR stabilization ."

sparser
"USP15 binds to the Smad7SMURF2 complex, which recruits USP15 to TGFβ receptor I and stabilizes it without direct binding [ xref ]."

sparser
"USP15 forms a complex with SMAD7 and SMURF2 and opposes the SMURF2-mediated ubiquitination of TβRI when the level of active TGF-β is low [ xref ]."

sparser
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-β receptor complex, where it deubiquitinates and stabilizes TβRI xref ."

sparser
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-β receptor (TβR-I), leading to an enhanced TGF-β signal."

sparser
"USP15 binds to the Smad7-Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-β type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-β signalling."
| 1 1

reach
"USP15 binds to the SMAD7–SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

sparser
"For example, the binding of USP15 to the SMAD7-specific E3 ubiquitin ligase 2 (SMURF2) complex results in the deubiquitination and stabilization of TGF-β receptor 1 (TβRI) and promotes TGF-β activity."

eidos
"USP15 knockdown significantly inhibited cell proliferation , invasion and epithelial-mesenchymal transition ( EMT ) of GC in vitro , while overexpression of USP15 promoted these processes ."

reach
"Rescue assays further suggested that USP15 promoted hPASMC proliferation and migration in a YAP1/TAZ-dependent manner."

reach
"USP15 promotes cell proliferation, invasion and EMT progression of GC via regulating the Wnt and beta-catenin pathway, which suggests that USP15 is a novel potential therapeutic target for GC."

reach
"On the other hand, SRSF1 is upregulated by high USP15 and USP4 that enhance cell proliferation and invasion (Fig. 7D)."

reach
"USP15 and USP4 induces cancer cell proliferation via regulating alternative splicing of SRSF1."

reach
"USP15 enhances the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TβRI in vitro."

reach
"Knockdown of USP15 without TGF-beta treatment promoted the cell proliferation."

reach
"USP15 overexpression promotes MM cell proliferation."

reach
"The authors hypothesized that USP15 was up-regulated and enhanced the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TGF-β receptor I (TβRI) in vitro."

reach
"Human pulmonary artery smooth muscle cells (hPASMCs) were exposed to hypoxia to mimic PH in vitro, and USP15 knockdown significantly inhibited cell proliferation, migration, and YAP1/TAZ signaling in hypoxic hPASMCs."

reach
"USP15 overexpression inhibits cell proliferation and growth in soft agar."

reach
"In addition, USP15 overexpression reversed the inhibited proliferation and migration ability of glioma cells induced by GINS1 silencing in U251 cells, whereas USP15 knockdown impaired the elevated proliferation and migration ability of glioma cells induced by GINS1 overexpression in A72 cells."
| 1 18 2
| 1 13 2
| 1 13 2

sparser
"In conclusion, our results indicate that NF-κBp65 is involved in the regulation of USP15 in MM proliferation and apoptosis and that USP15 inhibits MM apoptosis through activating a feedback loop with NF-κBp65."

reach
"These results suggest that targeting USP15 may both induce tumor cell apoptosis and boost antitumor T cell responses and, thus, have important clinical applications."

reach
"These findings suggest that targeting USP15 may both induce tumor cell apoptosis and boost antitumor T cell responses."

reach
"PDTC treatment inhibits USP15 overexpression induced MM cell proliferation and apoptosis inhibition."

reach
"Zhou et al. noted that depletion of USP15 in multiple myeloma enhanced the NFkappaB transcriptional activity and reduced the rate of apoptosis."

reach
"USP15 inhibited MM cell apoptosis through activating a feedback loop with NF-kappaBp65."

sparser
"USP15 inhibited MM cell apoptosis through activating a feedback loop with NF-κBp65."

reach
"USP15 overexpression inhibits MM cell apoptosis."

reach
"Overexpression of USP15 promoted proliferation and inhibited apoptosis, and these effects were inhibited by PDTC treatment."

eidos
"Overexpression of Ubiquitin-Specific Protease15 ( USP15 ) Promotes Tumor Growth and Inhibits Apoptosis and Correlated With Poor Disease-Free Survival in Hepatocellular Carcinoma ."
| 5

reach
"USP15 promotes the apoptosis of degenerative nucleus pulposus cells by suppressing the PI3K and AKT signalling pathway."

reach
"Under these standard T cell differentiation conditions, USP15 deficient and wild-type T cells were similar in differentiation and proliferation, although the USP15 deficient T cells had moderately enhanced apoptosis compared to wild-type T cells (XREF_SUPPLEMENTARY)."

reach
"The findings that USP15 deficiency promotes T cell activation and cancer cell apoptosis indicated that inhibition of USP15 might suppress tumor growth both via a tumor cell-intrinsic mechanism and by enhancing the anti-tumor host defense."

reach
"It was shown that when the XIAP gene was expressed in rat neonatal cardiomyocytes, it attenuated apoptosis induced by protein kinase C inhibition, hypoxia/ischemia, or isoproterenol stimulation.Ubiquitin-specific protease 15 (USP15), a member of cysteine protease deubiquitinases."

reach
"Crucially, ectopic expression of either p53 R175H or USP15 promoted p53 triggered apoptosis in human cervical cancer cells."
E6 affects USP15
2 | 6 13
E6 binds USP15.
2 | 4 13
2 | 4 7

reach
"As TRIM25 protein stability is regulated by the balance between degradative K48 linked ubiquitination and USP15 mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6, TRIM25, and USP15 complex."

sparser
"The Gaussia princeps luciferase protein complementation assay shows that USP15 interacts with the key oncoprotein human papillomavirus (HPV) E6, while USP29 and USP33 bind to E7 protein, suggesting that cellular DUBs impact HPV tumorigenesis by regulating the stability of the viral proteins [ xref ]."

sparser
"This study focuses on the functional consequences of the interaction of E6 with USP15."

sparser
"In addition, a recent study has found that the interaction between USP15 and E6 contributes to viral immune evasion by suppressing RIG-I-mediated immune activation ( xref ), suggesting a complex relationship between the viral oncoprotein and host factors."

No evidence text available

sparser
"The Gaussia princeps luciferase protein complementation assay shows that USP15 interacts with the key oncoprotein human papillomavirus (HPV) E6, while USP29 and USP33 bind to E7 protein, suggesting that cellular DUBs impact HPV tumorigenesis by regulating the stability of the viral proteins [45]."

No evidence text available

sparser
"The ubiquitin-specific peptidase USP15, a member of the largest subfamily of deubiquitinating enzymes (DUBs), binds to HPV E6 and regulates E6 protein stability ( xref ; xref )."

sparser
"In addition, putative mechanisms modulating E6-mediated degradation have been proposed, which include proteasome-mediated degradation of both E6 ( xref ) and E6AP ( xref ), stabilization of E6 by E6AP ( xref ), E6 interaction with the deubiquitinating enzyme USP15 ( xref ) and inhibition of the E6/E6AP activity by the EDD ubiquitin ligase ( xref )."

reach
"In addition, putative mechanisms modulating E6 mediated degradation have been proposed, which include proteasome mediated degradation of both E6 and E6AP, stabilization of E6 by E6AP, E6 interaction with the deubiquitinating enzyme USP15 and inhibition of the E6/E6AP activity by the EDD ubiquitin ligase."
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
E6 activates USP15.
| 2
E6 activates USP15. 2 / 2
| 2

reach
"Moreover, the human papillomavirus (HPV) E6 protein increases the activity of USP15 to promote proteasomal degradation of TRIM25, and Herpesvirus mediates autoubiquitination of TRIM25 to prevent K63 linked ubiquitination of RIG-I XREF_BIBR, XREF_BIBR."

reach
"For example, the non structural protein 1 (NS1) of influenza A virus displaces the SPRY domain by binding to an overlapping contact site on the CC domain [XREF_BIBR], the V proteins of measles, Sendai and parainfluenza viruses bind to the SPRY domain and prevent the interaction of TRIM25 with RIG-I [XREF_BIBR], while the E6 proteins of oncogenic HPVs target TRIM25 and USP15 to promote degradation of the ligase [XREF_BIBR]."
USP15 affects Interferon
| 3 16
USP15 inhibits Interferon.
| 2 9
| 2 9

reach
"However, when expressed alone, USP15 inhibited the IFN signaling pathway."

reach
"We will discuss them one by one.In a study using HEK293 T cells and Sendai virus (SeV), knockdown of the gene transcribing USP15 resulted in upregulation of type I IFN, while overexpression of USP15 decreased type I interferon as USP15 showed dose-dependent inhibition of IFN-β [16] ."

reach
"Although we can not rule out the possibility that USP15 exerts its effects in a third uncharacterized manner, the data in this study demonstrate that USP15 sequesters the interaction between RIG-I and IPS-1, shedding light on the mechanisms underlying the catalytic-activity-independent antagonism of IFN by USP15."

eidos
"Knockdown of USP15 results in upregulation of type I IFN ."

reach
"We will discuss the DUBs that influence the pathways of interferons (IFN), tumor necrosis factors (TNF), TNF-related apoptosis-inducing ligand (TRAIL), interleukins (IL) and chemokines.In a study using HEK293 T cells and Sendai virus (SeV), knockdown of the gene transcribing USP15 resulted in upregulation of type I IFN, while overexpression of USP15 decreased type I interferon as USP15 showed dose-dependent inhibition of IFN-β [16]."

reach
"To verify the specific mechanism of USP15 mediated IFN inhibition, we identified the DUB activity site His862 of USP15 in vivo and in vitro, and we presented evidence that USP15 functions as a RIG-I deubiquitinase and specifically removes Lys63 linked polyubiquitin chains."

reach
"In a study using HEK293T cells and Sendai virus (SeV), knockdown of the gene transcribing USP15 resulted in upregulation of type I IFN, while overexpression of USP15 decreased type I interferon as USP15 showed dose dependent inhibition of IFN-beta [XREF_BIBR]."

reach
"Reminding us USP15 may antagonize type I IFN induction independently of catalytic activity."

reach
"These findings taken together support the hypothesis that USP15 function as a negative regulator of IFN signaling.We also assessed whether USP15 deubiquitinase activity is required for its inhibitory role in SEV-induced IFN induction."

reach
"These results together suggested that both USP15 constructed in two different expression plasmids inhibited the production of IFN."
USP15 activates Interferon.
| 1 5
| 1 5

reach
"In addition, the ectopic expression of USP15 enhances the TRIM25- and RIG-I-mediated production of type I IFN and thus suppresses RNA virus replication, whereas the depletion of USP15 causes decreased IFN production and markedly enhanced viral replication (85)."

reach
"Knockdown of USP15 results in upregulation of type I IFN."

reach
"In addition, we demonstrated that in contrast to USP15 de-ubiquitinating (DUB) activity, USP15 mediated inhibition of IFN signaling was not abolished by mutations eliminating the catalytic activity, indicating that a fraction of USP15 mediated IFN antagonism was independent of the DUB activity."

eidos
"In addition , the ectopic expression of USP15 enhances the TRIM25 - and RIG-I-mediated production of type I IFN and thus suppresses RNA virus replication , whereas the depletion of USP15 causes decreased IFN production and markedly enhanced viral replication ( 85 ) ."

reach
"Furthermore, ectopic expression of USP15 enhanced the TRIM25- and RIG-I-dependent production of type I IFN and suppressed RNA virus replication."

reach
"Among these proteins, we found Ubiquitin carboxyl-terminal hydrolase 15 (Usp15) which positively regulates type I interferon responses and thereby antiviral immune response."
USP15 increases the amount of Interferon.
| 2
USP15 increases the amount of Interferon. 2 / 2
| 2

reach
"Several other DUBs have also been implicated in the regulation of RIG-I ubiquitination and virus induced type I IFN expression; these include A20, USP3, USP15, USP21, and USP25 XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR."

reach
"USP15 enhances the TRIM25- and RIG-I-mediated expression of type I IFN."
USP15 affects HBx
| 9 11
| 9 11

sparser
"These results clearly indicate that HBx and USP15 interact specifically both in vitro and in vivo ."

reach
"To determine whether there is a possible association between HBx and USP15, perhaps under more physiologic condition, the CytoTrap yeast two-hybrid system was employed, and the results demonstrated that HBx could interact with USP15, and the region between HBx amino acid residues 51 and 80 is required for the interaction with USP15."

sparser
"USP15 binds to HBx and stabilizes HBx through removal of Lys 48 -linked polyubiquitin moieties from HBx, thus extending its half-life and increasing its steady-state level."

reach
"To further confirm the interaction between HBx and USP15 in vitro, the GST pull-down assay was performed."

sparser
"HBx associates with USP15 in vitro and in vivo ."

sparser
"This implied that the association of USP15 with HBx not only increases the stability of HBx but also augments HBx-mediated oncogenic signals."

sparser
"To further confirm the interaction between HBx and USP15 in vitro , the GST pull-down assay was performed."

reach
"We demonstrate for the first time that USP15 specifically interacts with HBx and consequently increases HBx stability and the steady-state level by inhibition of HBx ubiquitination and degradation."

sparser
"Given the observations that USP15 binds to HBx, trims ubiquitin from HBx, and consequently increases HBx stability and protein level, we went on to explore whether the transcriptional transactivation function of HBx could be increased as a result of elevated HBx protein level due to the interaction between USP15 and HBx."

sparser
"To determine whether there is a possible association between HBx and USP15, perhaps under more physiologic condition, the CytoTrap yeast two-hybrid system was employed, and the results demonstrated that HBx could interact with USP15, and the region between HBx amino acid residues 51 and 80 is required for the interaction with USP15."
USP15 affects NFE2L1
1 1 | 17
USP15 activates NFE2L1.
| 8
USP15 activates NFE2L1. 8 / 8
| 8

reach
"Collectively, we concluded that endogenous USP15 enhances the NRF1 mediated gene expression for proteasome recovery.Finally, we examined the biological relationship between USP15 and other Cap'n ' Col[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These results uncover a new regulatory mechanism that USP15 activates Nrf1 against the beta-TrCP inhibition to maintain proteostasis."

reach
"Moreover, the siRNA mediated knockdown of endogenous USP15 reduced the protein turnover time of endogenous NRF1."

reach
"We also confirmed that other USP15 siRNAs can cause the mRNA induction of NRF1 (data not shown)."

reach
"Here, we report that USP15 (Ubiquitin Specific Protease 15) activates Nrf1 in the nucleus by stabilizing it through deubiquitination."

reach
"These results clearly suggest that USP15 activates the transcriptional activity of Nrf1."

reach
"Hence, these results strongly suggest that USP15 mediates the transcriptional activities of Nrf1."

reach
"A cycloheximide chase experiment also revealed that USP15 increases the turnover time of Nrf1."
USP15 binds NFE2L1.
1 | 4
1 | 4

reach
"Consistently, 3 x Flag-Nrf1 was coprecipitated with V5-USP15, indicating that USP15 physically interacts with Nrf1 in cells.We next examined whether USP15 stabilizes Nrf1 through its deubiquitination."

reach
"USP15 physically interacts with Nrf1, and it markedly stabilizes Nrf1 by removing its ubiquitin moieties."

reach
"Nevertheless, the coexpression of 3 x Flag-Nrf1 caused the nuclear translocation of V5-USP15, implying a physical interaction between USP15 and Nrf1 in cells (top panels)."

reach
"To address this hypothesis, we first examined an association between USP15 and Nrf1 using immunoprecipitation."

No evidence text available
USP15 deubiquitinates NFE2L1.
1 | 3
USP15 deubiquitinates NFE2L1. 4 / 4
1 | 3

reach
"Under these experimental conditions, USP15 significantly reduced the smear patterns of 3 x Flag-Nrf1, suggesting that USP15 promotes the deubiquitination of Nrf1."

"Here, we report that USP15 (Ubiquitin-Specific Protease 15) activates Nrf1 in the nucleus by stabilizing it through deubiquitination."

reach
"As a result, these data strongly suggest that USP15 stabilizes endogenous NRF1.We further conducted a ubiquitination assay to examine whether USP15 deubiquitinates Nrf1."

reach
"Taken together, it is fully possible that USP15 deubiquitinates Nrf1 in the nucleus."
USP15 increases the amount of NFE2L1.
| 2
USP15 increases the amount of NFE2L1. 2 / 2
| 2

reach
"Unexpectedly, USP15 siRNA alone induced the mRNA expression of NRF1, thereby augmenting the expression of these proteasomal genes."

reach
"Furthermore, we observed that USP15 siRNAs significantly increased the protein expression levels of endogenous NRF1 in HeLa cells."
USP15 affects NFE2L2
| 17
USP15 inhibits NFE2L2.
| 8
USP15 inhibits NFE2L2. 8 / 9
| 8

reach
"Taken together, these data indicate that USP15 inhibition protects podocytes from HG-induced injury by enhancing Nrf2 activation via Keap1."

reach
"USP15 negatively regulates Nrf2 through deubiquitination of KEAP1 and affects paclitaxel resistance ."

reach
"Taken together, these results further demonstrate that USP15 negatively regulates the Nrf2 antioxidant response."

reach
"Myc-USP15 inhibited the activity of Nrf2 in a concentration dependent manner (XREF_FIG)."

reach
"USP15 negatively regulates Nrf2 through deubiquitination of Keap1."

reach
"USP15 inhibits the transcriptional activity of Nrf2 and the Nrf2 dependent antioxidant response."

reach
"In accordance, the deubiquitinating enzyme USP15 negatively regulates Nrf2 through deubiquitination of Keap1 [XREF_BIBR]."

reach
"USP15 increases the degradation of Nrf2 by stabilizing the Cul3-Keap1-E3 ubiquitin ligase complex."
USP15 decreases the amount of NFE2L2.
| 7
USP15 decreases the amount of NFE2L2. 7 / 7
| 7

reach
"USP15 inhibits Nrf2 protein levels and expression of its target genes."

reach
"Taken together these results demonstrate the mechanism by which USP15 leads to decreased Nrf2 protein levels : USP15 is able to stabilize the Cul3-Keap1-E3 ligase complex through deubiquitination of Keap1, resulting in increased E3 ligase activity and ubiquitination of Nrf2, which ultimately leads to degradation of the Nrf2 protein."

reach
"These results indicate that USP15 may inhibit Nrf2 protein expression and thus, its activity, by increasing Nrf2 protein degradation."

reach
"We found that USP15 is unable to inhibit Nrf2 protein levels in the absence of Keap1 (XREF_FIG, lanes 3-4)."

reach
"Further investigation showed that inhibition of USP15 enhanced the activation of NF-E2-related factor 2 (Nrf2) and expression of Nrf2 target genes in HG-simulated podocytes."

reach
"In addition, USP15 is unable to inhibit Nrf2 protein levels when the seven lysine residues in the Neh2 domain required for ubiquitination by the Keap1-Cul3-E3 ligase complex are mutated (Nrf2-K7) (XREF_FIG, lanes 3-4), or when the Neh2 domain is deleted (XREF_FIG, lanes 5-6)."

reach
"Conversely, when the Neh6 domain of Nrf2 is deleted, USP15 is still able to inhibit Nrf2 protein expression (XREF_FIG, lanes 7-8)."
USP15 deubiquitinates NFE2L2.
| 2
USP15 leads to the deubiquitination of NFE2L2. 2 / 2
| 2

reach
"USP15 enhanced the degradation and ubiquitination of NRF2 and induced G6PD expression, leading to the progression of DNP."

reach
"USP15 promotes ubiquitination and degradation of NRF2, reducing the expression of G6PD."
TGFB affects USP15
| 17
TGFB activates USP15.
| 15
TGFB activates USP15. 10 / 15
| 15

reach
"In the presence MG132 that inhibits proteasome activity, treatment with TGF-beta increases USP15 production (XREF_FIG)."

reach
"TGF-beta upregulates the translation of USP15 through a non smad pathway."

reach
"TGF-beta promotes USP15 production."

reach
"For example, TGF-β upregulates the translation of USP15 via the PI3K/AKT pathway to promote p53 stability [39]."

reach
"23 However, in advanced cancer, TGF-beta signaling can also mediate USP15 to promote oncogenesis."

reach
"There are several reports implying that TGF-beta may upregulate USP15."

reach
"Upregulation of USP15 by TGF-beta was also observed in HEK293 cells (XREF_FIG)."

reach
"It is known that TGFbeta upregulates the protein translation of USP15 in a PI3K and Akt dependent manner."

reach
"TGF-beta promotes the translation of USP15 through activation of mammalian target of rapamycin by the phosphoinositide 3-kinase/AKT pathway."

reach
"Taken together, TGF-beta enhanced USP15 production was due to upregulation of its translation and not by suppression of USP15 degradation."
TGFB increases the amount of USP15.
| 2
TGFB increases the amount of USP15. 2 / 3
| 2

reach
"Monoubiquitination of R-SMADs prevents the R, SMAD, and SMAD4 complex binding with the DNA, while USP15 reverses the modification and promotes TGFbeta dependent transcription."

reach
"In addition, in the presence of cycloheximide that blocks translation, the levels of USP15 increased by TGF-beta treatments were blocked (XREF_FIG)."
BARD1 affects USP15
| 5 13
| 5 12

reach
"USP15 interacts with BARD1 via its C-terminal region."

sparser
"Furthermore, cancer-associated USP15 mutations, with decreased USP15-BARD1 interaction, increases PARP inhibitor sensitivity in cancer cells."

sparser
"Interestingly, USP15BARD1 interaction was increase after IR, HU, MMC, or CPT treatment (Fig.  xref )."

sparser
"Moreover, USP15 C-terminal is mutated in breast cancer patients, disrupting USP15BARD1 interaction and resulting in HR defect."

sparser
"USP15 deletion mutant (deletion residues 740–981) abolished the binding of USP15 with BARD1."

sparser
"As shown in Fig.  xref , endogenous USP15 and BARD1 associated with each other in cells."

sparser
"More interestingly, patients carried USP15 mutations that disrupted USP15-BARD1 interaction, and the cancer cell is more sensitive to PARP inhibitor."

sparser
"Since USP15 interacts with BARD1 and this interaction is important for HR, we hypothesized that BARD1 is the prime target of USP15."

sparser
"Furthermore, the interaction between USP15 and BARD1 was confirmed by in vitro glutathione S -transferase (GST) pull-down assay (Supplementary Fig.  xref )."

sparser
"Importantly, USP15BARD1 interaction is essential for HR and cancer cell response to PARP inhibitor (Fig.  xref and Supplementary Fig.  xref )."
USP15 binds CBX3 and BARD1. 1 / 1
| 1

sparser
"As shown in Fig.  xref , knockout of USP15 decreased BARD1HP1γ interaction in cells, and this effect is dependent on USP15 deubiquitinating enzyme activity."
USP15 affects PRPF31
3 1 | 8 3
USP15 binds PRPF31.
3 | 3 3
3 | 3 3

No evidence text available

reach
"We then confirmed the interaction between PRP31 and USP15 with immunoprecipitation."

sparser
"However, the DUSP-UBL domain of USP15 interacted with PRP31 in the presence of SART3 (Figure xref ) indicating that the interaction between PRP31 and USP15 was indirect but mediated by SART3."

No evidence text available

No evidence text available

sparser
"To examine whether PRP31 interacts directly with USP15, glutathione beads immobilized with a GST-tagged DUSP-UBL domain of USP15 was incubated with PRP31, which was synthesized with the in vitro transcription/translation (IVT/T) in the absence or presence of the SART3 HAT domains."

reach
"However, the DUSP-UBL domain of USP15 interacted with PRP31 in the presence of SART3 indicating that the interaction between PRP31 and USP15 was indirect but mediated by SART3."

reach
"To examine whether PRP31 interacts directly with USP15, glutathione beads immobilized with a GST tagged DUSP-UBL domain of USP15 was incubated with PRP31, which was synthesized with the in vitro transcription and translation (IVT/T) in the absence or presence of the SART3 HAT domains."

sparser
"We then confirmed the interaction between PRP31 and USP15 with immunoprecipitation (Figure xref )."
USP15 deubiquitinates PRPF31.
1 | 5
USP15 deubiquitinates PRPF31. 6 / 6
1 | 5

reach
"These findings suggest that USP15 deubiquitinates PRP3 as well as PRP31 when they are ubiquitinated by E3 ligase although USP15 may have more preference for PRP31."

reach
"Moreover, we found that USP15 and USP4 deubiquitinated substrates PRP31 and PRP3 simultaneously."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

"USP15 regulates dynamic protein-protein interactions of the spliceosome through deubiquitination of PRP31"

reach
"We further confirmed that the modified forms of PRP31 represented a covalent modification of PRP31 with ubiquitin using the denaturing NiNTA-pull down assay and found that USP15 WT but not inactive USP15 C269A led to deubiquitination of PRP31 in the cell."
USP15 affects FHL1
2 | 7 6
USP15 binds FHL1.
2 | 3 6
2 | 3 6

sparser
"We have shown that USP15 interacts physically and functionally with SLIM1, and stabilizes SLIM1 by deubiquitination in the transient expression system in HEK293T cells."

reach
"Thus, the protein levels of SLIM1 are regulated by the Ub-proteasomal system, and USP15 interacts physically and functionally with SLIM1 in mammalian cells.The above results suggest that USP15 may hav[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"As shown in Fig. 1 B, purified recombinant USP15 and SLIM1 were also bound to each other under cell-free conditions, indicating that the interaction is direct."

sparser
"In an effort to find novel protein–protein interactions by computational prediction (to be reported elsewhere) and its biochemical confirmation, we have identified a novel interaction of USP15 with SL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"We have shown that USP15 interacts physically and functionally with SLIM1, and stabilizes SLIM1 by deubiquitination in the transient expression system in HEK293T cells."

sparser
"In the present study, we have shown that USP15 interacts with SLIM1 and deubiquitinates SLIM1, leading to the stabilization of SLIM1."

sparser
"Furthermore, USP15C269S, a catalytic-inactive USP15 mutant [16] was unable to bind with SLIM1, suggesting that the region around C269, the core enzymatic domain, was critical for the interaction."

No evidence text available

sparser
"Thus, the protein levels of SLIM1 are regulated by the Ub-proteasomal system, and USP15 interacts physically and functionally with SLIM1 in mammalian cells."

reach
"In the present study, we have shown that USP15 interacts with SLIM1 and deubiquitinates SLIM1, leading to the stabilization of SLIM1."
USP15 deubiquitinates FHL1.
| 3
USP15 deubiquitinates FHL1. 3 / 3
| 3

reach
"As we found that SLIM1 was detected in poly-ubiquitinated forms, as well as a non ubiquitinated form, when SLIM1 and Ub were co-expressed in the presence of the proteasome inhibitor MG-132 in HEK293T [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"We found a novel protein protein interaction between ubiquitin specific protease 15 (USP15) and skeletal muscle LIM protein 1 (SLIM1) : USP15 and SLIM1 directly bound under cell-free conditions and co-immunoprecipitated from the lysates of the cells, where they were co-expressed; and USP15 deubiquitinated SLIM1, resulting in the increase of protein levels of SLIM1."

reach
"In the present study, we have shown that USP15 interacts with SLIM1 and deubiquitinates SLIM1, leading to the stabilization of SLIM1."
USP15 increases the amount of FHL1.
| 1
Modified USP15 increases the amount of FHL1. 1 / 1
| 1

reach
"Furthermore, co-expression of USP15 increased the protein levels of SLIM1 depending on its deubiquitinating activity, suggesting an escape from the proteasomal degradation."
| 8

reach
"XREF_BIBR, XREF_BIBR Furthermore, deubiquitylating enzyme USP15 mediates K48 linked deubiquitylation of ALK3, to promote ALK3-smad1 signal and BMP induced osteoblast differentiation."

reach
"USP15 stimulates RORgammat activity and Th17 differentiation by enhancing SRC1 recruitment."

reach
"Reduction of USP15 expression from C2C12 myoblast cells inhibited BMP induced osteoblastic differentiation, as judged by the reduction in alkaline phosphatase induction."

reach
"Loss of USP15 in mouse myoblast cells suppressed BMP induced osteoblast differentiation."

reach
"USP15 deficiency promotes the activation of naive CD4 + T cells and their subsequent differentiation into the IFN-gamma-producing Th1 cells."

reach
"The mutation of Lys 446 to Arg or the deubiquitination of Lys 446 by USP15 promotes NCOA1 recruitment and Th17 differentiation."

reach
"We also show that loss of USP15 expression from mouse myoblast cells inhibits BMP induced osteoblast differentiation."

reach
"We previously revealed that USP15 promotes Th17 differentiation through removing a ubiquitin chain conjugated to Lys446 of RORγt which prevents the recruitment of SRC1 ."
| 3

reach
"Collectively, these results suggest that USP15 negatively regulates naive CD4 + T cell activation and T H 1 differentiation."

reach
"Impaired Th17 differentiation by both inactive C298A and knockdown of USP15 supports the positive role of USP15 in Th17 differentiation."

reach
"Knockdown of USP15 with two different shRNAs markedly inhibited Th17 differentiation (XREF_FIG, top panels and XREF_FIG) compared to knockdown of a close member of USP15, USP45 (XREF_FIG, bottom panels and XREF_FIG)."
USP15 affects TGFBR1
3 1 | 10
USP15 deubiquitinates TGFBR1.
1 | 6
USP15 deubiquitinates TGFBR1. 7 / 7
1 | 6

reach
"Ubiquitin-specific peptidase 15 (USP15), a deubiquitinating enzyme, binds to the SMAD7-SMURF2 complex and deubiquitinates and stabilizes TGFBR1, resulting in enhanced TGF-β signaling ."

reach
"Preliminary results by Ten Dijke and colleagues add weight to this theory whereby they identified that the ability of USP15 to deubiquitinate TbetaRI requires USP4, as USP15 was unable to perform this[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"USP15 binds to the Smad7 and Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-beta type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-beta signalling[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"For example, the closely related DUBs USP4, USP11 and USP15 have been reported to modulate TGFbeta signalling by deubiquitylating the type I TGFbeta receptor ALK5 [XREF_BIBR - XREF_BIBR]."

reach
"UCHL37, USP11, and USP15 de-ubiquitinate TbetaRI, XREF_BIBR, XREF_BIBR, XREF_BIBR while USP15, CYLD, and USP9X target SMAD4 or SMAD7."

reach
"It has been revealed that the DUBs, UCH37, USP11, and USP15, de-ubiquitinate and stabilize TbetaRI."
USP15 binds TGFBR1.
3 | 3
3 | 3

No evidence text available

No evidence text available

reach
"Ubiquitin-specific peptidase 15 (USP15), a deubiquitinating enzyme, binds to the SMAD7-SMURF2 complex and deubiquitinates and stabilizes TGFBR1, resulting in enhanced TGF-β signaling ."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."

reach
"USP15 binds to the Smad7 and Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-beta type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-beta signalling[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available
USP15 increases the amount of TGFBR1.
| 1
Modified USP15 increases the amount of TGFBR1. 1 / 1
| 1

reach
"In contrast, ectopic expression of USP15 did not augment TbetaRI levels or overall TGF-beta luciferase activity in SMURF2 CRSP1 cell lines when expressed alone or in combination with SMURF2 C/A indicating that USP15 's role in the TGF-beta pathway is dependent on SMURF2 function (XREF_SUPPLEMENTARY)."
USP15 affects NFkappaB
| 2 12
USP15 activates NFkappaB.
| 1 9
| 1 9

eidos
"USP15 is also reported to activate NF-kappaB signaling by deubiquitination and stabilization of the transcription factor NF-kappaB p65 , which inhibits apoptosis and induces cell proliferation in multiple myeloma [ 68 ] ."

reach
"In contrary, another study found no interaction between USP15 and IkappaBalpha, and it was proposed that USP11 inhibits the ubiquitination and degradation of IkappaBalpha in the early stage while USP15 functions at a later time point in the TNFalpha induced NF-kappaB activation XREF_BIBR."

reach
"Similarly, we observed that increasing quantities of USP15 caused the inhibition of SEV induced activation of ISRE (XREF_FIG), NF-kappaB (XREF_FIG), and IRF3 (XREF_FIG) promoters, additionally, the expression of ISGs."

reach
"Collectively, USP15 positively regulates TNFalpha- and IL-1beta-triggered NF-kappaB activation by distinct mechanisms, which reflects the potential nonredundant roles of TAB2 and TAB3."

reach
"Coexpression of increasing amounts of Myc tagged USP15 further enhanced the IFN-beta and NF-kappaB promoter activation stimulated by GST-RIG-I (2CARD) and TRIM25 in a dose dependent manner (XREF_FIG)."

reach
"Zhou et al. noted that depletion of USP15 in multiple myeloma enhanced the NFkappaB transcriptional activity and reduced the rate of apoptosis."

reach
"USP15 potentiates NF-kappaB activation by differentially stabilizing TAB2 and TAB3."

reach
"Overexpression of USP15 potentiated TNFalpha- or IL-1beta-triggered NF-kappaB activation and downstream genes transcription, whereas knockdown of USP15 had opposite effects."

reach
"As shown in XREF_FIG, co-expression of USP15 enhanced the AP-1, AP-2, AP-3, SP-1 and NF-kappaB signal pathways transactivated by ectopically expressed HBx although these signal pathways were also affected to a lesser extent by USP15 overexpression alone (XREF_FIG)."

reach
"However, Sun et al. found no interaction between USP15 and IkappaBalpha, and proposed that USP11 inhibits the ubiquitination and degradation of IkappaBalpha in the early stage, whereas USP15 functions at a later time point in the TNFalpha induced NF-kappaB activation XREF_BIBR."
USP15 inhibits NFkappaB.
| 1 3
| 1 3

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."

eidos
"Thus , USP15 inhibits NF-kB signaling and its downstream target genes by deubiquitination and stabilization of IkB in mammalian cells [ 33 ] , as illustrated in Figure 2 ( left ) ."

reach
"NF-kappaB signaling is negatively regulated by USP11 or USP15 mediated removal of K48 linked ubiquitin chains from IkappaBalpha [XREF_BIBR, XREF_BIBR]."

reach
"As shown in XREF_FIG e and XREF_FIG f, knockdown of USP15 increased the activation of NF-kappaB (5.9 vs 12.9, p = 1.92E-04) and IRF3 (15.6 vs 26.5, p = 1.04E-03) through reporter assays."
USP15 affects BMP
| 14
USP15 activates BMP.
| 7
USP15 activates BMP. 7 / 7
| 7

reach
"In addition, USP15 also promotes TGF-beta and BMP signaling by opposing monoubiquitylation of R-SMADs, thereby allowing activated R-SMAD-SMAD4 complexes to recognize target promoters [XREF_BIBR]."

reach
"Here, our findings show that USP15 DUB activity is essential for BMP signalling, and that loss of USP15 function inhibits BMP signalling in human and mouse cells, as well as during Xenopus embryogenesis."

reach
"We therefore asked whether siRNA mediated knockdown of SMAD6 was also able to rescue the inhibition of BMP signalling caused by USP15 depletion."

reach
"Inhibition of USP15 might therefore be employed as a strategy to inhibit BMP signalling."

reach
"Furthermore, they found that USP15 modulates the BMP pathway during Xenopus embryogenesis (Herhaus et al., 2014)."

reach
"Although the mechanisms by which USP15 acts on TGFbeta and BMP signalling proposed in this study differ from those described above, the fundamental observations that USP15 enhances both TGFbeta and BMP signalling are consistent with studies described above XREF_BIBR."

reach
"In this study USP15 was found to potentiate both the TGF-beta pathway and the related BMP pathway by targeting mono-ubiquitinated R-SMADs for deubiquitination."
USP15 decreases the amount of BMP.
| 4
USP15 decreases the amount of BMP. 4 / 4
| 4

reach
"Depletion of USP15 reduces BMP induced phosphorylation of SMAD1 and the transcription of BMP-target genes, as well as inhibiting the differentiation of myoblasts into osteoblasts."

reach
"Consistent with this, pretreatment of HEK293 cells with the proteasomal inhibitor bortezomib does indeed rescue BMP induced pSMAD1 levels reduced by USP15 depletion (XREF_FIG b)."

reach
"RNAi mediated depletion of USP15 increases ALK3 K48 linked polyubiquitylation, and reduces both BMP induced SMAD1 phosphorylation and transcription of BMP target genes."

reach
"They also showed that depletion of USP15 in Hela cells increased polyubiquitynation of BMP type I receptor, and inhibited BMP mediated Smad1 phosphorylation and BMP target gene transcription."
USP15 deubiquitinates BMP.
| 3
USP15 deubiquitinates BMP. 3 / 3
| 3

reach
"Herhaus and coworkers showed that USP15 can interact with and deubiquitinate BMP type I receptors, thereby promoting phosphorylation of Smad1 (Herhaus et al., 2014)."

reach
"Here, we demonstrate that USP15 enhances BMP signalling by associating with and deubiquitylating the BMP type I receptor ALK3."

reach
"Here, we demonstrate that USP15 interacts with and deubiquitylates the type I BMP receptor ALK3."
SMAD6 affects USP15
3 | 5 2
SMAD6 binds USP15.
3 | 4 2
3 | 4 2

No evidence text available

reach
"We show that USP15 interacts with SMAD6 and ALK3 and enhances BMP signalling by deubiquitylating ALK3 and rescuing it from proteasomal destruction."

reach
"FLAG-SMAD6, but none of the other FLAG-SMADs, was detected in USP15 IPs (XREF_FIG d), indicating the selective nature of the interaction between SMAD6 and USP15."

No evidence text available

sparser
"The selective nature of the interaction between USP15 and SMAD6 prompted us to investigate a possible role for USP15 in BMP signalling."

reach
"Interestingly, the interaction between GFP-USP15 and HA-SMAD6 was completely abolished by FLAG-ALK3 overexpression (XREF_FIG b), suggesting that USP15 : SMAD6 and USP15 : ALK3 interactions could be mutually exclusive."

reach
"The selective nature of the interaction between USP15 and SMAD6 prompted us to investigate a possible role for USP15 in BMP signalling."

sparser
"FLAG-SMAD6, but none of the other FLAG-SMADs, was detected in USP15 IPs ( xref d ), indicating the selective nature of the interaction between SMAD6 and USP15."

No evidence text available
SMAD6 inhibits USP15.
| 1
SMAD6 inhibits USP15. 1 / 2
| 1

reach
"SMAD6 overexpression disrupts the association of USP15 with ALK3 and potently inhibits BMP signalling."
NOP53 affects USP15
1 | 9 4
NOP53 binds USP15.
1 | 3 4
1 | 3 3

reach
"These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63 linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-beta induction."

sparser
"The result showed that USP15 can interact with GLTSCR2 upon viral infection ( xref )."

reach
"The result showed that USP15 can interact with GLTSCR2 upon viral infection (XREF_FIG)."

No evidence text available

sparser
"These results indicated that USP15 interacted with GLTSCR2, via binding to the range of residues 330–432 (G3)."

reach
"These results indicated that USP15 interacted with GLTSCR2, via binding to the range of residues 330-432 (G3)."

sparser
"The result showed that USP15 can interact with GLTSCR2 upon viral infection (Fig. 6a)."
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
NOP53 inhibits USP15.
| 3
NOP53 inhibits USP15. 3 / 3
| 3

reach
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63 linked and K48 linked ubiquitination of RIG-I."

reach
"Interestingly, we detected that reduction of endogenous GLTSCR2 resulted in increased USP15 activity in removing K48 linked ubiquitination of RIG-I-N in GLTSCR2 knockdown cells (XREF_FIG, lane 6), whereas GLTSCR2 presence reduced the activity of USP15 in removing K48 linked ubiquitination of RIG-I-N in HEK293T cells (lane 3)."

reach
"Interestingly, we detected that reduction of endogenous GLTSCR2 resulted in increased USP15 activity in removing K48-linked ubiquitination of RIG-I-N in GLTSCR2 knockdown cells (Fig. 6d, lane 6) , whereas GLTSCR2 presence reduced the activity of USP15 in removing K48-linked ubiquitination of RIG-I-N in HEK293T cells (lane 3)."
NOP53 activates USP15.
| 3
NOP53 activates USP15. 3 / 3
| 3

reach
"Interestingly, we detected that reduction of endogenous GLTSCR2 resulted in increased USP15 activity in removing K48-linked ubiquitination of RIG-I-N in GLTSCR2 knockdown cells (Fig. 6d, lane 6) , whereas GLTSCR2 presence reduced the activity of USP15 in removing K48-linked ubiquitination of RIG-I-N in HEK293T cells (lane 3)."

reach
"Our studies revealed a novel role the nucleolar protein GLTSCR2 played in attenuation of IFN-β , via cytoplasmic translocation to induce the ability of USP15 to deactivate RIG-I."

reach
"Our studies revealed a novel role the nucleolar protein GLTSCR2 played in attenuation of IFN-beta, via cytoplasmic translocation to induce the ability of USP15 to deactivate RIG-I."
MYC affects USP15
5 | 9
MYC binds USP15.
| 9
| 9

sparser
"HEK293T cells were co-transfected with plasmid encoding HA–RIG-I, Flag-IPS-1, increasing amounts of wild-type MycUSP15 or its mutants."

sparser
"To determine the precise role of USP15 plays in mediating the IFN signaling pathway and figure out the factors that drive the main different results, we asked for the USP15-Myc and TRIM25-V5 plasmids from Dr."

sparser
"In contrast, poly(I:C)-induced inhibition of VSV replication was recovered by overexpression of both USP15-HA and USP15-Myc (Supplementary Fig. S5)."

sparser
"As shown in supplementary Fig. S5, neither USP15-HA nor USP15-Myc suppressed the replication of VSV, not in accordance with the result described in Pauli’s paper that USP15 limited the VSV replication."

sparser
"However, we also found that co-expression of increasing amounts of USP15-HA and USP15-Myc further enhanced the IFN-β promoter activation stimulated by RIG-I-N and TRIM25 as a function of the dose, in line with the result described by Pauli (Supplementary Fig. S5)."

sparser
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-β (Supplementary Fig. S5)."

sparser
"Ectopically expressed Myc-USP15 was readily detected in Flag-TET2 immune complex ( xref )."
| PMC

sparser
"Scale bar, 10 μm. (D) Quantification of the percentage of Parkin-positive cells (in the conditions transfected with Parkin and EV) or Parkin- and Myc-positive cells (in the conditions transfected with Parkin and USP15-Myc) in which Parkin colocalized with mitochondria (n = 3). (E) HEK293 cells were transfected with EV or Myc-tagged USP15 and treated with DMSO or CCCP (10 µm) for 3 h."

sparser
"Scale bar, 10 mm. (D) Quantification of the percentage of Parkin-positive cells (in the conditions transfected with Parkin and EV) or Parkin-and Myc-positive cells (in the conditions transfected with Parkin and USP15-Myc) in which Parkin colocalized with mitochondria (n ¼ 3). (E) HEK293 cells were transfected with EV or Myctagged USP15 and treated with DMSO or CCCP (10 mM) for 3 h."
MYC decreases the amount of USP15.
5 |
MYC decreases the amount of USP15. 5 / 5
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
BRAP affects USP15
3 1 | 7
BRAP binds USP15.
3 | 4
3 | 1

sparser
"Hayes et al. showed that the interaction of USP15 and IMP is mediated through DUSP-UBL domain of USP15 and coiled coil region of IMP."

No evidence text available

No evidence text available

No evidence text available
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
BRAP ubiquitinates USP15.
1 | 3
BRAP ubiquitinates USP15. 4 / 4
1 | 3

sparser
"We have been able to show that USP4 and USP15 can oppose this BRAP ubiquitylation and that BRAP can promote ubiquitylation of catalytically inactive USP15."

sparser
"In turn, BRAP can ubiquitylate USP15, which is opposed by its intrinsic catalytic activity."

sparser
"USP15 as well as USP4 oppose the autoubiquitylation of BRAP, whereas BRAP promotes the ubiquitylation of USP15."
USP15 affects TIFAB
| 13
| 13

sparser
"Their studies indicate that deregulation of the TIFAB-USP15 complex, as observed in del(5q) myelodysplasia or MLL-rearranged leukemia, modulates p53 activity and has critical functional consequences for stressed and malignant hematopoietic cells."

sparser
"TIFAB binds to the catalytic domain of USP15 resulting in improved activities such as deubiquitination of MDM2 (a Ub E3 ligase of p53) [ xref ]."

sparser
"TIFAB forms a complex with USP15, increasing the rate of USP15 deubiquitination and regulating p53 signaling in malignant hematopoietic cells [ xref ]."

sparser
"Since TIFAB regulates USP15 DUB activity and substrates implicated in p53 activation, we hypothesized that deregulation of the TIFAB-USP15 complex, such as by genetic deletion of TIFAB, would sensitize hematopoietic cells to a variety of cellular stressors."

sparser
"TIFAB Binds the Catalytic Domain of USP15 and Increases Its Rate of Deubiquitination."

sparser
"Since we observed that TIFAB binds the catalytic domain of USP15 and the binding of TIFAB to USP15 is affected by the deubiquitinase activity of USP15, we next sought to determine whether TIFAB binding affects USP15 deubiquitinating activity."

sparser
"TIFAB binds USP15 mutants that harbor residues 1–583 and 470–981 ( xref )."

sparser
"Our data revealed that TIFAB binds USP15 and may impact cellular stress responses related to p53-dependent signaling pathways."

sparser
"Our data suggest that the TIFAB-USP15 complex is important for maintaining leukemic progenitor function."

sparser
"Given that the TIFAB-USP15 axis suppresses p53-mediated stress in hematopoietic cells, we sought to determine whether this pathway was relevant in AML."
USP15 affects SHC1
1 | 12
1 | 12

sparser
"The interaction between USP15 and p66Shc may be attributed to the deubiquination of p66Shc by USP15."

sparser
"Thus, USP15 interacts with p66Shc and stabilizes p66Shc expression via its deubiquitinating activity."

No evidence text available

sparser
"USP15 interacts with p66Shc."

sparser
"We found that USP15 interacts with p66Shc in the SH2 domain that has been shown to be critical for protein-protein interactions [ xref ]."

sparser
"Using tandem affinity purification/mass spectrometry (TAP/MS) and co-immunoprecipitation (Co-IP)/MS, we identified the interaction between USP15 and p66Shc."

sparser
"Specifically, USP15 interacted with the SH2 domain of p66Shc and maintained its stabilization by removing ubiquitin."

sparser
"As shown in Fig. xref , USP15 and p66Shc efficiently interacted with each other."

sparser
"Thus, the interaction between USP15 and p66Shc mainly depends on the deubiquitylating activity of USP15."

sparser
"This study aimed to investigate the molecular mechanism of p66Shc in liver I/R and characterize the interaction between USP15 and p66Shc."
USP15 affects EIF4A1
| 1 7 5
USP15 binds EIF4A1.
| 3 5
| 2 5

sparser
"Together, these results suggest that the USP15-EIF4A1 axis is a key mediator of the reepithelialization process."

sparser
"Since USP15 could interact with EIF4A1, we then investigated whether EIF4A1 expression could be regulated by USP15."

sparser
"USP15 Interacted With EIF4A1."

reach
"In prior studies, USP15 was shown to interact with EIF4A1 and to thereby accelerate wound healing [XREF_BIBR]."

reach
"Conclusively, the USP15 and EIF4A1 complex significantly accelerated re-epithelialization in wound healing."

sparser
"Conclusively, the USP15-EIF4A1 complex significantly accelerated re-epithelialization in wound healing."

sparser
"In addition, a western blot assay proved that the USP15 protein could be pulled down in the anti-EIF4A1 group, which indicated a direct interaction between EIF4A1 and USP15 ( xref )."
| 1

reach
"Moreover, we revealed for the first time that USP15 could interact with eukaryotic initiation factor 4A-1 (EIF4A1), thereby promoting translational efficacy in keratinocytes, which is essential for keratinocyte proliferation and migration."
USP15 deubiquitinates EIF4A1.
| 1 3
USP15 leads to the deubiquitination of EIF4A1. 4 / 4
| 1 3

reach
"Together, these data suggested that USP15 can enhance the migration and proliferation of HaCaT cells by promoting EIF4A1 deubiquitination."

reach
"USP15 Enhances HaCaT Cell Functionality by Promoting EIF4A1 Deubiquitination."

reach
"At a mechanistic level, USP15 enhanced the functional properties of HaCaT cells by promoting EIF4A1 deubiquitination."

trips
"USP15 Enhances Re-epithelialization Through Deubiquitinating EIF4A1 During Cutaneous Wound Repair."
USP15 increases the amount of EIF4A1.
| 1
USP15 increases the amount of EIF4A1. 1 / 1
| 1

reach
"Consistent with such a model, we found that USP15 knockdown was sufficient to reduce EIF4A1 expression, while EIF4A1 knockdown directly impaired HaCaT cell migration and proliferation."
USP15 affects CARD9
1 | 1 2 9
USP15 binds CARD9.
1 | 1 9
1 | 1 9

sparser
"More broadly, compounds that modulate the strength of CARD9-USP15 interactions may also represent an avenue for the specific regulation of this signaling pathway in fungal infections and inflammatory or autoimmune syndromes."

sparser
"Here, we identify the deubiquitinase USP15 as a novel regulator of CARD9, demonstrating that USP15 constitutively associates with CARD9 and removes TRIM62-deposited ubiquitin marks."

reach
"In this study, we identify the deubiquitinase USP15 as a novel regulator of CARD9, demonstrating that USP15 constitutively associates with CARD9 and removes TRIM62 deposited ubiquitin marks."

sparser
"This result supports that CARD9 interacts with USP15 and suggests that the N-terminus of CARD9 harbors the USP15 interaction domain."

No evidence text available

sparser
"To validate the interaction between USP15 and CARD9, we overexpressed Flag-StrepII-tagged full length CARD9 as well as N-terminal and C-terminal fragments together with USP15 in HEK293T cells ( xref )."

sparser
"We next tested whether USP15 binds to CARD9 endogenously in primary murine BMDCs."

sparser
"We immunoprecipitated endogenous USP15 with endogenous CARD9, demonstrating that the USP15-CARD9 interaction occurs under physiological conditions."

sparser
"The negative regulation demonstrated in this study mediated by the USP15-CARD9 association could occur at multiple levels – deactivation of CARD9 after ubiquitination and modulation of CARD9-mediated signaling intensity, duration, or both – with the dynamic balance between TRIM62 and USP15 enzymatic activities likely critical in controlling the overall output of this pathway."

sparser
"Importantly, we observed that USP15 binds to CARD9 in BMDCs in the absence of stimulation and that this interaction is largely unaffected by Dectin-1 ligand binding, indicating that USP15 constitutively interacts with CARD9 and may act to prevent aberrant CARD9 signaling at steady state."
USP15 deubiquitinates CARD9.
| 1 1
USP15 deubiquitinates CARD9. 2 / 2
| 1 1

reach
"USP15 Deubiquitinates CARD9 to Downregulate C-Type Lectin Receptor Mediated Signaling."

trips
"USP15 Deubiquitinates CARD9 to Downregulate C-Type Lectin Receptor-Mediated Signaling."
TIFAB affects USP15
| 13
| 13

sparser
"Their studies indicate that deregulation of the TIFAB-USP15 complex, as observed in del(5q) myelodysplasia or MLL-rearranged leukemia, modulates p53 activity and has critical functional consequences for stressed and malignant hematopoietic cells."

sparser
"TIFAB binds to the catalytic domain of USP15 resulting in improved activities such as deubiquitination of MDM2 (a Ub E3 ligase of p53) [ xref ]."

sparser
"TIFAB forms a complex with USP15, increasing the rate of USP15 deubiquitination and regulating p53 signaling in malignant hematopoietic cells [ xref ]."

sparser
"Since TIFAB regulates USP15 DUB activity and substrates implicated in p53 activation, we hypothesized that deregulation of the TIFAB-USP15 complex, such as by genetic deletion of TIFAB, would sensitize hematopoietic cells to a variety of cellular stressors."

sparser
"TIFAB Binds the Catalytic Domain of USP15 and Increases Its Rate of Deubiquitination."

sparser
"Since we observed that TIFAB binds the catalytic domain of USP15 and the binding of TIFAB to USP15 is affected by the deubiquitinase activity of USP15, we next sought to determine whether TIFAB binding affects USP15 deubiquitinating activity."

sparser
"TIFAB binds USP15 mutants that harbor residues 1–583 and 470–981 ( xref )."

sparser
"Our data revealed that TIFAB binds USP15 and may impact cellular stress responses related to p53-dependent signaling pathways."

sparser
"Our data suggest that the TIFAB-USP15 complex is important for maintaining leukemic progenitor function."

sparser
"Given that the TIFAB-USP15 axis suppresses p53-mediated stress in hematopoietic cells, we sought to determine whether this pathway was relevant in AML."
SHC1 affects USP15
1 | 12
1 | 12

sparser
"The interaction between USP15 and p66Shc may be attributed to the deubiquination of p66Shc by USP15."

sparser
"Thus, USP15 interacts with p66Shc and stabilizes p66Shc expression via its deubiquitinating activity."

No evidence text available

sparser
"USP15 interacts with p66Shc."

sparser
"We found that USP15 interacts with p66Shc in the SH2 domain that has been shown to be critical for protein-protein interactions [ xref ]."

sparser
"Using tandem affinity purification/mass spectrometry (TAP/MS) and co-immunoprecipitation (Co-IP)/MS, we identified the interaction between USP15 and p66Shc."

sparser
"Specifically, USP15 interacted with the SH2 domain of p66Shc and maintained its stabilization by removing ubiquitin."

sparser
"As shown in Fig. xref , USP15 and p66Shc efficiently interacted with each other."

sparser
"Thus, the interaction between USP15 and p66Shc mainly depends on the deubiquitylating activity of USP15."

sparser
"This study aimed to investigate the molecular mechanism of p66Shc in liver I/R and characterize the interaction between USP15 and p66Shc."
BMPR1A affects USP15
3 | 5 2
3 | 5 2

No evidence text available

reach
"The strong interaction between USP15 and ALK3 and their co-localization at the plasma membrane suggested that USP15 could act as a DUB for ALK3."

reach
"We show that USP15 interacts with SMAD6 and ALK3 and enhances BMP signalling by deubiquitylating ALK3 and rescuing it from proteasomal destruction."

reach
"Next, we tested how SMAD6 affected the interaction between GFP-USP15 and FLAG-ALK3 (XREF_FIG b)."

sparser
"The strong interaction between USP15 and ALK3 and their co-localization at the plasma membrane suggested that USP15 could act as a DUB for ALK3."

No evidence text available

sparser
"SMAD6 overexpression disrupts the association of USP15 with ALK3 and potently inhibits BMP signalling."

reach
"It was shown that USP15 interacts with type I BMP receptors, including ALK3, co-localises with ALK3 at the membrane and deubiquitylates ALK3, thereby countering the inhibition of the BMP pathway caused by SMAD6 XREF_BIBR."

No evidence text available

reach
"Here, we demonstrate that USP15 interacts with and deubiquitylates the type I BMP receptor ALK3."
USP15 affects SMAD6
3 | 4 2
3 | 4 2

No evidence text available

reach
"We show that USP15 interacts with SMAD6 and ALK3 and enhances BMP signalling by deubiquitylating ALK3 and rescuing it from proteasomal destruction."

reach
"FLAG-SMAD6, but none of the other FLAG-SMADs, was detected in USP15 IPs (XREF_FIG d), indicating the selective nature of the interaction between SMAD6 and USP15."

No evidence text available

sparser
"The selective nature of the interaction between USP15 and SMAD6 prompted us to investigate a possible role for USP15 in BMP signalling."

reach
"Interestingly, the interaction between GFP-USP15 and HA-SMAD6 was completely abolished by FLAG-ALK3 overexpression (XREF_FIG b), suggesting that USP15 : SMAD6 and USP15 : ALK3 interactions could be mutually exclusive."

reach
"The selective nature of the interaction between USP15 and SMAD6 prompted us to investigate a possible role for USP15 in BMP signalling."

sparser
"FLAG-SMAD6, but none of the other FLAG-SMADs, was detected in USP15 IPs ( xref d ), indicating the selective nature of the interaction between SMAD6 and USP15."

No evidence text available
USP15 affects RELA
| 12
USP15 increases the amount of RELA.
| 8
USP15 increases the amount of RELA. 4 / 4
| 4

reach
"USP15 promoted NF-kappaBp65 expression through inhibiting ubiquitination."

reach
"Moreover, in vivo experiments indicated that USP15 silencing inhibited MM tumor growth and NF-kappaBp65 expression."

reach
"These results suggest that USP15 promotes NF-kappaBp65 expression through deubiquitination."

reach
"USP15 silencing induced MM cell proliferation inhibition, apoptosis, and the expression of nuclear and cytoplasmic NF-kappaBp65, while USP15 overexpression exhibited an inverse effect."
Modified USP15 increases the amount of RELA. 4 / 4
| 4

reach
"PDTC treatment significantly inhibited USP15 overexpression induced cell proliferation, apoptosis inhibition, and NF-kappaBp65 expression."

reach
"USP15 overexpression promoted NF-kappaBp65 expression through inhibition of its ubiquitination, whereas NF-kappaBp65 promoted USP15 expression as a positive regulator."

reach
"NF-kappaBp65 positively regulated USP15 expression, whereas USP15 overexpression promoted NF-kappaBp65 expression through deubiquitination of NF-kappaBp65 in MM cells."

reach
"USP15 overexpression promotes the expression of Bcl-2, Bcl-xL, Survivin, and NF-kappaBp65."
USP15 dephosphorylates RELA.
| 3
USP15 leads to the dephosphorylation of RELA. 3 / 3
| 3

reach
"(g) Effects of USP15 knockdown on SEV-induced phosphorylation of NF-κB subunit p65 and IRF3."

reach
"To further confirm the results, SEV-induced phosphorylation of NF-κB subunit p65 and IRF3 were enhanced by the knockdown of USP15 (Fig. 1g)."

reach
"To further confirm the results, SEV induced phosphorylation of NF-kappaB subunit p65 and IRF3 were enhanced by the knockdown of USP15 (XREF_FIG)."
USP15 deubiquitinates RELA.
| 1
Modified USP15 leads to the deubiquitination of RELA. 1 / 1
| 1

reach
"Additionally, USP15 overexpression significantly inhibited the ubiquitination of NF-kappaBp65."
USP15 affects NFKBIA
1 | 8 2
USP15 deubiquitinates NFKBIA.
1 | 6
USP15 deubiquitinates NFKBIA. 7 / 7
1 | 6

reach
"CSN associated USP15 can deubiquitinate IkappaBalpha after TNFalpha mediated stimulation of the NF-kappaB pathway XREF_BIBR."

reach
"In this report, it was postulated that a CSN associated deubiquitinylase (USP15) causes a deubiquitination of IkappaBalpha representing a negative feedback mechanism of IkappaBalpha degradation and NF-kappaB activation."

reach
"Schweitzer et al. reported that COP9 signalosome (CSN)-associated USP15 can deubiquitinate IkappaBalpha and regulates the activation of NF-kappaB XREF_BIBR."

reach
"Another report reveals that USP15 deubiquitinates IkappaBalpha and increases its re-accumulation, leading to reduced NF-kappaB activity [XREF_BIBR]."

No evidence text available

reach
"The Cylindroma tumour suppressor protein (CYLD) de-ubiquitinates NEMO and TRAF2 [XREF_BIBR - XREF_BIBR], while USP15 reverses betaTRCP mediated ubiquitination of IkappaBalpha [XREF_BIBR]."

reach
"USP15 deubiquitinates IkappaBalpha and promotes its re-accumulation after TNF-alpha-induced degradation, leading to reduced NF-kappaB activity."
USP15 binds NFKBIA.
| 2
| 2

sparser
"However, Sun et al. found no interaction between USP15 and IκBα, and proposed that USP11 inhibits the ubiquitination and degradation of IκBα in the early stage, whereas USP15 functions at a later time point in the TNFα-induced NF-κB activation50."

sparser
"In contrary, another study found no interaction between USP15 and IκBα, and it was proposed that USP11 inhibits the ubiquitination and degradation of IκBα in the early stage while USP15 functions at a later time point in the TNFα-induced NF-κB activation xref ."
USP15 activates NFKBIA.
| 2
USP15 activates NFKBIA. 2 / 2
| 2

reach
"Interestingly, knockdown of both USP15 and USP11 expression leads to an increased basal protein level of IkappaBalpha, suggesting that USP11 and USP15 cooperatively modulate IkappaBalpha turnover."

reach
"An in vitro ubiquitination assay revealed that IkappaBalpha ubiquitination was markedly inhibited by overexpression of CHMP5 or USP15 (XREF_FIG), which is accompanied with pulse-chase labeling experiments showing that IkappaBalpha stability was increased by overexpression of CHMP5 or USP15 (XREF_FIG)."
CGAS affects USP15
| 11
USP15 binds cGAS. 10 / 11
| 11

sparser
"To identify the domains that are essential in the cGASUSP15 interaction."

sparser
"USP15 interacts with cGAS."

sparser
"To confirm a direct interaction between cGAS and USP15, we performed GST pull-down experiments using recombinant GST-tagged cGAS and USP15 ( xref )."

sparser
"We found that the two DUB domains and the linker region were necessary for USP15 interaction with cGAS (Figure xref , xref )."

sparser
"Consistently, GST-tagged USP15 (521–981) pulled down recombinant cGAS (Figure xref ), indicating a direct interaction between USP15 and cGAS."

sparser
"We also conducted a GST pull-down assay and found that deletion of the IDR completely abolished the interaction between cGAS and USP15, indicating that the IDR of USP15 was important for its direct binding with cGAS ( xref )."

sparser
"To confirm that USP15 interacts with cGAS, we overexpressed Flag-epitope tagged USP15 and Myc epitope-tagged cGAS and performed co-IP experiments."

sparser
"Although the direct interaction between cGAS and USP15 was abolished in the GST pull-down assay, their interaction remained to some extent after the IDR of USP15 was deleted in the co-IP assay, indicating the indirect interaction between cGAS and USP15 in cells, which might be responsible for the process of cGAS deubiquitylation by USP15 ( xref )."

sparser
"In the resting state, USP15 interacts with cGAS, promoting its dimerization and phase separation through multivalent interactions."

sparser
"Consistently, the interaction between cGAS and USP15 became weaker after the IDR of USP15 was deleted ( xref )."
USP15 affects Ubiquitin
| 9
USP15 inhibits Ubiquitin.
| 6
| 6

reach
"The OMM localized DUB ubiquitin specific processing proteases USP30 and USP15 antagonize PARKIN activity by cleaving ubiquitin chains on mitochondria."

reach
"Conversely, the deubiquitinase USP15 antagonizes LUBAC by removing K48linked ubiquitin from TRIM25, leading to its stabilization and thereby promoting RIG-I-mediated antiviral signaling (67) ."

reach
"73 USP15 inhibits the NF‐κB pathway by removing K48‐Ub from IκBα and consequently prevent degradation it."

reach
"Overexpression of USP15 reduced ubiquitin accumulation on mitochondria, while depletion rescued mitophagy defects in PD patient derived fibroblasts."

reach
"In accordance, the de-ubiquitination assay in LN-229 cells that were transfected with siUSP15, showed that knockdown of endogenous USP15 increased the incorporation of ubiquitin into HECTD1, as compared to the siRNA control cells."

reach
"In resting T cells, MDM2 was stable even in the absence of USP15; however, the TCR+CD 28 signals stimulated ubiquitin dependent degradation of MDM2, which was negatively regulated by USP15."
USP15 activates Ubiquitin.
| 3
| 3

reach
"We previously revealed that USP15 promotes Th17 differentiation through removing a ubiquitin chain conjugated to Lys446 of RORγt which prevents the recruitment of SRC1 ."

reach
"Depletion of USP15 with two independent siRNA oligos does not interfere with this basic ubiquitylation ladder but promotes the appearance of an additional higher molecular weight ubiquitin smear above the 116-kDa marker that is indicative of the accumulation of distinct polyubiquitylated species of BRAP in the absence of USP15."

reach
"These results suggest that USP15 prevents the ubiquitin dependent degradation of MDM2 in activated T cells."
USP15 affects TGFBR
| 9
USP15 deubiquitinates TGFBR.
| 4
USP15 deubiquitinates TGFBR. 4 / 4
| 4

reach
"For example, they are involved in the TGF-beta signaling pathway; USP15 deubiquitinates and stabilizes TGF-beta receptor I or receptor activated SMADs, while USP4 regulates the signaling pathway of TGF-beta receptor I and is associated with a poor prognosis in breast cancer."

reach
"USP15 can deubiquitinate type I TGF-β receptor (TβR-I) and enhance TGF-β activity; and over-expression of USP15 is closely related to TGF-β activation as well as a poor prognosis for glioblastoma patients."

reach
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-beta receptor (TbetaR-I), leading to an enhanced TGF-beta signal."

reach
"USP15 in this trimeric complex deubiquitinates and stabilizes type 1 TGF-beta receptor, upregulating the TGF-beta signaling and providing a critically pathogenic factor for glioblastoma."
USP15 activates TGFBR.
| 2
USP15 activates TGFBR. 2 / 4
| 2

reach
"USP15 is known to promote stabilization of the TGF-beta receptor and its downstream signal transducers, known as receptor activated SMADS (R-SMADS), thus empowering the TGF-beta signaling [XREF_BIBR, XREF_BIBR]."

reach
"Both USP15 and USP4 stimulate TGF-beta signaling by deubiquitylating and stabilizing two key signaling molecules in this pathway, TGF-beta receptor I (TbetaRI) and R-SMADs, suggesting that these two closely related DUBs act in concert to modulate central signaling processes that are involved in oncogenesis and innate immunity."
USP15 binds TGFBR.
| 3
| 3

reach
"USP15 binds to the SMAD7-SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

reach
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-beta receptor (TbetaR-I), leading to an enhanced TGF-beta signal."

reach
"Furthermore, co-immunoprecipitation (Co-IP) demonstrated that USP15 could interact with TGF-beta receptor I (TBR1) and promote its deubiquitination, thereby maintaining TGF-beta signalling pathway activity by enhancing TBR1 stability."
MDM2 affects USP15
1 | 3 5
1 | 3 3

reach
"First, USP15 interacts with MDM2, inhibits ubiquitination, and stabilizes MDM2, an important E3 ligase that mediates the ubiquitination and proteolysis of NFATc2 members of the NFAT family and negatively regulates TCR signals."

reach
"When co-expressed in HEK293 cells, USP15 interacted with MDM2, as detected by co-IP assays (XREF_FIG)."

sparser
"When co-expressed in HEK293 cells, USP15 interacted with MDM2, as detected by co-IP assays ( xref )."

sparser
"USP15 physically interacts with MDM2 and inhibits the ubiquitination and degradation of MDM2."

No evidence text available

reach
"These results suggest that USP15 physically interacts with MDM2 in a p53 independent manner."

sparser
"First, USP15 interacts with MDM2, inhibits ubiquitination, and stabilizes MDM2, an important E3 ligase that mediates the ubiquitination and proteolysis of NFATc2 members of the NFAT family and negatively regulates TCR signals."
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
FHL1 affects USP15
2 | 3 6
2 | 3 6

sparser
"We have shown that USP15 interacts physically and functionally with SLIM1, and stabilizes SLIM1 by deubiquitination in the transient expression system in HEK293T cells."

reach
"Thus, the protein levels of SLIM1 are regulated by the Ub-proteasomal system, and USP15 interacts physically and functionally with SLIM1 in mammalian cells.The above results suggest that USP15 may hav[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"As shown in Fig. 1 B, purified recombinant USP15 and SLIM1 were also bound to each other under cell-free conditions, indicating that the interaction is direct."

sparser
"In an effort to find novel protein–protein interactions by computational prediction (to be reported elsewhere) and its biochemical confirmation, we have identified a novel interaction of USP15 with SL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"We have shown that USP15 interacts physically and functionally with SLIM1, and stabilizes SLIM1 by deubiquitination in the transient expression system in HEK293T cells."

sparser
"In the present study, we have shown that USP15 interacts with SLIM1 and deubiquitinates SLIM1, leading to the stabilization of SLIM1."

sparser
"Furthermore, USP15C269S, a catalytic-inactive USP15 mutant [16] was unable to bind with SLIM1, suggesting that the region around C269, the core enzymatic domain, was critical for the interaction."

No evidence text available

sparser
"Thus, the protein levels of SLIM1 are regulated by the Ub-proteasomal system, and USP15 interacts physically and functionally with SLIM1 in mammalian cells."

reach
"In the present study, we have shown that USP15 interacts with SLIM1 and deubiquitinates SLIM1, leading to the stabilization of SLIM1."
CARD9 affects USP15
1 | 1 9
1 | 1 9

sparser
"More broadly, compounds that modulate the strength of CARD9-USP15 interactions may also represent an avenue for the specific regulation of this signaling pathway in fungal infections and inflammatory or autoimmune syndromes."

sparser
"Here, we identify the deubiquitinase USP15 as a novel regulator of CARD9, demonstrating that USP15 constitutively associates with CARD9 and removes TRIM62-deposited ubiquitin marks."

reach
"In this study, we identify the deubiquitinase USP15 as a novel regulator of CARD9, demonstrating that USP15 constitutively associates with CARD9 and removes TRIM62 deposited ubiquitin marks."

sparser
"This result supports that CARD9 interacts with USP15 and suggests that the N-terminus of CARD9 harbors the USP15 interaction domain."

No evidence text available

sparser
"To validate the interaction between USP15 and CARD9, we overexpressed Flag-StrepII-tagged full length CARD9 as well as N-terminal and C-terminal fragments together with USP15 in HEK293T cells ( xref )."

sparser
"We next tested whether USP15 binds to CARD9 endogenously in primary murine BMDCs."

sparser
"We immunoprecipitated endogenous USP15 with endogenous CARD9, demonstrating that the USP15-CARD9 interaction occurs under physiological conditions."

sparser
"The negative regulation demonstrated in this study mediated by the USP15-CARD9 association could occur at multiple levels – deactivation of CARD9 after ubiquitination and modulation of CARD9-mediated signaling intensity, duration, or both – with the dynamic balance between TRIM62 and USP15 enzymatic activities likely critical in controlling the overall output of this pathway."

sparser
"Importantly, we observed that USP15 binds to CARD9 in BMDCs in the absence of stimulation and that this interaction is largely unaffected by Dectin-1 ligand binding, indicating that USP15 constitutively interacts with CARD9 and may act to prevent aberrant CARD9 signaling at steady state."
| 1 4 5
Mitoxantrone inhibits USP15.
| 1 2 5
| 1 2 5

sparser
"We determined that USP15 is weakly inhibited by mitoxantrone with an IC 50 value of 33 ± 11 μ m ( xref A and)."

reach
"XREF_BIBR - XREF_BIBR Recently, an anticancer chemotherapy drug, mitoxantrone, has been shown to inhibit USP15, but the potency of USP15 inhibition by this compound is low, and in vivo studies have not been performed."

reach
"Moreover, we report that USP15 is weakly inhibited by the antineoplastic agent mitoxantrone in vitro A USP15 and mitoxantrone complex structure disclosed that the anthracenedione interacts with the S1 ' binding site."

eidos
"In addition , it was found that mitoxantrone weakly inhibits the activity of USP15 with an IC50 of 33 muM ."

sparser
"Moreover, we report that USP15 is weakly inhibited by the antineoplastic agent mitoxantrone in vitro ."

sparser
"Furthermore, we show that mitoxantrone weakly inhibits USP15 and determined a mitoxantroneUSP15 complex structure."

sparser
"Crystal structure analysis by Ward et al. highlighted minute differences between the paralogs and noted that mitoxantrone binds and partially inhibits USP15, similar to USP11."

sparser
"We subsequently tested whether USP15 is inhibited by mitoxantrone using a diubiquitin gel shift cleavage assay, as this agent has previously been shown to inhibit the homolog USP11 ( xref )."
| 2

reach
"Moreover, we report that USP15 is weakly inhibited by the antineoplastic agent mitoxantrone in vitro A USP15 and mitoxantrone complex structure disclosed that the anthracenedione interacts with the S1 ' binding site."

reach
"Crystal structure analysis by Ward et al. highlighted minute differences between the paralogs and noted that mitoxantrone binds and partially inhibits USP15, similar to USP11."
2 | 1 5
USP15 translocates.
| 1 5
USP15 translocates to the nucleus. 6 / 6
| 1 5

sparser
"Confocal microscopy analysis clearly demonstrates that the NLS is required for SART3 to relocate to the nucleus and both USP4 and USP15 are recruited to the nucleus in the presence of SART3."

sparser
"Treatment of cells with purvalanol A, a cyclin-dependent kinase (CDK) inhibitor, results in nuclear translocation of USP15."

reach
"Confocal microscopy analysis clearly demonstrates that the NLS is required for SART3 to relocate to the nucleus and both USP4 and USP15 are recruited to the nucleus in the presence of SART3."

sparser
"Consistent with our recent study ( xref ) co-expression of SART3 with USP15 led to the nuclear translocation of USP15, which suggests that SART3 has a significant effect on USP15 localization."

sparser
"Furthermore, the overexpression of Nrf1 markedly promotes the nuclear translocation of USP15 ( Fig. 2 A), similar to the case of the nuclear protein Tip110 [24] ."

sparser
"Additionally, the quantitative analysis clearly showed that the translocation of USP15 into the nucleus is dependent on SART3 (Figure xref , right graph)."
USP15 binds.
2 |
2 |

No evidence text available

No evidence text available
USP15 affects TET2
| 3 7
USP15 binds TET2.
| 6
| 6

sparser
"Collectively, these data demonstrate that USP15 and TET2 physically interact with each other, and the CD domain of TET2 is responsible for their association."
| PMC

sparser
"USP15 binds to TET2."
| PMC

sparser
"To determine the functional significance of USP15-TET2 interaction, we first performed a dot blot experiment to determine 5hmC levels in cells ectopically expressing USP15."
| PMC

sparser
"Using antibodies that recognize TET2 or USP15, we detected endogenous interaction between USP15 and TET2 by reciprocal IP-Western assay in both human U2OS cells and mouse B16–ovalbumin (OVA) cells ( xref )."
| PMC

sparser
"First, USP15 directly interacts with TET2 ( xref ) and catalyzes the TET2 deubiquitylation."
| PMC

sparser
"To confirm the interaction of TET2 with USP15, we examined the binding of their association in cells when both proteins were ectopically expressed by IP–Western blot analysis."
| PMC
USP15 inhibits TET2.
| 3 1
USP15 inhibits TET2. 4 / 4
| 3 1

sparser
"USP15 inactivates TET2 and inhibits TET2 binding to substrate DNA."
| PMC

reach
"Deletion of Usp15 in melanoma stimulates chemokine expression and TILs in a TET2 dependent manner, leading to increased response to immunotherapy and extended life span of tumor bearing mice."

reach
"USP15 catalyzes the removal of K1299 linked monoubiquitin and negatively regulates TET2 activity."

reach
"USP15 suppresses tumor immunity via deubiquitylation and inactivation of TET2."
USP15 affects IRF3
| 10
USP15 inhibits IRF3.
| 7
USP15 inhibits IRF3. 5 / 5
| 5

reach
"As shown in XREF_FIG e and XREF_FIG f, knockdown of USP15 increased the activation of NF-kappaB (5.9 vs 12.9, p = 1.92E-04) and IRF3 (15.6 vs 26.5, p = 1.04E-03) through reporter assays."

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."

reach
"As shown in Fig. 1e and 1f, knockdown of USP15 increased the activation of NF-κB (5.9 vs 12.9, p = 1.92E-04) and IRF3 (15.6 vs 26.5, p = 1.04E-03) through reporter assays."

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities (Supplementary Fig. S3)."

reach
"(c–e) USP15 inhibited SEV-induced activation of ISRE and the NF-κB and IRF3 promoters."
USP15-C269A inhibits IRF3. 2 / 2
| 2

reach
"The catalytic mutants USP15 C269A and -H862A, especially USP15-H862A, still dose-dependently inhibited the IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."

reach
"The catalytic mutants USP15-C269A and -H862A, especially USP15-H862A, still dose-dependently inhibited the IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities."
USP15 dephosphorylates IRF3.
| 3
USP15 leads to the dephosphorylation of IRF3. 3 / 3
| 3

reach
"To further confirm the results, SEV induced phosphorylation of NF-kappaB subunit p65 and IRF3 were enhanced by the knockdown of USP15 (XREF_FIG)."

reach
"To further confirm the results, SEV-induced phosphorylation of NF-κB subunit p65 and IRF3 were enhanced by the knockdown of USP15 (Fig. 1g)."

reach
"(g) Effects of USP15 knockdown on SEV-induced phosphorylation of NF-κB subunit p65 and IRF3."
USP15 affects BRAP
3 | 4
3 | 1

sparser
"Hayes et al. showed that the interaction of USP15 and IMP is mediated through DUSP-UBL domain of USP15 and coiled coil region of IMP."

No evidence text available

No evidence text available

No evidence text available
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
ATM affects USP15
1 | 4 5
ATM phosphorylates USP15. 6 / 6
| 3 3

sparser
"Here we found that ATM phosphorylates USP15 after DNA damage, affects USP15 recruitment to DNA damage sites, and BARD1–HP1γ interaction, and therefore regulates BARD1/BRCA1 retention at DNA damage sites."

reach
"Here we found that ATM phosphorylates USP15 after DNA damage, affects USP15 recruitment to DNA damage sites, and BARD1-HP1gamma interaction, and therefore regulates BARD1 and BRCA1 retention at DNA damage sites."

reach
"USP15 Ser678 is phosphorylated by ATM, which is essential for USP15 recruitment to DSBs."

sparser
"As shown in Fig.  xref , USP15 was phosphorylated at ataxia telangiectasia-mutated (ATM) consensus Ser-Gln/Thr-Gln (SQ/TQ) sites after IR."

sparser
"Thus, ATM-dependent USP15 phosphorylation has two effects: (1) affecting the sub-cellular localization of USP15, and (2) affecting the recruitment of USP15 to DSBs."

reach
"Finally, USP15 is phosphorylated by ATR and ATM and is known to cleave ubiquitin from IkappaB, thus dampening the NF-kappaB response (see below)."
ATM phosphorylates USP15 on S678. 4 / 4
1 | 1 2

sparser
"USP15 Ser678 is phosphorylated by ATM, which is essential for USP15 recruitment to DSBs."

sparser
"Previous large-scale proteomic studies also demonstrated that Ser678 of USP15 is phosphorylated by ATM following DNA damage xref ."

No evidence text available

reach
"Previous large-scale proteomic studies also demonstrated that Ser678 of USP15 is phosphorylated by ATM following DNA damage 61."
USP15 affects X
| 9
USP15 activates X.
| 6
USP15 activates X. 6 / 6
| 6

reach
"This implied that the association of USP15 with HBx not only increases the stability of HBx but also augments HBx mediated oncogenic signals."

reach
"USP15 enhances the transactivation activity of HBx."

reach
"USP15 attenuates HBx degradation through deubiquitination of HBx."

reach
"There results clearly indicate that USP15 attenuates the degradation of HBx."

reach
"We found that USP15 mediated deubiquitylation protects HBx from proteasomal degradation thus increasing the stability and level of HBx protein as well as its transactivation activity."

reach
"Since we have shown that USP15 is essential for maintaining HBx stability and that USP15 augments HBx mediated oncogenic signals, one inference from our work is that compromising USP15 might be a novel approach to abrogate cellular transformation and serve as a target for anti-cancer therapy."
USP15 increases the amount of X.
| 2
Modified USP15 increases the amount of X. 1 / 1
| 1

reach
"As shown in XREF_FIG, USP15 overexpression significantly increased HBx protein levels in a dose dependent manner."
USP15 increases the amount of X. 1 / 1
| 1

reach
"As shown in XREF_FIG, despite the fact that USP15 dose-dependently increases HBx levels, it did not affect the expression levels of DDB1, a core component of E3 ubiquitin ligase complexes."
USP15 deubiquitinates X.
| 1
USP15 deubiquitinates X. 1 / 1
| 1

reach
"To confirm the deubiquitination of HBx by USP15, we performed an in vivo ubiquitination assay in which HBx was immunoprecipitated and detected by antibody against ubiquitin."
USP15 affects Proteasome
| 5
USP15 activates Proteasome.
| 2
| 2

reach
"Furthermore, we examined whether USP15 can activate the NRF1 induced endogenous proteasome activity."

reach
"Thus, we concluded that USP15 activates proteasome activity through regulating Nrf1 function.We next examined whether the knockdown of endogenous USP15 reduces the NRF1 mediated expression of the prot[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP15 increases the amount of Proteasome.
| 2
USP15 increases the amount of Proteasome. 2 / 3
| 2

reach
"We surmise that Nrf1 activating stresses facilitate the USP15 mediated deubiquitination rather than the beta-TrCP-mediated ubiquitination, thereby promoting the expression of Nrf1 target genes.The dat[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Consequently, USP15 siRNA activated the expression of proteasome genes, such as PSMC4 and PSMA4."
USP15 inhibits Proteasome.
| 1
| 1

reach
"Nevertheless, USP15 siRNA significantly reduced the induction of proteasome genes by the proteasome inhibitors."
USP15 affects MYC
| 9
| 9

sparser
"HEK293T cells were co-transfected with plasmid encoding HA–RIG-I, Flag-IPS-1, increasing amounts of wild-type MycUSP15 or its mutants."

sparser
"To determine the precise role of USP15 plays in mediating the IFN signaling pathway and figure out the factors that drive the main different results, we asked for the USP15-Myc and TRIM25-V5 plasmids from Dr."

sparser
"In contrast, poly(I:C)-induced inhibition of VSV replication was recovered by overexpression of both USP15-HA and USP15-Myc (Supplementary Fig. S5)."

sparser
"As shown in supplementary Fig. S5, neither USP15-HA nor USP15-Myc suppressed the replication of VSV, not in accordance with the result described in Pauli’s paper that USP15 limited the VSV replication."

sparser
"However, we also found that co-expression of increasing amounts of USP15-HA and USP15-Myc further enhanced the IFN-β promoter activation stimulated by RIG-I-N and TRIM25 as a function of the dose, in line with the result described by Pauli (Supplementary Fig. S5)."

sparser
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-β (Supplementary Fig. S5)."

sparser
"Ectopically expressed Myc-USP15 was readily detected in Flag-TET2 immune complex ( xref )."
| PMC

sparser
"Scale bar, 10 μm. (D) Quantification of the percentage of Parkin-positive cells (in the conditions transfected with Parkin and EV) or Parkin- and Myc-positive cells (in the conditions transfected with Parkin and USP15-Myc) in which Parkin colocalized with mitochondria (n = 3). (E) HEK293 cells were transfected with EV or Myc-tagged USP15 and treated with DMSO or CCCP (10 µm) for 3 h."

sparser
"Scale bar, 10 mm. (D) Quantification of the percentage of Parkin-positive cells (in the conditions transfected with Parkin and EV) or Parkin-and Myc-positive cells (in the conditions transfected with Parkin and USP15-Myc) in which Parkin colocalized with mitochondria (n ¼ 3). (E) HEK293 cells were transfected with EV or Myctagged USP15 and treated with DMSO or CCCP (10 mM) for 3 h."
USP15 affects MAPK1
| 2 7
| 2 7

sparser
"And USP15 can form a complex with ERK2 to regulate ubiquitination of ERK2."

reach
"Immunoprecipitation and deubiquitination assays were used to examine whether USP15 could bind to ERK2 and affect the deubiquitination of ERK2."

sparser
"Co-immunocoprecipitation assays in our current studies showed that USP15 could bind to ERK2."

sparser
"Since USP15 can interact with ERK2, we hypothesized that USP15 deubiquitinates ERK2."

sparser
"Indeed, endogenous USP15 can form a complex with endogenous ERK2 in rat articular chondrocytes (Fig. xref a and Supplementary Fig.  xref a, b)."

reach
"And USP15 can form a complex with ERK2 to regulate ubiquitination of ERK2."

sparser
"Immunoprecipitation and deubiquitination assays were used to examine whether USP15 could bind to ERK2 and affect the deubiquitination of ERK2."

sparser
"USP15 can form a complex with ERK2."

sparser
"These results indicated that although USP15 can bind to and deubiquitinate ERK2, USP15 was not resistant to degradation by the ERK2 ubiquitination hydrolase."
USP15 affects IFNG
| 9
USP15 activates IFNG.
| 8
USP15 activates IFNG. 8 / 8
| 8

reach
"These findings suggest that T cell intrinsic USP15 deficiency causes excessive production of IFN-gamma, which promotes an immunosuppressive tumor microenvironment, during MCA induced primary tumorigenesis."

reach
"Our present study revealed that in the MCA induced fibrosarcoma model, USP15 deficiency caused hyper-activation of IFN-gamma + T cells, which was associated with formation of a more immunosuppressive tumor microenvironment characterized by upregulated expression of PD-L1 and CXCL12 and enhanced recruitment of Treg cells and MDSCs."

reach
"To determine the source of the aberrantly higher level of serum IFN-gamma in Usp15 -/- mice, we examined whether the USP15 deficiency promoted IFN-gamma production in T cells or innate immune cells at the tumor site."

reach
"found that USP15 was abundantly expressed in immune cells, and the USP15 deficiency promoted the TCR + CD28 - stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma in naive CD4 + T cells."

reach
"However, since the development of primary tumors involves a long period of interplays between tumors and the immune system, it has remained unclear how the excessive and chronic production of IFN-gamma by USP15 deficient T cells impacts the development of primary tumors."

reach
"Moreover, excessive IFN-gamma production by USP15 deficient CD4 + T cells promoted the expression of CXCL12 leading to an accumulation of T-bet + Treg cells and CD11b + Gr-1 + MDSC, therefore promoting MCA induced tumorigenesis [XREF_BIBR]."

reach
"However, the USP15 deficiency promoted the TCR+CD 28 stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma (IFN-gamma), in naive CD4 + T cells, as assessed by quantitative real-time RT-PCR (qRT-PCR) (XREF_FIG), intracellular cytokine staining (XREF_FIG) and ELISA (XREF_FIG)."

reach
"T cell intrinsic USP15 deficiency promotes excessive IFN-gamma production and an immunosuppressive tumor microenvironment in MCA induced fibrosarcoma."
USP15 decreases the amount of IFNG.
| 1
Modified USP15 decreases the amount of IFNG. 1 / 1
| 1

reach
"The accumulation of T-bet + Treg cells in the tumor of Usp15 -/- mice was caused by loss of USP15 in T cells and apparently due to the aberrant expression of IFN-gamma."
USP15 affects CHMP5
| 5 4
| 5 3

sparser
"Accordingly, mutations in VCP/p97 that cause IBMPFD (R155H and A232E) disrupt both the physical and functional interaction with CHMP5 and USP15."

reach
"This also raises the possibility that VCP and p97 serves an important function to select the substrates targeted by the CHMP5 and USP15 complex for deubiquitination."

sparser
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP/p97 ( xref ), the physical interactions between CHMP5, USP15, and VCP/p97 were studied using cell-free immunoprecipitation analysis ( xref )."

sparser
"Intriguingly, CHMP5 interacts directly with both USP15 and VCP/p97, whereas there was no direct interaction between USP15 and VCP/p97."

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Collectively, these data suggest that the CHMP5 and USP15 complex suppresses RANK mediated NF-kappaB activation via IkappaBalpha stabilization in osteoclasts, in which mechanism it prevents proteasomal degradation of IkappaBalpha leading to the retention of NF-kappaB in an inactive cytosolic complex."

reach
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP and p97, and beta-Trcp in an osteoclast line and HEK293 cells, respectively (XREF_FIG and unpublished data)."

reach
"Intriguingly, CHMP5 interacts directly with both USP15 and VCP and p97, whereas there was no direct interaction between USP15 and VCP and p97."
| 1

sparser
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP/p97, and β-Trcp in an osteoclast line and HEK293 cells, respectively ( xref and unpublished data)."
SMURF2 affects SMAD7
| 9
| 9

sparser
"As shown in xref , mutated SMURF2 bound to both USP15 and SMAD7 to the same degree as wild type SMURF2."

sparser
"Initially, we tested if mutated SMURF2 could form complexes with both SMAD7 and USP15."

sparser
"On the contrary, when the level of TGF β in the body is too low, USP15 associates with smad7 and smurf2 to form a complex to deubiquitinate the type I TGF β receptor and further increase the expression level of the intracellular signaling of TGF β [ xref , xref ]."

sparser
"At the receptor level USP15 forms a complex with SMAD7 and SMURF2 with USP15 opposing the effects of the SMURF2 ligase on TβR stabilization ."

sparser
"USP15 binds to the Smad7SMURF2 complex, which recruits USP15 to TGFβ receptor I and stabilizes it without direct binding [ xref ]."

sparser
"USP15 forms a complex with SMAD7 and SMURF2 and opposes the SMURF2-mediated ubiquitination of TβRI when the level of active TGF-β is low [ xref ]."

sparser
"Using a functional genetic screen we have previously found that USP15 forms a complex with SMAD7 and SMURF2 and is recruited to the TGF-β receptor complex, where it deubiquitinates and stabilizes TβRI xref ."

sparser
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-β receptor (TβR-I), leading to an enhanced TGF-β signal."

sparser
"USP15 binds to the Smad7-Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-β type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-β signalling."
PRPF31 affects USP15
3 | 3 3
3 | 3 3

No evidence text available

reach
"We then confirmed the interaction between PRP31 and USP15 with immunoprecipitation."

sparser
"However, the DUSP-UBL domain of USP15 interacted with PRP31 in the presence of SART3 (Figure xref ) indicating that the interaction between PRP31 and USP15 was indirect but mediated by SART3."

No evidence text available

No evidence text available

sparser
"To examine whether PRP31 interacts directly with USP15, glutathione beads immobilized with a GST-tagged DUSP-UBL domain of USP15 was incubated with PRP31, which was synthesized with the in vitro transcription/translation (IVT/T) in the absence or presence of the SART3 HAT domains."

reach
"However, the DUSP-UBL domain of USP15 interacted with PRP31 in the presence of SART3 indicating that the interaction between PRP31 and USP15 was indirect but mediated by SART3."

reach
"To examine whether PRP31 interacts directly with USP15, glutathione beads immobilized with a GST tagged DUSP-UBL domain of USP15 was incubated with PRP31, which was synthesized with the in vitro transcription and translation (IVT/T) in the absence or presence of the SART3 HAT domains."

sparser
"We then confirmed the interaction between PRP31 and USP15 with immunoprecipitation (Figure xref )."
MAPK1 affects USP15
| 2 7
| 2 7

sparser
"And USP15 can form a complex with ERK2 to regulate ubiquitination of ERK2."

reach
"Immunoprecipitation and deubiquitination assays were used to examine whether USP15 could bind to ERK2 and affect the deubiquitination of ERK2."

sparser
"Co-immunocoprecipitation assays in our current studies showed that USP15 could bind to ERK2."

sparser
"Since USP15 can interact with ERK2, we hypothesized that USP15 deubiquitinates ERK2."

sparser
"Indeed, endogenous USP15 can form a complex with endogenous ERK2 in rat articular chondrocytes (Fig. xref a and Supplementary Fig.  xref a, b)."

reach
"And USP15 can form a complex with ERK2 to regulate ubiquitination of ERK2."

sparser
"Immunoprecipitation and deubiquitination assays were used to examine whether USP15 could bind to ERK2 and affect the deubiquitination of ERK2."

sparser
"USP15 can form a complex with ERK2."

sparser
"These results indicated that although USP15 can bind to and deubiquitinate ERK2, USP15 was not resistant to degradation by the ERK2 ubiquitination hydrolase."
CHMP5 affects USP15
| 5 4
| 5 3

sparser
"Accordingly, mutations in VCP/p97 that cause IBMPFD (R155H and A232E) disrupt both the physical and functional interaction with CHMP5 and USP15."

reach
"This also raises the possibility that VCP and p97 serves an important function to select the substrates targeted by the CHMP5 and USP15 complex for deubiquitination."

sparser
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP/p97 ( xref ), the physical interactions between CHMP5, USP15, and VCP/p97 were studied using cell-free immunoprecipitation analysis ( xref )."

sparser
"Intriguingly, CHMP5 interacts directly with both USP15 and VCP/p97, whereas there was no direct interaction between USP15 and VCP/p97."

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Collectively, these data suggest that the CHMP5 and USP15 complex suppresses RANK mediated NF-kappaB activation via IkappaBalpha stabilization in osteoclasts, in which mechanism it prevents proteasomal degradation of IkappaBalpha leading to the retention of NF-kappaB in an inactive cytosolic complex."

reach
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP and p97, and beta-Trcp in an osteoclast line and HEK293 cells, respectively (XREF_FIG and unpublished data)."

reach
"Intriguingly, CHMP5 interacts directly with both USP15 and VCP and p97, whereas there was no direct interaction between USP15 and VCP and p97."
| 1

sparser
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP/p97, and β-Trcp in an osteoclast line and HEK293 cells, respectively ( xref and unpublished data)."
C6orf89 affects USP15
| 6 3
C6orf89 ubiquitinates USP15.
| 3 3
C6orf89 ubiquitinates USP15. 6 / 6
| 3 3

sparser
"USP15 as well as USP4 oppose the autoubiquitylation of BRAP, whereas BRAP promotes the ubiquitylation of USP15."

reach
"We have been able to show that USP4 and USP15 can oppose this BRAP ubiquitylation and that BRAP can promote ubiquitylation of catalytically inactive USP15."

sparser
"We have been able to show that USP4 and USP15 can oppose this BRAP ubiquitylation and that BRAP can promote ubiquitylation of catalytically inactive USP15."

sparser
"In turn, BRAP can ubiquitylate USP15, which is opposed by its intrinsic catalytic activity."

reach
"In turn, BRAP can ubiquitylate USP15, which is opposed by its intrinsic catalytic activity."

reach
"USP15 as well as USP4 oppose the autoubiquitylation of BRAP, whereas BRAP promotes the ubiquitylation of USP15."
C6orf89 binds USP15.
| 3
| 3

reach
"Indeed, we were able to detect a constitutive interaction between endogenous USP15 and BRAP in (both stimulated and unstimulated) HEK293T cells (XREF_FIG B)."

reach
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15 : BRAP rather than USP4 : BRAP interaction may be of most relevance within a physiological setting."

reach
"In this study we show that CRAF expression levels are controlled by the BRAP binding partner USP15, which therefore acts as a positive regulator of MAPK signaling."
Csn affects USP15
| 8
| 8

sparser
"However, in human cells, the interaction of CSN with USP15 is mediated by diverse mechanisms, but the specific subunits or variants involved in this interaction are still unknown."

sparser
"In addition to direct deneddylation, and steric hindrance, the CSN can associate with the de-ubiquitylating enzyme USP15."

sparser
"The CSN is associated with USP15 protecting BTB3 protein against destabilization as shown in S. pombe ( xref )."

sparser
"Binding of USP15 to the CSN seems to be conserved."

sparser
"The stabilizing effect of CSN5 toward IκB-α in stimulated cells was explained both by CSN5-mediated deNEDDylation of cullins, controlling CRL activity, and the association of the CSN with the deubiquitinase USP15 [ xref , xref , xref , xref ]."

sparser
"The CSN supercomplex regulates the balance between β-catenin and APC: while it stimulates β-catenin degradation, USP15 associated with the CSN stabilizes APC."

sparser
"USP15 is bound to the CSN complex, and a recent study showed that the Cullin-RING ubiquitin ligase (CRL), as a CSN-binding partner, is associated with USP15 [34, 35]."
| PMC

sparser
"Moreover, the CSN is associated with the Ub-specific protease USP15, a de-ubiquitinating enzyme that protects proteins from auto-ubiquitination and degradation."
| 2 6
| 1 3

reach
"USP15 promotes the apoptosis of degenerative nucleus pulposus cells by suppressing the PI3K and AKT signalling pathway."

eidos
"However , when expressed alone , USP15 inhibited the IFN signaling pathway ."

reach
"USP15 may suppress tumorigenesis of HCC by regulating pathway clusters of signal transduction for gene expression, cell cycle, and DNA repair."

reach
"However, when expressed alone, USP15 inhibited the IFN signaling pathway."
| 1 3

reach
"USP15 modulates various signal transduction pathways, including the transforming growth factor-beta (TGF-beta), NF-kappaB, and Wnt-beta-catenin pathways; however, a role for USP15 in the IFN mediated antiviral innate immune response has not yet been described."

reach
"[180] In addition to preventing signaling proteins from degradation by removing K48 linked polyubiquitin chains, USP15 was shown to upregulate RLR signal transduction by indirectly attaching K63 linked polyubiquitin chains on RIG-I."

eidos
"] In addition to preventing signaling proteins from degradation by removing K48-linked polyubiquitin chains , USP15 was shown to upregulate RLR signal transduction by indirectly attaching K63-linked polyubiquitin chains on RIG-I ."

reach
"These observations shed light on the function and mechanisms of USP15 mediated modulation of the TGF-beta signalling pathway during wound healing, thus providing a novel potential target for the treatment of refractory wounds."
USP15 affects csn
| 8
| 8

sparser
"However, in human cells, the interaction of CSN with USP15 is mediated by diverse mechanisms, but the specific subunits or variants involved in this interaction are still unknown."

sparser
"In addition to direct deneddylation, and steric hindrance, the CSN can associate with the de-ubiquitylating enzyme USP15."

sparser
"The CSN is associated with USP15 protecting BTB3 protein against destabilization as shown in S. pombe ( xref )."

sparser
"Binding of USP15 to the CSN seems to be conserved."

sparser
"The stabilizing effect of CSN5 toward IκB-α in stimulated cells was explained both by CSN5-mediated deNEDDylation of cullins, controlling CRL activity, and the association of the CSN with the deubiquitinase USP15 [ xref , xref , xref , xref ]."

sparser
"The CSN supercomplex regulates the balance between β-catenin and APC: while it stimulates β-catenin degradation, USP15 associated with the CSN stabilizes APC."

sparser
"USP15 is bound to the CSN complex, and a recent study showed that the Cullin-RING ubiquitin ligase (CRL), as a CSN-binding partner, is associated with USP15 [34, 35]."
| PMC

sparser
"Moreover, the CSN is associated with the Ub-specific protease USP15, a de-ubiquitinating enzyme that protects proteins from auto-ubiquitination and degradation."

reach
"Furthermore, depleting endogenous USP15 enhanced mitophagy in HeLa cells, in a human dopaminergic neuronal cell line and in primary fibroblasts from human patients 150 ."

reach
"Knockdown of USP15 enhances mitophagy."

reach
"The C269A mutation abolished the inhibitory effect of USP15 on Parkin-mediated mitophagy, indicating that this effect of USP15 required its deubiquitinating activity ( Fig. 1; Supplementary Material, Fig. S2 )."

reach
"Interestingly, RNAi-mediated knockdown of USP15 in these fibroblasts strongly enhanced mitophagy, so that mitophagy already became demonstrable after 24 h exposure to CCCP or valinomycin (Fig. 2H–K)."

reach
"The C269A mutation abolished the inhibitory effect of USP15 on Parkin-mediated mitophagy, indicating that this effect of USP15 required its deubiquitinating activity (Fig. 1; Supplementary Data)."

reach
"What could be the mechanism for the inhibitory effect of USP15 on Parkin-mediated mitophagy?"

reach
"Furthermore, depleting endogenous USP15 enhanced mitophagy in HeLa cells, in a human dopaminergic neuronal cell line and in primary fibroblasts from human patients ."

reach
": Knockdown of USP15 enhances mitophagy in HeLa cells, SH-SY5Y cells and primary human fibroblasts."
USP15 affects UBC
8 |
8 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
USP15 affects SMAD
| 1 4
USP15 inhibits SMAD.
| 1
USP15 inhibits SMAD. 1 / 4
| 1

reach
"Consequently, silencing USP15 expression abolishes the recruitment of TGF-beta-activated Smad complexes to regulatory DNA sequences."
USP15 binds SMAD.
| 4
| 3

sparser
"Despite reports that USP15 interacts with SMADs 2 and 3 [ xref , xref ], we failed to detect USP15 interacting with any of the SMAD proteins (see the electronic supplementary material, figure S2)."

sparser
"A previous study has shown that USP15 interacts with receptor-phosphorylated SMAD proteins (R-SMADs) and deubiquitinates transforming growth factor-β (TGF-β) receptor 1 (TBR1), thereby promoting protein stability ( xref )."

sparser
"To detect interactions between USP15 and FLAG-tagged SMADs, endogenous USP15 was immunoprecipitated from HEK293 cell extracts transfected with either empty vector control or FLAG-tagged SMADs 1, 3, 4, 6 and 7 ( xref b )."

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
USP15 affects PRPF3
1 | 7
USP15 deubiquitinates PRPF3.
| 7
USP15 deubiquitinates PRPF3. 7 / 7
| 7

reach
"Moreover, we found that USP15 and USP4 deubiquitinated substrates PRP31 and PRP3 simultaneously."

reach
"Moreover, it was reported that Sart3, Usp4 and Usp15 form a complex in order to de-ubiquitinate Prp3 and Prp31 simultaneously."
| PMC

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

reach
"However, USP15 deubiquitinated PRP3 in the presence of E3 ligase."

reach
"PRP3 was deubiquitinated by USP15 in the presence of PRP19."

reach
"PRP3 was deubiquitinated by USP4 consistent with a previous report but not by USP15."

reach
"These findings suggest that USP15 deubiquitinates PRP3 as well as PRP31 when they are ubiquitinated by E3 ligase although USP15 may have more preference for PRP31."
USP15 binds PRPF3.
1 |
1 |

No evidence text available
USP15 affects NOP53
1 | 3 4
1 | 3 3

reach
"These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63 linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-beta induction."

sparser
"The result showed that USP15 can interact with GLTSCR2 upon viral infection ( xref )."

reach
"The result showed that USP15 can interact with GLTSCR2 upon viral infection (XREF_FIG)."

No evidence text available

sparser
"These results indicated that USP15 interacted with GLTSCR2, via binding to the range of residues 330–432 (G3)."

reach
"These results indicated that USP15 interacted with GLTSCR2, via binding to the range of residues 330-432 (G3)."

sparser
"The result showed that USP15 can interact with GLTSCR2 upon viral infection (Fig. 6a)."
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
| 8
USP15 activates Multiple Myeloma.
| 5

reach
"Silencing USP15 inhibited MM cell growth both in vitro and in vivo."

reach
"USP15 knockdown inhibits MM tumor growth and protein expression in vivo."

reach
"To investigate the role of NF-kappaBp65 signaling in USP15 mediated MM cell proliferation and apoptosis, the NF-kappaBp65 signaling inhibitor PDTC was added to MM cell cultures."

reach
"PDTC treatment inhibits USP15 overexpression induced MM cell proliferation and apoptosis inhibition."

reach
"USP15 overexpression promotes MM cell proliferation."
| 3

reach
"In conclusion, our results indicate that NF-kappaBp65 is involved in the regulation of USP15 in MM proliferation and apoptosis and that USP15 inhibits MM apoptosis through activating a feedback loop with NF-kappaBp65."

reach
"USP15 overexpression inhibits MM cell apoptosis."

reach
"USP15 inhibited MM cell apoptosis through activating a feedback loop with NF-kappaBp65."
USP15 affects KEAP1
1 1 | 3 3
USP15 deubiquitinates KEAP1.
1 | 3
USP15 deubiquitinates KEAP1. 4 / 4
1 | 3

reach
"USP15 deubiquitinates Keap1."

reach
"Here we report that the deubiquitinating enzyme, USP15, specifically deubiquitinates Keap1, which suppresses the Nrf2 pathway."

reach
"USP15 activates ubiquitin ligase activity by deubiquitinating Keap1 as its adaptor, promoting the proteasomal degradation of Nrf2."
USP15 binds KEAP1.
1 | 3
1 | 2

sparser
"These findings suggest that AML cells rely on broken redox sensing, instigated by USP15-KEAP1 repression of NRF2-mediated antioxidant programming."

No evidence text available

sparser
"COP1, along with numerous other ubiquitin ligases, is regulated by the COP9 signalosome; this protein complex is associated with the oxidative stress sensor Keap1 and the deubiquitinase USP15."

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
USP15 affects CD9
| 8
USP15 inhibits CD9. 8 / 8
| 8

reach
"These data establish that USP15 mediated p24 degradation is achieved via both endosomal and proteosomal degradation.These data collectively demonstrated that stability of Nef and USP15 is regulated re[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132 (XREF_FIG), indicating that the proteosomal degradation pathway plays a key role in USP15- mediated degradation of Gag protein."

reach
"Remarkably, the band intensity of p24 degraded by USP15 was visibly weaker, when the cells were treated with Bafilomycin A1."

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway plays a key role in[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These data establish that USP15 mediated p24 degradation is achieved via both endosomal and proteosomal degradation."

reach
"In corroboration, the observed degradation of p24 by USP15 (XREF_FIG) was thoroughly abrogated, when the transfected cells were treated with MG132 (XREF_FIG), indicating that the proteosomal degradation pathway acts on the USP15 mediated degradation of Gag protein."

reach
"In corroboration, the observed degradation of p24 by USP15 was thoroughly abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway acts on the[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Remarkably, the band intensity of p24 degraded by USP15 was visibly weaker (XREF_FIG vs A), when the cells were treated with Bafilomycin A1."
UBC affects USP15
8 |
8 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
EIF4A1 affects USP15
| 3 5
| 2 5

sparser
"Together, these results suggest that the USP15-EIF4A1 axis is a key mediator of the reepithelialization process."

sparser
"Since USP15 could interact with EIF4A1, we then investigated whether EIF4A1 expression could be regulated by USP15."

sparser
"USP15 Interacted With EIF4A1."

reach
"In prior studies, USP15 was shown to interact with EIF4A1 and to thereby accelerate wound healing [XREF_BIBR]."

reach
"Conclusively, the USP15 and EIF4A1 complex significantly accelerated re-epithelialization in wound healing."

sparser
"Conclusively, the USP15-EIF4A1 complex significantly accelerated re-epithelialization in wound healing."

sparser
"In addition, a western blot assay proved that the USP15 protein could be pulled down in the anti-EIF4A1 group, which indicated a direct interaction between EIF4A1 and USP15 ( xref )."
| 1

reach
"Moreover, we revealed for the first time that USP15 could interact with eukaryotic initiation factor 4A-1 (EIF4A1), thereby promoting translational efficacy in keratinocytes, which is essential for keratinocyte proliferation and migration."
7 |
Valproic acid increases the amount of USP15. 7 / 7
7 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
| 7
USP15 activates immune response.
| 4

reach
"Among these proteins, we found Ubiquitin carboxyl-terminal hydrolase 15 (Usp15) which positively regulates type I interferon responses and thereby antiviral immune response."

reach
"Our previous work demonstrates that USP15 deficiency promotes antitumor immunity in a transplantable B16 melanoma tumor model, which differs from the present findings obtained using the MCA induced primary tumor model."

reach
"These findings indicate that USP15 ablation promotes immunity against transplantable MCA-205, as well as B16, tumors."

reach
"USP15 deficiency promotes immunity against transplanted MCA tumors."
| 3

reach
"USP15 suppresses tumor immunity via deubiquitylation and inactivation of TET2."

reach
"It is thus possible that inhibition of USP15, along with targeting immunosuppressive regulators of the tumor microenvironment, may induce strong antitumor immunity."

reach
"Together, these findings suggest that USP15 inhibition may not only promote cancer cell apoptosis but also boost T cell mediated anti-tumor immunity."
USP15 affects TOP2A
| 7
USP15 deubiquitinates TOP2A.
| 3
USP15 leads to the deubiquitination of TOP2A. 3 / 3
| 3

reach
"USP15 overexpression significantly reduced the endogenous ubiquitination of TOP2A, and silencing endogenous USP15 promoted TOP2A ubiquitination."

reach
"Accordingly, in the presence or absence of MG132, silencing endogenous USP15 promoted TOP2A ubiquitination (Figures 6I and 6J)."

reach
"The results revealed that USP15 significantly diminished TOP2A ubiquitination, suggesting that USP15 might be a potential TOP2A deubiquitinase (Figure 6B)."
USP15 increases the amount of TOP2A.
| 2
USP15 increases the amount of TOP2A. 2 / 2
| 2

reach
"Moreover, USP15 knockdown enhanced the TOP2A inhibition induced by GINS1 silencing and USP15 overexpression promoted the upregulation of TOP2A expression induced by GINS1 overexpression (Figures 6E and 6F)."

reach
"Moreover, USP15 knockdown reversed the TOP2A inhibition induced by GINS1 silencing and the upregulation of TOP2A expression induced by GINS1 overexpression."
USP15 inhibits TOP2A.
| 1
USP15 inhibits TOP2A. 1 / 1
| 1

reach
"This is consistent with our data showing that depletion of either USP15 isoform reduces TOP2A accumulation during G2."
USP15 decreases the amount of TOP2A.
| 1
USP15 decreases the amount of TOP2A. 1 / 1
| 1

reach
"USP15 depletion does not affect cell cycle phase distribution within an asynchronous population and did not prevent TOP2A transcription during G2, it did, however, impede accumulation of TOP2A protein (Figs."
USP15 affects SMAD2
3 | 4
USP15 binds SMAD2.
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
USP15 increases the amount of SMAD2.
| 2
USP15 increases the amount of SMAD2. 2 / 2
| 2

reach
"Similarly, ectopic expression of USP15 and SMURF2 C/A did not enhance p-SMAD2 levels compared with either construct alone (XREF_FIG)."

reach
"The authors demonstrated that USP15 knockdown significantly inhibited the proliferation, migration, and invasion of hypertrophic scar-derived fibroblasts in vitro and down-regulated the expression of TβRI, Smad2, Smad3, α-SMA, COL1, and COL3; in addition, USP15 overexpression showed the opposite trends (p < 0.05)."
USP15 activates SMAD2.
| 2
USP15 activates SMAD2. 2 / 2
| 2

reach
"Our results indicated that USP15 stimulated TGF-beta and SMAD2 signaling and the cartilage phenotype."

reach
"Moreover, Eichhorn et al. (2012) found that inhibition of USP15 decreased TGF-beta type I receptor and -phosphorylated Smad2 concentrations in these cells, thus corroborating the notion that USP15 sta[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The authors hypothesized that USP15 was up-regulated and enhanced the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TGF-β receptor I (TβRI) in vitro."

reach
"USP15 enhances the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TβRI in vitro."

reach
"USP15 and USP4 promote cell proliferation and invasion in lung cancer cell lines."

reach
"USP15 knockdown significantly inhibited cell proliferation, invasion and epithelial-mesenchymal transition (EMT) of GC in vitro, while overexpression of USP15 promoted these processes."

eidos
"USP15 knockdown significantly inhibited cell proliferation , invasion and epithelial-mesenchymal transition ( EMT ) of GC in vitro , while overexpression of USP15 promoted these processes ."

eidos
"USP15 promotes cell proliferation , invasion and EMT progression of GC via regulating the Wnt / beta-catenin pathway , which suggests that USP15 is a novel potential therapeutic target for GC ."

reach
"On the other hand, SRSF1 is upregulated by high USP15 and USP4 that enhance cell proliferation and invasion (Fig. 7D)."
USP15 affects NRF1
| 7
USP15 binds NRF1.
| 4
| 4

sparser
"In contrast, USP15 physically interacts with Nrf1 and also stabilizes Nrf1 by removing its ubiquitin moieties, such that this transcription factor is activated to promote the expression of Nrf1-target proteasomal genes [ xref ]."

sparser
"Consistently, 3 × Flag-Nrf1 was coprecipitated with V5-USP15, indicating that USP15 physically interacts with Nrf1 in cells."

sparser
"Nevertheless, the coexpression of 3 × Flag-Nrf1 caused the nuclear translocation of V5-USP15, implying a physical interaction between USP15 and Nrf1 in cells (top panels)."

sparser
"USP15 physically interacts with Nrf1, and it markedly stabilizes Nrf1 by removing its ubiquitin moieties."
USP15 activates NRF1.
| 3
USP15 activates NRF1. 3 / 3
| 3

sparser
"These results uncover a new regulatory mechanism that USP15 activates Nrf1 against the β-TrCP inhibition to maintain proteostasis."

sparser
"This study demonstrates a new molecular mechanism of Nrf1 activation by the deubiquitination enzyme USP15 ( Fig. 4 B)."

sparser
"Here, we report that USP15 (Ubiquitin-Specific Protease 15) activates Nrf1 in the nucleus by stabilizing it through deubiquitination."
USP15 affects NFATC2
| 5 1
USP15 activates NFATC2.
| 3
USP15 activates NFATC2. 3 / 4
| 3

reach
"USP15 deficiency enhances NFATc2 activation in naive CD4 + T cells."

reach
"Therefore, USP15 deficiency promotes NFATc2 activation, causes increased T cell responses and function in antitumor immunity."

reach
"USP15 deficiency did not enhance Nfatc2 mRNA induction, as revealed by a qRT-PCR assay (XREF_SUPPLEMENTARY)."
USP15 deubiquitinates NFATC2.
| 2
USP15 leads to the deubiquitination of NFATC2. 2 / 2
| 2

reach
"A parallel HEK293 transfection experiment revealed that USP15 did not inhibit the ubiquitination of NFATc2 (XREF_SUPPLEMENTARY)."

reach
"These data suggest that USP15 promotes the ubiquitination and degradation of activated NFATc2."
USP15 ubiquitinates NFATC2.
| 1
USP15 ubiquitinates NFATC2. 1 / 1
| 1

sparser
"These data suggest that USP15 promotes the ubiquitination and degradation of activated NFATc2."
| 3 4
USP15 activates Carcinogenesis.
| 2 3
| 2 3

reach
"By enhancing TGF-β signaling, USP15 promotes oncogenesis (27)."

eidos
"By enhancing TGF-b signaling , USP15 promotes oncogenesis ( 27 ) ."

reach
"In conclusion, the results from the present study suggest that the high expression of USP15 promotes NSCLC tumorigenesis."

eidos
"By enhancing TGF-beta signaling , USP15 promotes oncogenesis ( 27 ) ."

reach
"By enhancing TGF-b signaling, USP15 promotes oncogenesis (27) ."
USP15 inhibits Carcinogenesis.
| 1 1
| 1 1

eidos
"USP15 may suppress tumorigenesis of HCC by regulating pathway clusters of signal transduction for gene expression , cell cycle , and DNA repair ."

reach
"USP15 may suppress tumorigenesis of HCC by regulating pathway clusters of signal transduction for gene expression, cell cycle, and DNA repair."
USP15 affects APC
1 | 5
USP15 binds APC.
| 3
| 3

reach
"Thus, the CSN controls the Wnt and beta-catenin signalling by assisting the assembly of beta-catenin-degrading supercomplexes by deneddylation and, simultaneously, by stabilising APC via CSN associated USP15."

reach
"CSN controls Wnt and beta-catenin signaling by assisting with the assembly of beta-catenin-degrading supercomplexes by deneddylation and, simultaneously, by stabilizing APC via CSN associated USP15."

reach
"A model is provided that proposes a role of CSN mediated deneddylation in the formation of the beta-catenin-degrading supercomplex and the protection of complex bound APC via CSN associated USP15."
USP15 deubiquitinates APC.
1 | 1
USP15 leads to the deubiquitination of APC. 2 / 2
1 | 1

reach
"However, it has been reported that the assembly of beta-catenin destruction complex is attributed to CSN mediated deneddylation and also reliant on CSN associated USP15, which catalyzes deubiquitination of APC [XREF_BIBR]."
USP15 activates APC.
| 1
USP15 activates APC. 1 / 2
| 1

reach
"Unlike the mechanism of USP15 mediated stabilization of APC, USP15 destabilizes EB1."
USP4 affects SART3
| 1 5
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
USP15 affects mitophagy
| 6
| 6

eidos
"Thus , USP15 knockdown enhanced mitophagy but only in the presence of Parkin ."

eidos
"Interestingly , USP15 strongly inhibited Parkin-mediated mitophagy , while the other DUBs had no effect ( Fig. 1A and B ) ."

eidos
"As demonstrated above in HeLa cells ( Fig. 2A ) , USP15 knockdown does not enhance mitophagy in the complete absence of Parkin ."

eidos
"Overexpression of USP15 inhibits mitophagy dependently of its catalytic activity , while depletion of USP15 enhances mitophagy ."

eidos
"USP15 knockdown rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts As demonstrated above in HeLa cells ( Fig. 2A ) , USP15 knockdown does not enhance mitophagy in the complete absence of Parkin ."

eidos
"USP15 , a deubiquitinase specifically counteracts the parkin-mediated ubiquitination of mitochondria and thus prevents mitophagy , while USP15 knockdown stimulates mitochondrial ubiquitination and age-dependent mitophagy defects in Parkin-deficient muscles and dopaminergic neurons [ 91,106 ] ."
USP15 affects activity
| 6
USP15 activates activity.
| 4
USP15 activates activity. 4 / 4
| 4

sparser
"These results clearly suggest that USP15 activates the transcriptional activity of Nrf1."

sparser
"Furthermore, we examined whether USP15 can activate the NRF1-induced endogenous proteasome activity ( Fig. 3 B)."

sparser
"USP15 activates ubiquitin ligase activity by deubiquitinating Keap1 as its adaptor, promoting the proteasomal degradation of Nrf2."

sparser
"Thus, we concluded that USP15 activates proteasome activity through regulating Nrf1 function."
USP15 inhibits activity.
| 2
USP15 inhibits activity. 2 / 2
| 2

sparser
"Moreover, high alkaline phosphatase activity is linked to poor prognosis in patients with prostatic bone metastases [ xref ], and we found that loss of USP15 inhibited BMP-induced alkaline phosphatase activity in C2C12 cells."

sparser
"Myc-USP15 inhibited the activity of Nrf2 in a concentration-dependent manner ( xref )."
USP15 affects TRAF4
2 | 3 1
2 | 3 1

sparser
"TRAF4 also interacts with deubiquitinating enzyme USP15, which deubiquitinates TβRI upon SMURF2-mediated ubiquitination of TβRI, stabilizing this signaling pathway."

No evidence text available

reach
"Moreover, USP15, a recently reported deubiquitinating enzyme for TbetaRI (Eichhorn et al., 2012), also associates with TRAF4."

reach
"TRAF4 also interacts with deubiquitinating enzyme USP15, which deubiquitinates TbetaRI upon SMURF2 mediated ubiquitination of TbetaRI, stabilizing this signaling pathway."

No evidence text available

reach
"TRAF4 binds to SMURF2 and USP15."
USP15 affects SRSF1
| 6
USP15 activates SRSF1.
| 4
USP15 activates SRSF1. 4 / 4
| 4

reach
"On the other hand, SRSF1 is upregulated by high USP15 and USP4 that enhance cell proliferation and invasion (Fig. 7D)."

reach
"Overexpression of USP15 and USP4 upregulated SRSF1 (Fig. 3A), while the knockdown caused its downregulation (Fig. 3B)."

reach
"Additionally, the depletion of SRSF1 by USP15 and USP4 knockdown got restored by ectopically overexpressed USP15 or USP4 wild-type, but not by their respective active site mutants (Fig. 3C, D), suggesting that USP15 and USP4 activity is required for SRSF1 regulation."

reach
"Depletion of USP15 and USP4 impair SRSF1 splicing characterized by the replacement of exon 4 with non-coding intron sequences retained at its C-terminus, resulting in an alternative isoform SRSF1-3."
USP15 increases the amount of SRSF1.
| 2
USP15 increases the amount of SRSF1. 2 / 2
| 2

reach
"Also, the subsequent overexpression of SRSF1 restored the decreased invasion by USP15 (Fig. 5C, D) and USP4 (Fig. 5F, G) knockdown in H157 cells, as well as in A549 cells (Supplementary Fig. 5A, B)."

reach
"Collectively, our current study demonstrates USP15 and USP4 mediated lung cancer cell proliferation and migration by increasing the expression of functional full-length SRSF1 protein."
USP15 affects SMAD3
1 5 |
USP15 binds SMAD3.
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
USP15 deubiquitinates SMAD3.
1 |
USP15 deubiquitinates SMAD3 on lysine. 1 / 1
1 |

No evidence text available
USP15 affects SMAD2_3
| 2 4
USP15 binds SMAD2_3.
| 4
| 4

sparser
"Finally, we provide evidence that this type of control might operate more widely by showing that interactions between USP15 with SMAD2/3 ( xref ) are subject to USP15 auto-regulation."

sparser
"Similar to USP4, the interactions between USP15 and its protein target, SMAD2/3 [ xref ], are governed via USP15 self-regulation, while catalytically inactive USP15 lacks the ability to bind to SMAD2/3 protein [ xref ]."

sparser
"Studies have shown that the substrate SMAD2/3 can interact with WT USP15, and not with a catalytically dead USP15 mutant, implying that there may be an auto-deubiquitination-dependent interaction as well ( xref ; xref )."

sparser
"In light of our USP4 findings, we tested whether catalytically dead USP15 was still able to interact with one of its established substrates, SMAD2/3 ( xref ), and if this interaction was influenced by C451A mutagenesis."
USP15 deubiquitinates SMAD2_3.
| 2
USP15 deubiquitinates SMAD2_3. 2 / 2
| 2

reach
"USP15 has been reported to reverse SMAD2/3 monoubiquitylation, which targets the DNA binding domains of SMAD2/3 and inhibits promoter recognition."

reach
"Upon TGFbeta signaling, Usp15 deubiquitinates Smad2/3, which would lead to p97 dissociation and transcription activation."
USP15 affects SMAD1
2 | 2 2
USP15 phosphorylates SMAD1.
| 1 2
USP15 leads to the phosphorylation of SMAD1. 3 / 3
| 1 2

reach
"Herhaus and coworkers showed that USP15 can interact with and deubiquitinate BMP type I receptors, thereby promoting phosphorylation of Smad1 (Herhaus et al., 2014)."

sparser
"We show that USP15 enhances BMP-induced phosphorylation of SMAD1 by interacting with and deubiquitylating ALK3."

sparser
"Further characterisation of the role of USP15 in the BMP pathway established that USP15 enhances BMP-induced phosphorylation of SMAD1 and transcription."
USP15 binds SMAD1.
2 |
2 |

No evidence text available

No evidence text available
USP15 increases the amount of SMAD1.
| 1
Modified USP15 increases the amount of SMAD1. 1 / 1
| 1

reach
"Indeed, overexpression of HA-USP15 in HEK293 cells increased the levels of pSMAD1 in response to BMP signalling (XREF_FIG a), and this was true in both nuclear [XREF_BIBR - XREF_BIBR] and cytoplasmic fractions (XREF_FIG b)."
USP15 affects RNF26
2 | 1 2
2 | 1 2

No evidence text available

reach
"Weshow that RNF26 interacts with the DUB USP15, which influences occupancy of RNF26 by their common substrate, SQSTM1."

sparser
"This function could be served by USP15, which preferentially associates with catalytically competent RNF26 ( xref A and 5D)."

sparser
"We show that RNF26 interacts with the DUB USP15, which influences occupancy of RNF26 by their common substrate, SQSTM1."

No evidence text available
USP15 affects RAF1
| 5
USP15 decreases the amount of RAF1.
| 3
USP15 decreases the amount of RAF1. 3 / 4
| 3

reach
"Concordantly, depletion of USP15 in these cells caused a reduction of CRAF expression levels but did not affect the MEK or ERK phosphorylation status (XREF_FIG C)."

reach
"RT-PCR analysis of mRNA levels showed that USP15 depletion with two independent oligos causes a reduction of CRAF transcript levels (XREF_FIG A)."

reach
"Although, USP15 depletion reduced the level of C-RAF, it had no effect on the level of B-RAF and p-MEK in B-RAFV600E harbouring melanoma cells [155]."
USP15 increases the amount of RAF1.
| 2
USP15 increases the amount of RAF1. 2 / 2
| 2

reach
"Furthermore we are able to demonstrate that USP15 also contributes to the regulation of sustained MAP kinase signaling after acute stimulation by modulating the expression level of the upstream kinase CRAF."

reach
"Rather we found a specific and significant impact of USP15 depletion on a luciferase reporter cloned upstream of the CRAF 3 '-UTR, suggesting that USP15 may modulate CRAF protein levels via an as yet identified mechanism involving its 3 '-UTR."
TRIM25 affects E6
| 6
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
TRAF4 affects USP15
2 | 3 1
2 | 3 1

sparser
"TRAF4 also interacts with deubiquitinating enzyme USP15, which deubiquitinates TβRI upon SMURF2-mediated ubiquitination of TβRI, stabilizing this signaling pathway."

No evidence text available

reach
"Moreover, USP15, a recently reported deubiquitinating enzyme for TbetaRI (Eichhorn et al., 2012), also associates with TRAF4."

reach
"TRAF4 also interacts with deubiquitinating enzyme USP15, which deubiquitinates TbetaRI upon SMURF2 mediated ubiquitination of TbetaRI, stabilizing this signaling pathway."

No evidence text available

reach
"TRAF4 binds to SMURF2 and USP15."
TGFBR1 affects USP15
3 | 3
3 | 3

No evidence text available

No evidence text available

reach
"Ubiquitin-specific peptidase 15 (USP15), a deubiquitinating enzyme, binds to the SMAD7-SMURF2 complex and deubiquitinates and stabilizes TGFBR1, resulting in enhanced TGF-β signaling ."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."

reach
"USP15 binds to the Smad7 and Smurf2 complex and, like USP4 and USP11, deubiquitinates the TGF-beta type I receptor, thereby maintaining the stability of this receptor and enhancing TGF-beta signalling[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available
TET2 affects USP15
| 6
| 6

sparser
"Collectively, these data demonstrate that USP15 and TET2 physically interact with each other, and the CD domain of TET2 is responsible for their association."
| PMC

sparser
"USP15 binds to TET2."
| PMC

sparser
"To determine the functional significance of USP15-TET2 interaction, we first performed a dot blot experiment to determine 5hmC levels in cells ectopically expressing USP15."
| PMC

sparser
"Using antibodies that recognize TET2 or USP15, we detected endogenous interaction between USP15 and TET2 by reciprocal IP-Western assay in both human U2OS cells and mouse B16–ovalbumin (OVA) cells ( xref )."
| PMC

sparser
"First, USP15 directly interacts with TET2 ( xref ) and catalyzes the TET2 deubiquitylation."
| PMC

sparser
"To confirm the interaction of TET2 with USP15, we examined the binding of their association in cells when both proteins were ectopically expressed by IP–Western blot analysis."
| PMC
SART3 affects USP4
| 1 5
USP15 binds USP4 and SART3. 6 / 6
| 1 5

reach
"Deubiquitination of PRP31 and PRP3 by the USP15, SART3, and USP4 complex decreases the affinity towards PRP8 and this regulation is important for the proper splicing of chromosome segregation related genes such as Bub1 and alpha-tubulin."

sparser
"PRP31, a component of the U4 snRNP, is modified with K63-linked ubiquitin chains by the PRP19 complex and is deubiquitinated by the ternary complex of USP15, SART3, and USP4."

sparser
"Consistent with our prediction, SART3 interacted with endogenous USP4 and USP15 (Figure xref )."

sparser
"We next examined whether SART3 forms a complex with USP15 and USP4 simultaneously using sequential immunoprecipitation."

sparser
"Moreover, as a substrate recruiting factor of USP15 either ( xref ; xref ), SART3 can simultaneously bind USP4 and USP15, serving as a platform to deubiquitinate PRP31 and PRP3 ( xref )."

sparser
"Drugs interfering with the interaction between USP4 and USP15 and SART3 may selectively inhibit the DUB functions in the nucleus."
| PMC
RNF26 affects USP15
2 | 1 2
2 | 1 2

No evidence text available

reach
"Weshow that RNF26 interacts with the DUB USP15, which influences occupancy of RNF26 by their common substrate, SQSTM1."

sparser
"This function could be served by USP15, which preferentially associates with catalytically competent RNF26 ( xref A and 5D)."

sparser
"We show that RNF26 interacts with the DUB USP15, which influences occupancy of RNF26 by their common substrate, SQSTM1."

No evidence text available
KEAP1 affects USP15
1 | 2 3
KEAP1 binds USP15.
1 | 3
1 | 2

sparser
"These findings suggest that AML cells rely on broken redox sensing, instigated by USP15-KEAP1 repression of NRF2-mediated antioxidant programming."

No evidence text available

sparser
"COP1, along with numerous other ubiquitin ligases, is regulated by the COP9 signalosome; this protein complex is associated with the oxidative stress sensor Keap1 and the deubiquitinase USP15."

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
KEAP1 inhibits USP15.
| 2
KEAP1 inhibits USP15. 2 / 2
| 2

reach
"Moreover, depletion of Kelch-like ECH-associated protein 1 (Keap1) diminished the regulatory effect of USP15 inhibition on Nrf2 activation."

reach
"Given that Nrf2 exerts gene regulation in the oxidative stress response, it is quite reasonable that oxidative stress could repress the Keap1 mediated proteasomal degradation of Nrf2 by suppressing US[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
E6 affects TRIM25
| 6
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
USP15 affects proteolysis
| 5
| 5

reach
"Further investigation demonstrated the significance of Nef- and USP15 mediated viral and cellular protein degradation with respect to the regulation of the virus life cycle and HIV-1 and host cell competition that is essential for AIDS progression."

reach
"Further investigation demonstrated the significance of Nef- and USP15 mediated viral and cellular protein degradation with respect to the regulation of the virus life cycle and HIV-1 and host cell com[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"To investigate Nef role in protein degradation, we seek to identify cellular proteins involved in the UPS mediated protein degradation through association with Nef and found ubiquitin specific protease 15 (USP15) which stabilizes proteins by deubiquitylation and by preventing autoubiquitylation of substrates."

reach
"We found that Nef binds to ubiquitin protein ligase E3A (UBE3A and E6AP) which induces protein degradation by attaching Ub to substrates, i.e. Nef associated with two functionally antagonistic proteins in the UPS mediated protein degradation processes, suggesting that UBE3A could be a major cellular component in regulating USP15 mediated viral protein degradation by interacting with Nef and USP15 simultaneously or independently."

reach
"To investigate Nef role in protein degradation, we seek to identify cellular proteins involved in the UPS mediated protein degradation through association with Nef and found ubiquitin specific proteas[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP15 affects YAP1
1 | 3 1
USP15 activates YAP1.
| 3
USP15 activates YAP1. 3 / 3
| 3

reach
"Human pulmonary artery smooth muscle cells (hPASMCs) were exposed to hypoxia to mimic PH in vitro, and USP15 knockdown significantly inhibited cell proliferation, migration, and YAP1/TAZ signaling in hypoxic hPASMCs."

reach
"USP15 promotes pulmonary vascular remodeling in pulmonary hypertension in a YAP1/TAZ-dependent manner."

reach
"Rescue assays further suggested that USP15 promoted hPASMC proliferation and migration in a YAP1/TAZ-dependent manner."
USP15 binds YAP1.
1 | 1
1 | 1

sparser
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."

No evidence text available
USP15 affects USP15
| 2
USP15 activates USP15.
| 1
USP15 activates USP15. 1 / 3
| 1

reach
"Additionally, our results suggest the need to examine whether blockage of endogenous expression of USP15 reverses USP15 mediated degradation of viral proteins and thus the impairment of HIV-1 replication."
USP15 decreases the amount of USP15.
| 1
USP15 decreases the amount of USP15. 1 / 2
| 1

reach
"Three distinct siRNAs targeting USP15 and a control siRNA targeting FoxO4 were transfected in HEK293 cells (XREF_FIG a), in which all three USP15 siRNAs caused an approximately 80-90% reduction in USP15 protein levels compared with the FoxO4 control (XREF_FIG a)."
USP15 affects TUT1
1 | 1 1 2
USP15 binds TUT1.
1 | 2
1 | 2

No evidence text available

sparser
"These findings provide a possibility that disturbance of the USP15-TUT1 cascade may induce chronic and mild ER stress, leading to an acceleration of neurodegenerative phenotype."

sparser
"Moreover, inhibition of the USP15-TUT1 cascade triggered mild and chronic endoplasmic reticulum (ER) stress."
USP15 deubiquitinates TUT1.
| 1 1
USP15 deubiquitinates TUT1. 2 / 2
| 1 1

trips
"USP15 deubiquitinates TUT1 associated with RNA metabolism and maintains cerebellar homeostasis."

reach
"USP15 deubiquitinates TUT1 associated with RNA metabolism and maintains cerebellar homeostasis."
USP15 affects RORC
1 | 4
1 | 3

sparser
"USP15 interacts with RORγt and deubiquitinates K446."

sparser
"Interestingly, a catalytically inactive USP15 with a cysteine 298 to alanine mutation (C298A) ( xref ), had reduced interaction with RORγt ( xref ), suggesting important function of enzyme activity in RORγt-USP15 interaction."

sparser
"We also confirmed the RORγt-USP15 interaction in differentiated Th17 cells ( xref )."

No evidence text available
RORC binds USP15 and FDH. 1 / 1
| 1

sparser
"RORγt-USP15 interaction in the RORγt-flag EL4 cells was confirmed by immunoprecipitation analysis ( xref )."
| 5

reach
"USP15 knockdown rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts As demonstrated above in HeLa cells ( Fig. 2A) , USP15 knockdown does not enhance mitophagy in the complete absence of Parkin."

reach
"The deubiquitinase USP15 antagonizes Parkin-mediated mitochondrial ubiquitination and mitophagy.Loss-of-function mutations in PARK2, the gene encoding the E3 ubiquitin ligase Parkin, are the most frequent cause of recessive Parkinson's disease (PD)."

reach
"The deubiquitinase USP15 antagonizes Parkin-mediated mitochondrial ubiquitination and mitophagy.Loss-of-function mutations in PARK2, the gene encoding the E3 ubiquitin ligase Parkin, are the most frequent cause of recessive Parkinson's disease (PD)."

reach
": Knockdown of USP15 rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts."

reach
"USP15 knockdown rescues the mitophagy defect of PARK2 mutant PD patient fibroblasts."
USP15 affects IL1R2
| 2 3
| 2 3

reach
"The initial screening identified a number of protein candidates in the SUM159‐IL1R2/‐sIL1R2 and MB231‐IL1R2/‐sIL1R2 cells (Table S5, Supporting Information), among them, we did not find the previous reported ubiquitin Ligases or deubiquitinase of BMI1 such as βTrCP,19 RING1B,20 or USP22,21 but we found that IL1R2 could bind to USP15 (Figure 4 A)."

sparser
"These results indicated that IL1R2 could bind to USP15 and increases the deubiquitination and stability of BMI1 protein, which then promotes BTIC enrichment and BC progression."

sparser
"Here, we found that IL1R2 intracellular domain (icd‐IL1R2) could bind to the deubiquitinase USP15 at the UBL2 domain and promoted USP15 deubiquitinase activity on BMI1 protein deubiquitination at K81 and finally increased BMI1 stability in BC cellular nucleus."

sparser
"The initial screening identified a number of protein candidates in the SUM159‐IL1R2/‐sIL1R2 and MB231‐IL1R2/‐sIL1R2 cells (Table S5, Supporting Information), among them, we did not find the previous reported ubiquitin Ligases or deubiquitinase of BMI1 such as βTrCP, xref RING1B, xref or USP22, xref but we found that IL1R2 could bind to USP15 ( Figure xref A)."

reach
"These results indicated that IL1R2 could bind to USP15 and increases the deubiquitination and stability of BMI1 protein, which then promotes BTIC enrichment and BC progression.2."
USP15 affects HECTD1
| 2 3
| 2 3

sparser
"Interaction of USP15 with HECTD1."

reach
"First we confirmed the interaction between USP15 and HECTD1 in two additional GBM cell lines, LN-428 and LN-18 after immunoprecipitation of the endogenous USP15 by Western blot."

reach
"Then we assessed the nature of the interaction between USP15 and HECTD1."

sparser
"Then we assessed the nature of the interaction between USP15 and HECTD1."

sparser
"To better understand the USP15-HECTD1 interaction we performed a de-ubiquitination assay."
USP15 affects ESR1
| 5
| 5

sparser
"Moreover, the results of Co-IP assay show that USP15 interacts with ERα."

sparser
"These findings not only provide a novel treatment for overcoming resistance to endocrine therapy, but also represent a therapeutic strategy on ERα degradation by targeting USP15-ERα axis."

sparser
"Co-immunoprecipitation (Co-IP) with antibodies against ERα followed by immunoblot (IB) with antibodies against USP15 showed that endogenous USP15 notably interacted with ERα, and vice versa (Fig. xref )."

sparser
"USP15 interacts with ERα."

sparser
"The results of Co-IP assay confirmed the efficient interaction between USP15 and ERα protein (Fig. xref ), which is consistent with the previous results."
USP15 affects CTNNB1
2 | 3
USP15 binds CTNNB1.
2 | 1
2 | 1

reach
"Both USP15 and USP47 form a complex with beta-catenin leading to its deubiquitination and stabilization [248,249]."

No evidence text available

No evidence text available
USP15 inhibits CTNNB1.
| 2
USP15 inhibits CTNNB1. 2 / 2
| 2

reach
"USP4 negatively regulates Wnt signaling by interacting with Nemolike kinase [XREF_BIBR] and USP15 promotes beta-catenin degradation through the stabilization of adenomatous polyposis coli (APC), a negative regulator of Wnt mediated transcription [XREF_BIBR]."

reach
"USP15 in turn prevents the basal turnover of beta-catenin by inhibiting its ubiquitin dependent proteasomal degradation, thereby enhancing WNT signaling."
USP15 affects C6orf89
| 5
USP15 binds C6orf89.
| 3
| 3

reach
"Indeed, we were able to detect a constitutive interaction between endogenous USP15 and BRAP in (both stimulated and unstimulated) HEK293T cells (XREF_FIG B)."

reach
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15 : BRAP rather than USP4 : BRAP interaction may be of most relevance within a physiological setting."

reach
"In this study we show that CRAF expression levels are controlled by the BRAP binding partner USP15, which therefore acts as a positive regulator of MAPK signaling."
USP15 activates C6orf89.
| 2
USP15 activates C6orf89. 2 / 2
| 2

reach
"Endogenous BRAP appears to be constitutively poly- or multiply monoubiquitylated in our system; however, depletion of USP15 promotes the appearance of additional high molecular weight ubiquitylated species of BRAP."

reach
"Our results lead to the prediction that USP15 knockdown may recapitulate the effect of BRAP knockdown by destabilizing and thereby reducing the pool of BRAP that is able to sequester key components of the MAPK module, such as KSR1."
SMAD3 affects USP15
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
RORC affects USP15
1 | 4
1 | 3

sparser
"USP15 interacts with RORγt and deubiquitinates K446."

sparser
"Interestingly, a catalytically inactive USP15 with a cysteine 298 to alanine mutation (C298A) ( xref ), had reduced interaction with RORγt ( xref ), suggesting important function of enzyme activity in RORγt-USP15 interaction."

sparser
"We also confirmed the RORγt-USP15 interaction in differentiated Th17 cells ( xref )."

No evidence text available
RORC binds USP15 and FDH. 1 / 1
| 1

sparser
"RORγt-USP15 interaction in the RORγt-flag EL4 cells was confirmed by immunoprecipitation analysis ( xref )."
PRKN affects USP15
| 1 4
| 1 4

sparser
"We then asked if there was a functional interaction between Parkin and USP15."

sparser
"As we were unable to coimmunoprecipitate USP15 with endogenous Parkin in HEK293 cells, we assumed that the binding of Parkin and USP15 is weak and not detectable at endogenous Parkin expression levels."

sparser
"Coimmunoprecipitation and western blotting confirmed the interaction of overexpressed Parkin with USP15 (Supplementary Material, Fig. S1 ), but not USP11."

sparser
"Coimmunoprecipitation and western blotting confirmed the interaction of overexpressed Parkin with USP15 (Supplementary Data), but not USP11."

reach
"As we were unable to coimmunoprecipitate USP15 with endogenous Parkin in HEK293 cells, we assumed that the binding of Parkin and USP15 is weak and not detectable at endogenous Parkin expression levels.We then asked if there was a functional interaction between Parkin and USP15."
NFE2L1 affects USP15
1 | 4
1 | 4

reach
"Consistently, 3 x Flag-Nrf1 was coprecipitated with V5-USP15, indicating that USP15 physically interacts with Nrf1 in cells.We next examined whether USP15 stabilizes Nrf1 through its deubiquitination."

reach
"USP15 physically interacts with Nrf1, and it markedly stabilizes Nrf1 by removing its ubiquitin moieties."

reach
"Nevertheless, the coexpression of 3 x Flag-Nrf1 caused the nuclear translocation of V5-USP15, implying a physical interaction between USP15 and Nrf1 in cells (top panels)."

reach
"To address this hypothesis, we first examined an association between USP15 and Nrf1 using immunoprecipitation."

No evidence text available
IL1R2 affects USP15
| 2 3
| 2 3

reach
"The initial screening identified a number of protein candidates in the SUM159‐IL1R2/‐sIL1R2 and MB231‐IL1R2/‐sIL1R2 cells (Table S5, Supporting Information), among them, we did not find the previous reported ubiquitin Ligases or deubiquitinase of BMI1 such as βTrCP,19 RING1B,20 or USP22,21 but we found that IL1R2 could bind to USP15 (Figure 4 A)."

sparser
"These results indicated that IL1R2 could bind to USP15 and increases the deubiquitination and stability of BMI1 protein, which then promotes BTIC enrichment and BC progression."

sparser
"Here, we found that IL1R2 intracellular domain (icd‐IL1R2) could bind to the deubiquitinase USP15 at the UBL2 domain and promoted USP15 deubiquitinase activity on BMI1 protein deubiquitination at K81 and finally increased BMI1 stability in BC cellular nucleus."

sparser
"The initial screening identified a number of protein candidates in the SUM159‐IL1R2/‐sIL1R2 and MB231‐IL1R2/‐sIL1R2 cells (Table S5, Supporting Information), among them, we did not find the previous reported ubiquitin Ligases or deubiquitinase of BMI1 such as βTrCP, xref RING1B, xref or USP22, xref but we found that IL1R2 could bind to USP15 ( Figure xref A)."

reach
"These results indicated that IL1R2 could bind to USP15 and increases the deubiquitination and stability of BMI1 protein, which then promotes BTIC enrichment and BC progression.2."
HECTD1 affects USP15
| 2 3
| 2 3

sparser
"Interaction of USP15 with HECTD1."

reach
"First we confirmed the interaction between USP15 and HECTD1 in two additional GBM cell lines, LN-428 and LN-18 after immunoprecipitation of the endogenous USP15 by Western blot."

reach
"Then we assessed the nature of the interaction between USP15 and HECTD1."

sparser
"Then we assessed the nature of the interaction between USP15 and HECTD1."

sparser
"To better understand the USP15-HECTD1 interaction we performed a de-ubiquitination assay."
ESR1 affects USP15
| 5
| 5

sparser
"Moreover, the results of Co-IP assay show that USP15 interacts with ERα."

sparser
"These findings not only provide a novel treatment for overcoming resistance to endocrine therapy, but also represent a therapeutic strategy on ERα degradation by targeting USP15-ERα axis."

sparser
"Co-immunoprecipitation (Co-IP) with antibodies against ERα followed by immunoblot (IB) with antibodies against USP15 showed that endogenous USP15 notably interacted with ERα, and vice versa (Fig. xref )."

sparser
"USP15 interacts with ERα."

sparser
"The results of Co-IP assay confirmed the efficient interaction between USP15 and ERα protein (Fig. xref ), which is consistent with the previous results."
E6 affects TRIM25, and USP15
| 5
USP15 binds TRIM25 and E6. 5 / 5
| 5

sparser
"Furthermore, HPV E6 protein forms a ternary complex with USP15 and TRIM25, resulting in the inhibition of immune surveillance and antiviral responses, thereby exhibiting a direct involvement in immune system regulation [ xref ]."

sparser
"As TRIM25 protein stability is regulated by the balance between degradative K48-linked ubiquitination and USP15-mediated deubiquitination, the authors performed coimmunoprecipitation experiments in HEK 293T and cervical-carcinoma-derived C33a cells ectopically expressing FLAG-tagged E6 of HPV16, showing that E6 binds exogenous TRIM25 and USP15, giving rise to a ternary E6-TRIM25-USP15 complex."

sparser
"In the RLR-mediated signaling pathway, E6 forms a three-molecule complex with TRIM25 and USP15, which triggers the K48-linked ubiquitination and proteasomal degradation of TRIM25, attenuates the TRIM25-mediated K63-linked ubiquitination of RIG-I."

sparser
"Interestingly, it has been shown that HPV16 E6, but not E7, forms a complex with TRIM25 and its regulator ubiquitin carboxyl-terminal hydrolase 15 (USP15), inducing TRIM25 degradation [ xref ]."

sparser
"HPV E6 binds to both TRIM25 and USP15 when ectopically expressed or in natively HPV-infected cells."
VCP affects USP15
| 4
| 4

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Likewise, in osteoclasts the interaction of USP15 with VCP and p97 was markedly decreased in the absence of CHMP5 (XREF_FIG), suggesting that CHMP5 mediates the interaction between USP15 and VCP and p97."

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Likewise, in osteoclasts the interaction of USP15 with VCP and p97 was markedly decreased in the absence of CHMP5 (XREF_FIG), suggesting that CHMP5 mediates the interaction between USP15 and VCP and p97."
USP7 affects USP15
1 | 1 2
1 | 1 1

reach
"A protein protein interaction screen study has revealed the physical interaction between USP15 and USP7, although the functional significance remains to be further studied 36."

sparser
"A protein-protein interaction screen study has revealed the physical interaction between USP15 and USP7, although the functional significance remains to be further studied xref ."

No evidence text available
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."
USP15 affects protein
| 4
USP15 inhibits protein. 4 / 4
| 4

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway plays a key role in[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"In corroboration, the observed degradation of p24 by USP15 was thoroughly abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway acts on the[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"In corroboration, the observed degradation of p24 by USP15 (XREF_FIG) was thoroughly abrogated, when the transfected cells were treated with MG132 (XREF_FIG), indicating that the proteosomal degradation pathway acts on the USP15 mediated degradation of Gag protein."

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132 (XREF_FIG), indicating that the proteosomal degradation pathway plays a key role in USP15- mediated degradation of Gag protein."
USP15 affects pathway
| 4
USP15 inhibits pathway. 4 / 4
| 4

sparser
"USP15 inhibits the NF-κB pathway by removing K48-Ub from IκBα and consequently prevent degradation it."

sparser
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63-based chains [55], [56], and USP15 inhibits the NFκB pathway by removing K48-Ub from IκBα, preventing its degradation [57]."

sparser
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63-based chains [55, 56] , and USP15 inhibits the NFkB pathway by removing K48-Ub from IkBa, preventing its degradation [57] ."

sparser
"The NF‐kB signalling pathway plays critical role in regulation of innate and adaptive immunity, inflammation, apoptosis, cancer and tumour development. xref NF‐kB is a transcription factor, consists of five related proteins, p105/p50 (NF‐κB1) and p100/p52 (NF‐κB2), p65 (RelA), RelB and c‐Rel (Rel), which in resting state remain in the cytoplasm as dimers associated with the IκB inhibitor. xref There are eight IκB proteins, IκBα, IκBβ, IκBε, IκBζ, BCL‐3, IκBns and the precursor proteins NF‐κB2 and NF‐κB1, which are characterized by the presence of six to seven ankyrin repeat motifs (ANK) which have binding ability to NF‐κB dimers. xref , xref Therefore, in unstimulated cells, NF‐κB dimers bind to IκB inhibitor proteins in the cytoplasm because all NF‐κB proteins are characterized by the presence of a highly conserved Rel homology domain (RHD) in their N‐terminus, which contains a nuclear localization signal (NLS) and is responsible interaction with IκBs. xref Upon stimulation, IκB is phosphorylated in serine residues by the IκB kinase (IKK) complex, which consists of two catalytic subunits, IKKα (IKK1 or CHUK) and IKKβ (IKK2) and an NF‐κB essential modifier (NEMO, also known as IKKγ, IKKAP1 or Fip‐3). xref , xref Phosphorylated IκB creates a destruction motif recognized by the ubiquitin ligase complex and degraded by 26S proteasome, then NF‐κB complexes translocate to the nucleus and regulates the expression of its target genes. xref , xref Ubiquitination plays a crucial role in control of NF‐κB pathway as a major regulator of the immune response. xref USP15 inhibits the NF‐κB pathway by removing K48‐Ub from IκBα and consequently prevent degradation it."
USP15 affects Wnt
| 2 1
USP15 activates Wnt. 3 / 4
| 2 1

eidos
"USP15 stabilizes beta-catenin and enhances Wnt signaling ."

reach
"USP15 stabilizes β-catenin and enhances Wnt signaling."

eidos
"Finally , rescue experiments showed that the effect of USP15 on gastric cancer progression was dependent on Wnt / beta-catenin pathway ."
USP15 affects VCP
| 4
| 4

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Likewise, in osteoclasts the interaction of USP15 with VCP and p97 was markedly decreased in the absence of CHMP5 (XREF_FIG), suggesting that CHMP5 mediates the interaction between USP15 and VCP and p97."

reach
"To confirm the observation that the CHMP5 complex in osteoclasts contains the deubiquitinating enzyme USP15 and VCP and p97 (XREF_FIG), the physical interactions between CHMP5, USP15, and VCP and p97 were studied using cell-free immunoprecipitation analysis (XREF_FIG)."

reach
"Likewise, in osteoclasts the interaction of USP15 with VCP and p97 was markedly decreased in the absence of CHMP5 (XREF_FIG), suggesting that CHMP5 mediates the interaction between USP15 and VCP and p97."
USP15 affects USP7
1 | 1 2
1 | 1 1

reach
"A protein protein interaction screen study has revealed the physical interaction between USP15 and USP7, although the functional significance remains to be further studied 36."

sparser
"A protein-protein interaction screen study has revealed the physical interaction between USP15 and USP7, although the functional significance remains to be further studied xref ."

No evidence text available
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."

reach
"On the other hand, the aberrant activation of the USP15 deficient T cells appears to promote an immunosuppressive tumor microenvironment that facilitates tumor development during the long period of tumor-immune system interplay."

reach
"The USP15 deficient T cells, likely via excessive production of IFN-gamma, promoted an immunosuppressive tumor microenvironment that suppressed antitumor immunity."

reach
"T cell intrinsic USP15 deficiency promotes excessive IFN-gamma production and an immunosuppressive tumor microenvironment in MCA induced fibrosarcoma."

reach
"USP15 deficient T cells contribute to immunosuppressive tumor microenvironment."
USP15 affects TAFAZZIN
| 3 1
USP15 binds TAFAZZIN.
| 1 1
| 1 1

reach
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."

sparser
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."
USP15 activates TAFAZZIN.
| 2
| 2

reach
"Human pulmonary artery smooth muscle cells (hPASMCs) were exposed to hypoxia to mimic PH in vitro, and USP15 knockdown significantly inhibited cell proliferation, migration, and YAP1/TAZ signaling in hypoxic hPASMCs."

reach
"Rescue assays further suggested that USP15 promoted hPASMC proliferation and migration in a YAP1/TAZ-dependent manner."
USP15 affects SYVN1
| 1 3
| 1 3

sparser
"USP15 interacts with Hrd1, an E3 ligase, in microphages to regulate IkBα degradation and pro-inflammatory cytokine production in the TLR4-mediated signalling pathway [ xref ]."

sparser
"Hrd1 interacts directly with the deubiquitinating enzyme Usp15."

reach
"Hrd1 interacts directly with the deubiquitinating enzyme Usp15."

sparser
"SYVN1 directly interacts with the deubiquitinating enzyme Usp15."
USP15 affects RORgammat
| 4
USP15 activates RORgammat.
| 3
USP15 activates RORgammat. 3 / 3
| 3

reach
"Altogether, our results indicate that USP15 stimulates RORgammat activity via enhancing SRC1 recruitment, ultimately leading to promoting Th17 differentiation."

reach
"This suggests that USP15 stimulates RORgammat activity via enhancing SRC1 recruitment."

reach
"USP15 stimulates RORgammat activity and Th17 differentiation by enhancing SRC1 recruitment."
USP15 deubiquitinates RORgammat.
| 1
USP15 deubiquitinates RORgammat on K446. 1 / 1
| 1

reach
"To determine whether USP15 can deubiquitinate RORgammat K446 specifically, K446 that has all lysines mutated to arginines except K446 was co-expressed with USP15 WT or C298A and HA-Ub in 293T cells, as we showed that K446 can be ubiquitinated (XREF_FIG)."
USP15 affects K48-
| 4
USP15 inhibits K48-.
| 2
USP15 inhibits K48-. 2 / 2
| 2

reach
"We show that USP15 antagonizes the Parkin-mediated accumulation of K48- and K63-linked chains on mitochondria."

reach
"Overexpression of USP15 antagonized Parkin-mediated clustering of both K48- and K63-linked ubiquitin chains on depolarized mitochondria (Fig. 6B, C, E, F)."
USP15 activates K48-.
| 2
USP15 activates K48-. 2 / 2
| 2

reach
"Overexpression of USP15 antagonized Parkin-mediated clustering of both K48- and K63-linked ubiquitin chains on depolarized mitochondria (Fig. 6B, C, E, F)."

reach
"We show that USP15 antagonizes the Parkin-mediated accumulation of K48- and K63-linked chains on mitochondria."
USP15 affects IRS2
2 | 1
USP15 binds IRS2.
2 |
2 |

No evidence text available

No evidence text available
USP15 deubiquitinates IRS2.
| 1
Modified USP15 leads to the deubiquitination of IRS2. 1 / 1
| 1

reach
"In HEK293cells, Nedd4 overexpression induced IRS-2 ubiquitination, which was decreased by USP15 co-expression while increased by USP15 knockdown."
USP15 affects H2BC21
2 2 |
USP15 deubiquitinates H2BC21.
2 |
USP15 deubiquitinates H2BC21. 2 / 2
2 |

"The U4/U6 recycling factor SART3 has histone chaperone activity and associates with USP15 to regulate H2B deubiquitination."

"?Ubp-M may deubiquitinate several critical proteins that are involved in the condensation of mitotic chromosomes, mainly on ubiquitinated proteins of the chromatin such as histones H2A and H2B?"
USP15 binds H2BC21.
2 |
2 |

No evidence text available

No evidence text available
USP15 affects DEK
| 3 1
USP15 deubiquitinates DEK.
| 2
USP15 leads to the deubiquitination of DEK. 2 / 2
| 2

reach
"USP15 knockdown increased DEK polyubiquitination and canceled the effect of KIF15 overexpression on reducing DEK polyubiquitination."

reach
"USP15 overexpression reduced DEK polyubiquitination."
USP15 binds DEK.
| 1
USP15 binds KIF15 and DEK. 1 / 1
| 1

sparser
"USP15 physically interacted with both DEK and KIF15 in the cells."
USP15 activates DEK.
| 1
USP15 activates DEK. 1 / 1
| 1

reach
"USP15 overexpression enhanced DEK stability, the effect of which was impaired by KIF15 knockdown."
USP15 affects ACVR1
1 | 2
1 | 2

reach
"Under these conditions, the association between USP15 and ALK2 appeared to be the strongest (XREF_FIG a)."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."

No evidence text available
USP11 affects USP15
| 1 3
USP11 binds USP15.
| 3
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal &quot;domain present in ubiquitin specific proteases&quot; (DUSP) and &quot;ubiquitin-like&quot; (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
USP11 activates USP15.
| 1
USP11 activates USP15. 1 / 1
| 1

reach
"We also confirmed that USP11 RNAi did not target USP15 and vice versa, confirming that the observed effects of USP11 on the TGFbeta pathway are likely to be due to USP11 (see the electronic supplementary material, figure S4)."
SYVN1 affects USP15
| 1 3
| 1 3

sparser
"USP15 interacts with Hrd1, an E3 ligase, in microphages to regulate IkBα degradation and pro-inflammatory cytokine production in the TLR4-mediated signalling pathway [ xref ]."

sparser
"Hrd1 interacts directly with the deubiquitinating enzyme Usp15."

reach
"Hrd1 interacts directly with the deubiquitinating enzyme Usp15."

sparser
"SYVN1 directly interacts with the deubiquitinating enzyme Usp15."
SMAD2_3 affects USP15
| 4
| 4

sparser
"Finally, we provide evidence that this type of control might operate more widely by showing that interactions between USP15 with SMAD2/3 ( xref ) are subject to USP15 auto-regulation."

sparser
"Similar to USP4, the interactions between USP15 and its protein target, SMAD2/3 [ xref ], are governed via USP15 self-regulation, while catalytically inactive USP15 lacks the ability to bind to SMAD2/3 protein [ xref ]."

sparser
"Studies have shown that the substrate SMAD2/3 can interact with WT USP15, and not with a catalytically dead USP15 mutant, implying that there may be an auto-deubiquitination-dependent interaction as well ( xref ; xref )."

sparser
"In light of our USP4 findings, we tested whether catalytically dead USP15 was still able to interact with one of its established substrates, SMAD2/3 ( xref ), and if this interaction was influenced by C451A mutagenesis."
SMAD affects USP15
| 4
| 3

sparser
"Despite reports that USP15 interacts with SMADs 2 and 3 [ xref , xref ], we failed to detect USP15 interacting with any of the SMAD proteins (see the electronic supplementary material, figure S2)."

sparser
"A previous study has shown that USP15 interacts with receptor-phosphorylated SMAD proteins (R-SMADs) and deubiquitinates transforming growth factor-β (TGF-β) receptor 1 (TBR1), thereby promoting protein stability ( xref )."

sparser
"To detect interactions between USP15 and FLAG-tagged SMADs, endogenous USP15 was immunoprecipitated from HEK293 cell extracts transfected with either empty vector control or FLAG-tagged SMADs 1, 3, 4, 6 and 7 ( xref b )."

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
RELA affects USP15
| 4
RELA increases the amount of USP15.
| 2
RELA increases the amount of USP15. 2 / 2
| 2

reach
"NF-kappaBp65 positively regulated USP15 expression, whereas USP15 overexpression promoted NF-kappaBp65 expression through deubiquitination of NF-kappaBp65 in MM cells."

reach
"USP15 overexpression promoted NF-kappaBp65 expression through inhibition of its ubiquitination, whereas NF-kappaBp65 promoted USP15 expression as a positive regulator."
RELA activates USP15.
| 2
RELA activates USP15. 2 / 2
| 2

reach
"Whereas PDTC treatment significantly decreased the luciferase Firefly and Renilla ratio, LPS treatment significantly increased that ratio when compared to untreated cells, suggesting that NF-kappaBp65 enhances the promoter activity of USP15."

reach
"Conversely, NF-kappaBp65 also enhanced the promoter activity of USP15 and its protein expression."
NRF1 affects USP15
| 4
| 4

sparser
"In contrast, USP15 physically interacts with Nrf1 and also stabilizes Nrf1 by removing its ubiquitin moieties, such that this transcription factor is activated to promote the expression of Nrf1-target proteasomal genes [ xref ]."

sparser
"Consistently, 3 × Flag-Nrf1 was coprecipitated with V5-USP15, indicating that USP15 physically interacts with Nrf1 in cells."

sparser
"Nevertheless, the coexpression of 3 × Flag-Nrf1 caused the nuclear translocation of V5-USP15, implying a physical interaction between USP15 and Nrf1 in cells (top panels)."

sparser
"USP15 physically interacts with Nrf1, and it markedly stabilizes Nrf1 by removing its ubiquitin moieties."

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132 (XREF_FIG), indicating that the proteosomal degradation pathway plays a key role in USP15- mediated degradation of Gag protein."

reach
"In corroboration, the observed degradation of p24 by USP15 was thoroughly abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway acts on the[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"However, the observed degradation of p24 by USP15 was effectively abrogated, when the transfected cells were treated with MG132, indicating that the proteosomal degradation pathway plays a key role in[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"To test if the effect of USP15 on HBx expression is proteasome dependent, Huh7 cells were co-transfected with pHBx-FLAG and pUSP15-myc or USP15 targeting siRNA then treated with the proteasome inhibitor MG132."
MAX affects USP15
4 |
MAX decreases the amount of USP15. 4 / 4
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
ACVR1 affects USP15
1 | 2
1 | 2

reach
"Under these conditions, the association between USP15 and ALK2 appeared to be the strongest (XREF_FIG a)."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."

No evidence text available
XDH affects USP15
| 1 2
| 1 2

reach
"Mechanistically, XOR physically interacts with USP15, thereby promoting deubiquitination of Kelch Like ECH Associated Protein 1 (KEAP1) to stabilize its expression, which leads to degradation of Nrf2 via ubiquitination and subsequently reactive oxygen species (ROS) accumulation in liver CSCs."

sparser
"Mechanistically, XOR physically interacts with USP15, thereby promoting deubiquitination of Kelch Like ECH Associated Protein 1 (KEAP1) to stabilize its expression, which leads to degradation of Nrf2 via ubiquitination and subsequently reactive oxygen species (ROS) accumulation in liver CSCs."

sparser
"USP15 physically interacts with XOR and stabilizes Kelch-like ECH, which is attributed to ROS accumulation in hepatocellular carcinoma [ xref ]."
USP4 affects USP11
| 3
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal &quot;domain present in ubiquitin specific proteases&quot; (DUSP) and &quot;ubiquitin-like&quot; (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
USP4 affects BRAP
| 3
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
USP15 affects p53-R175H
| 3
USP15 decreases the amount of p53-R175H.
| 2
USP15 decreases the amount of p53-R175H. 2 / 2
| 2

reach
"Interestingly, knockdown of USP15 in both TYK-Nu and TOV112D cells caused p53-R175H levels to decrease."

reach
"These results are consistent with our previous observations that the effect of MCB-613 on p53-R175H is post-translational, and that depletion of USP15 causes decreases in p53-R175H levels in TYK-Nu cells, but not p53-R273H in OVCA420 cells."
USP15 binds p53-R175H.
| 1
USP15 binds p53-R175H. 1 / 1
| 1

reach
"Next, we performed p53 immunoprecipitation, from the p53 R175H mutant expressing TYK-Nu cells, to determine whether p53-R175H interacted with USP15."
USP15 affects interaction RIG-I IPS-1 DUB activity-independent manner
| 3
USP15 inhibits interaction RIG-I IPS-1 DUB activity-independent manner. 3 / 3
| 3

eidos
"These results suggest that USP15 sequesters the interaction between RIG-I and IPS-1 in a DUB activity-independent manner by acting as a competitor of IPS-1 for RIG-I binding , resulting in the inhibition of both IPS-1 activation and subsequent type I IFN production ."

eidos
"USP15 sequesters the interaction between RIG-I and IPS-1 in a DUB activity-independent manner ."

eidos
"Scientific RepoRts | 5:11220 | DOi : 10.1038 / srep11220 USP15 sequesters the interaction between RIG-I and IPS-1 in a DUB activity-independent manner ."
USP15 affects degradation
| 3
USP15 inhibits degradation. 3 / 3
| 3

sparser
"For TAB3, USP15 inhibited NBR1-mediated selective autophagic TAB3 degradation independent of its deubiquitinating activity."

sparser
"The linear ubiquitin ligase assembly complex (LUBAC) was shown to inhibit IFN-responses by targeting TRIM25 for proteasomal degradation [ xref ], which is inhibited by the cellular ubiquitin deconjugase USP15 [ xref ]."

sparser
"USP15 inhibited the degradation of HPV16 E6 in dose-dependent manner."
USP15 affects cell growth
| 2 1
USP15 inhibits cell growth.
| 1 1
| 1 1

sparser
"Silencing USP15 inhibited MM cell growth both in vitro and in vivo."

reach
"Ubiquitin Specific Peptidase 15 (USP15) suppresses glioblastoma cell growth via stabilization of HECTD1 E3 ligase attenuating WNT pathway activity."
USP15 activates cell growth.
| 1
| 1

reach
"Silencing USP15 inhibited MM cell growth both in vitro and in vivo."
USP15 affects XDH
| 1 2
| 1 2

reach
"Mechanistically, XOR physically interacts with USP15, thereby promoting deubiquitination of Kelch Like ECH Associated Protein 1 (KEAP1) to stabilize its expression, which leads to degradation of Nrf2 via ubiquitination and subsequently reactive oxygen species (ROS) accumulation in liver CSCs."

sparser
"Mechanistically, XOR physically interacts with USP15, thereby promoting deubiquitination of Kelch Like ECH Associated Protein 1 (KEAP1) to stabilize its expression, which leads to degradation of Nrf2 via ubiquitination and subsequently reactive oxygen species (ROS) accumulation in liver CSCs."

sparser
"USP15 physically interacts with XOR and stabilizes Kelch-like ECH, which is attributed to ROS accumulation in hepatocellular carcinoma [ xref ]."
USP15 affects USP11
| 3
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal &quot;domain present in ubiquitin specific proteases&quot; (DUSP) and &quot;ubiquitin-like&quot; (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
USP15 affects SQSTM1
1 | 2
USP15 deubiquitinates SQSTM1. 3 / 3
1 | 2

No evidence text available

reach
"At one point, endosomes leave the cloud, which involves the deubiquitination of SQSTM1 and p62 by the deubiquitinating enzyme USP15, and start their fast bidirectional microtubule based journey in the periphery along microtubules and finally the cortical actin cytoskeleton before reaching the cell surface."

reach
"At one point, endosomes leave the cloud, which involves the deubiquitination of SQSTM1 and p62 by the deubiquitinating enzyme USP15, and start their fast bidirectional microtubule based journey in the periphery along microtubules and finally the cortical actin cytoskeleton before reaching the cell surface."
USP15 affects SGCG
| 3
USP15 inhibits SGCG. 3 / 3
| 3

reach
"We will discuss the DUBs that influence the pathways of interferons (IFN), tumor necrosis factors (TNF), TNF-related apoptosis-inducing ligand (TRAIL), interleukins (IL) and chemokines.In a study using HEK293 T cells and Sendai virus (SeV), knockdown of the gene transcribing USP15 resulted in upregulation of type I IFN, while overexpression of USP15 decreased type I interferon as USP15 showed dose-dependent inhibition of IFN-β [16]."

reach
"Reminding us USP15 may antagonize type I IFN induction independently of catalytic activity."

reach
"We will discuss them one by one.In a study using HEK293 T cells and Sendai virus (SeV), knockdown of the gene transcribing USP15 resulted in upregulation of type I IFN, while overexpression of USP15 decreased type I interferon as USP15 showed dose-dependent inhibition of IFN-β [16] ."
USP15 affects RNF40
2 | 1
2 | 1

No evidence text available

No evidence text available

reach
"In the nucleus, Usp15 indirectly associates with the ubH2B E3 ligase, RNF20 and RNF40, and directly associates with a component of the splicing machinery, SART3 (also known as TIP110 or p110)."
USP15 affects RI
| 3
USP15 activates RI.
| 2
USP15 activates RI. 2 / 2
| 2

reach
"The authors hypothesized that USP15 was up-regulated and enhanced the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TGF-β receptor I (TβRI) in vitro."

reach
"Most of the alternative splicing events were downregulated, while the RI event was upregulated by USP15 and USP4, consistent with our previous finding that the depletion of USP15 and USP4 results in the intron retention of genes such as Bub1 and α-tubulin [1]."
USP15 deubiquitinates RI.
| 1
USP15 deubiquitinates RI. 1 / 1
| 1

reach
"Co-immunoprecipitation and ubiquitination assays revealed that USP15 interacted with TβRI and deubiquitinated TβRI."
| 3

eidos
"Ubiquitin-specific peptidase 15 ( USP15 ) , an important member of deubiquitinating enzymes ( DUBs ) , removes ubiquitin chains from target proteins and promotes protein stability ( Villeneuve et al ., 2013 ) ."

eidos
"USP15 , an important DUB , removes ubiquitin chains from target proteins and promotes protein stability ( Padmanabhan et al ., 2018 ) ."

eidos
"A previous study has shown that USP15 interacts with receptor-phosphorylated SMAD proteins ( R-SMADs ) and deubiquitinates transforming growth factor-beta ( TGF-beta ) receptor 1 ( TBR1 ) , thereby promoting protein stability ( Inui et al ., 2011 ) ."
USP15 affects PSMD7
2 | 1
2 | 1

reach
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [XREF_BIBR]."

No evidence text available

No evidence text available
USP15 affects PARP1
| 1 2
| 1 2

reach
"Here, we demonstrated that the deubiquitinase USP15 interacts with and deubiquitinates PARP1 to promote its stability, thereby stimulating DNA repair, genomic stability and TNBC cell proliferation."

sparser
"Two PARP1 mutations found in individuals with breast cancer (E90K and S104R) enhanced the PARP1-USP15 interaction and suppressed PARP1 ubiquitination, thereby elevating the protein level of PARP1."

sparser
"ER bound to the USP15 promoter to suppress its expression, PR suppressed the deubiquitinase activity of USP15, and HER2 abrogated the PARP1-USP15 interaction."
USP15 affects MDC1
| 1 2
| 1 1

reach
"Mechanistically, USP15 colocalized with MDC1 upon DNA damage and depletion of MDC1 impaired USP15 recruitment to DSBs."

sparser
"More importantly, USP15 was associated with MDC1 and this interaction was increased after DNA damage (Fig.  xref )."
USP15 binds MDC1 and FHA. 1 / 1
| 1

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."
USP15 affects ISRE
| 3
USP15 inhibits ISRE. 2 / 2
| 2

reach
"(c–e) USP15 inhibited SEV-induced activation of ISRE and the NF-κB and IRF3 promoters."

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities (Supplementary Fig. S3)."
USP15-C269A inhibits ISRE. 1 / 1
| 1

reach
"The catalytic mutants USP15-C269A and -H862A, especially USP15-H862A, still dose-dependently inhibited the IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities."
USP15 affects Flag
| 3
| 3

sparser
"Flag-USP15 significantly reduced p66Shc ubiquitin conjugation (Fig. xref )."

sparser
"This indicated that either the upregulation of USP15 and p66Shc, or their increased interaction or both contribute to liver I/R. Furthermore, Myc-p66Shc and Flag-USP15 plasmids were co-transfected to HEK293 cells in order to verify the physical association between USP15 and p66Shc."

sparser
"HA-Ub, Myc-p66Shc, and Flag-USP15 plasmids were co-transfected to HEK-293 cells."
| 1 2
| 1 1

reach
"USP15 binds to the SMAD7–SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

sparser
"For example, the binding of USP15 to the SMAD7-specific E3 ubiquitin ligase 2 (SMURF2) complex results in the deubiquitination and stabilization of TGF-β receptor 1 (TβRI) and promotes TGF-β activity."

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
USP15 affects DUSP
| 3
| 2

sparser
"D (orange and yellow) complexed with the DUSP domain of USP15 (blue) (PDB entry 6DJ9). (b) USP8 (blue) in complex with the inhibitor UbV."

sparser
"The DUSP domain of USP15 is formed from approximately 120 amino acid residues, with a defined α1-β1-α2-β2-α3-β3 secondary structure."
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
USP15 affects COPS5
1 | 2
1 | 2

reach
"A distinct cross-talk between NF-kappaB pathway and CSN-signalosome was then confirmed by the fact that Jab1 and COPS5 controls NF-kB activity through CSN associated deubiquitinase USP15, which causes deubiquitination of IkappaBalpha, a negative feedback between degradation of IkappaBalpha and activation of NF-kappaB."

reach
"This is, for example, the case for CSN5, which, in addition to its own isopeptidase activity, is associated with USP15, both being required for proper processing of polyubiquitinated substrates bound to p97 and VCP XREF_BIBR - XREF_BIBR."

No evidence text available
USP15 affects CD4
| 3
USP15 activates CD4. 3 / 3
| 3

reach
"USP15 deficiency promotes the activation of naive CD4 + T cells and their subsequent differentiation into the IFN-gamma-producing Th1 cells."

reach
"However, the USP15 deficiency promoted the TCR+CD 28 stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma (IFN-gamma), in naive CD4 + T cells, as assessed by quantitative real-time RT-PCR (qRT-PCR) (XREF_FIG), intracellular cytokine staining (XREF_FIG) and ELISA (XREF_FIG)."

reach
"found that USP15 was abundantly expressed in immune cells, and the USP15 deficiency promoted the TCR + CD28 - stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma in naive CD4 + T cells."
USP11 affects USP4
| 3
USP11 binds USP15 and USP4. 3 / 3
| 3

sparser
"USP4 can form stable homodimers and can also interact with USP11 and USP15 ( Fig. 4 )."

sparser
"USP15 forms a subfamily with USP4 and USP11 related through a shared presence of N-terminal &quot;domain present in ubiquitin specific proteases&quot; (DUSP) and &quot;ubiquitin-like&quot; (UBL) domains (DU subfamily)."

sparser
"Human deubiquitinase Usp15 forms a small subfamily with its close relatives Usp11 and Usp4, which all share a common domain architecture."
TUT1 affects USP15
1 | 2
1 | 2

No evidence text available

sparser
"These findings provide a possibility that disturbance of the USP15-TUT1 cascade may induce chronic and mild ER stress, leading to an acceleration of neurodegenerative phenotype."

sparser
"Moreover, inhibition of the USP15-TUT1 cascade triggered mild and chronic endoplasmic reticulum (ER) stress."
TGFBR affects USP15
| 3
| 3

reach
"USP15 binds to the SMAD7-SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

reach
"USP15 binds to the SMAD7-SMAD specific E3 ubiquitin protein ligase 2 (SMURF2) complex and deubiquitinates and stabilizes type I TGF-beta receptor (TbetaR-I), leading to an enhanced TGF-beta signal."

reach
"Furthermore, co-immunoprecipitation (Co-IP) demonstrated that USP15 could interact with TGF-beta receptor I (TBR1) and promote its deubiquitination, thereby maintaining TGF-beta signalling pathway activity by enhancing TBR1 stability."
SMAD2 affects USP15
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
RNF40 affects USP15
2 | 1
2 | 1

No evidence text available

No evidence text available

reach
"In the nucleus, Usp15 indirectly associates with the ubH2B E3 ligase, RNF20 and RNF40, and directly associates with a component of the splicing machinery, SART3 (also known as TIP110 or p110)."
PSMD7 affects USP15
2 | 1
2 | 1

reach
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [XREF_BIBR]."

No evidence text available

No evidence text available
PLOD2 affects USP15
1 | 1 1
PLOD2 binds USP15.
1 | 1
1 | 1

sparser
"In addition, PLOD2 interacted with USP15 by stabilizing it in the cytoplasm and then activated the phosphorylation of AKT/mTOR, thereby promoting CRC progression."

No evidence text available
PLOD2 activates USP15.
| 1
PLOD2 activates USP15. 1 / 1
| 1

reach
"PLOD2 promotes colorectal cancer progression by stabilizing USP15 to activate the AKT/mTOR signaling pathway."
PARP1 affects USP15
| 1 2
| 1 2

reach
"Here, we demonstrated that the deubiquitinase USP15 interacts with and deubiquitinates PARP1 to promote its stability, thereby stimulating DNA repair, genomic stability and TNBC cell proliferation."

sparser
"Two PARP1 mutations found in individuals with breast cancer (E90K and S104R) enhanced the PARP1-USP15 interaction and suppressed PARP1 ubiquitination, thereby elevating the protein level of PARP1."

sparser
"ER bound to the USP15 promoter to suppress its expression, PR suppressed the deubiquitinase activity of USP15, and HER2 abrogated the PARP1-USP15 interaction."
NFKBIA affects USP15
| 2
| 2

sparser
"However, Sun et al. found no interaction between USP15 and IκBα, and proposed that USP11 inhibits the ubiquitination and degradation of IκBα in the early stage, whereas USP15 functions at a later time point in the TNFα-induced NF-κB activation50."

sparser
"In contrary, another study found no interaction between USP15 and IκBα, and it was proposed that USP11 inhibits the ubiquitination and degradation of IκBα in the early stage while USP15 functions at a later time point in the TNFα-induced NF-κB activation xref ."
MDC1 affects USP15
| 1 2
| 1 1

reach
"Mechanistically, USP15 colocalized with MDC1 upon DNA damage and depletion of MDC1 impaired USP15 recruitment to DSBs."

sparser
"More importantly, USP15 was associated with MDC1 and this interaction was increased after DNA damage (Fig.  xref )."
USP15 binds MDC1 and FHA. 1 / 1
| 1

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."
IRS2 affects USP15
2 |
2 |

No evidence text available

No evidence text available
Flag affects USP15
| 3
| 3

sparser
"Flag-USP15 significantly reduced p66Shc ubiquitin conjugation (Fig. xref )."

sparser
"This indicated that either the upregulation of USP15 and p66Shc, or their increased interaction or both contribute to liver I/R. Furthermore, Myc-p66Shc and Flag-USP15 plasmids were co-transfected to HEK293 cells in order to verify the physical association between USP15 and p66Shc."

sparser
"HA-Ub, Myc-p66Shc, and Flag-USP15 plasmids were co-transfected to HEK-293 cells."
| 1 2
| 1 1

reach
"USP15 binds to the SMAD7–SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

sparser
"For example, the binding of USP15 to the SMAD7-specific E3 ubiquitin ligase 2 (SMURF2) complex results in the deubiquitination and stabilization of TGF-β receptor 1 (TβRI) and promotes TGF-β activity."

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
DUSP affects USP15
| 3
| 2

sparser
"D (orange and yellow) complexed with the DUSP domain of USP15 (blue) (PDB entry 6DJ9). (b) USP8 (blue) in complex with the inhibitor UbV."

sparser
"The DUSP domain of USP15 is formed from approximately 120 amino acid residues, with a defined α1-β1-α2-β2-α3-β3 secondary structure."
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
CTNNB1 affects USP15
2 | 1
2 | 1

reach
"Both USP15 and USP47 form a complex with beta-catenin leading to its deubiquitination and stabilization [248,249]."

No evidence text available

No evidence text available
COPS5 affects USP15
1 | 2
1 | 2

reach
"A distinct cross-talk between NF-kappaB pathway and CSN-signalosome was then confirmed by the fact that Jab1 and COPS5 controls NF-kB activity through CSN associated deubiquitinase USP15, which causes deubiquitination of IkappaBalpha, a negative feedback between degradation of IkappaBalpha and activation of NF-kappaB."

reach
"This is, for example, the case for CSN5, which, in addition to its own isopeptidase activity, is associated with USP15, both being required for proper processing of polyubiquitinated substrates bound to p97 and VCP XREF_BIBR - XREF_BIBR."

No evidence text available
CK2 affects USP15
| 2 1
CK2 phosphorylates USP15. 3 / 3
| 2 1

sparser
"In this context, USP15 also is phosphorylated by CSN-associated CK2 [ xref ]."

reach
"Because USP15 is phosphorylated by the CSN and by recombinant CK2, the impact of curcumin on the deubiquitinating activity of the CSN and USP15 was tested."

reach
"In this context, USP15 also is phosphorylated by CSN-associated CK2 [61]."
BRAP affects USP4
| 3
USP15 binds USP4 and BRAP. 3 / 3
| 3

sparser
"We turned to expression of epitope-tagged proteins to confirm the interactions of USP4 and USP15 with BRAP in the context of a mammalian cell system."

sparser
"This reinforces the notion that although both USP4 and USP15 can interact with BRAP under certain experimental conditions, the USP15:BRAP rather than USP4:BRAP interaction may be of most relevance within a physiological setting."

sparser
"In summary, USP4 and USP15 interact with the coiled-coil domain of BRAP through their N-terminal regions, requiring a combination of DUSP and UBL domains ( xref C )."
APC affects USP15
| 3
| 3

reach
"Thus, the CSN controls the Wnt and beta-catenin signalling by assisting the assembly of beta-catenin-degrading supercomplexes by deneddylation and, simultaneously, by stabilising APC via CSN associated USP15."

reach
"CSN controls Wnt and beta-catenin signaling by assisting with the assembly of beta-catenin-degrading supercomplexes by deneddylation and, simultaneously, by stabilizing APC via CSN associated USP15."

reach
"A model is provided that proposes a role of CSN mediated deneddylation in the formation of the beta-catenin-degrading supercomplex and the protection of complex bound APC via CSN associated USP15."
YneF affects USP15
| 2
Modified yneF decreases the amount of USP15. 2 / 2
| 2

reach
"Paralleling the pHNef expression (lane 2, Fig. 2 C), transfection of pYNef expressing R-tropic nef (YU2 strain) of HIV-1 reduced the amount of USP15 (lane 3, Fig. 2 C), establishing that the observed [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Paralleling the pHNef expression (lane 2, XREF_FIG), transfection of pYNef expressing R-tropic nef (YU2 strain) of HIV-1 reduced the amount of USP15 (lane 3, XREF_FIG), establishing that the observed decreases of USP15 were not just strain specific but were common to different strains of HIV-1 Nef."
SiUSP15-1 affects USP15
| 2
SiUSP15-1 decreases the amount of USP15. 2 / 2
| 2

reach
"As shown in XREF_FIG, siUSP15-1 was found to have a higher efficiency to block USP15 transcription, and the protein level of USP15 was inhibited by siUSP15-1 confirmed through immunoblotting."

reach
"As shown in Fig. 1a, siUSP15-1 was found to have a higher efficiency to block USP15 transcription, and the protein level of USP15 was inhibited by siUSP15-1 confirmed through immunoblotting."
SiUSP15#2 affects USP15
| 2
SiUSP15#2 decreases the amount of USP15. 2 / 2
| 2

reach
"XREF_FIG, siUSP15 # 1 and siUSP15 # 2 transfection in RPMI 8226 cells significantly reduced USP15 protein expression by 61.7% and 66.9% compared to siNC, respectively."

reach
"siUSP15 # 1 and siUSP15 # 2 transfection in U266 cells significantly reduced USP15 protein expression by 55.2% and 72.2% compared to siNC, respectively."
SiUSP15#1 affects USP15
| 2
SiUSP15#1 decreases the amount of USP15. 2 / 2
| 2

reach
"XREF_FIG, siUSP15 # 1 and siUSP15 # 2 transfection in RPMI 8226 cells significantly reduced USP15 protein expression by 61.7% and 66.9% compared to siNC, respectively."

reach
"siUSP15 # 1 and siUSP15 # 2 transfection in U266 cells significantly reduced USP15 protein expression by 55.2% and 72.2% compared to siNC, respectively."

sparser
"However, we were not able to detect an interaction between USP15 and R-SMADs and, consistent with this, depletion or overexpression of USP15 from human and mouse cells as well as Xenopus embryos did not cause significant changes in the levels of endogenous SMAD1."

sparser
"Mechanistically, Usp15 interacts with R-Smads of the TGF–β (i.e. Smad2/3) and BMP (i.e. Smad1/5/8) branches and opposes their ubiquitylation."
Phenylmercury acetate increases the amount of USP15. 2 / 2
2 |

No evidence text available

No evidence text available
Foci affects USP15
| 2
USP15 binds foci. 2 / 2
| 2

sparser
"WT MDC1 could restore USP15 foci formation, while both deletion mutants could not (Fig.  xref )."

sparser
"Of note, MDC1 BRCT domain is essential for itself recruitment to DSBs xref , xref , which explains why BRCT deletion mutant could not restore USP15 foci formation."
2 |
Cobalt dichloride increases the amount of USP15. 2 / 2
2 |

No evidence text available

No evidence text available
| 2

reach
"Remarkably, the band intensity of p24 by USP15 was visibly weaker, when the cells were treated with Bafilomycin A1 (compare p24 intensity in XREF_FIG with A), indicating that endosomal degradation inhibitor actually accelerated p24 degradation by unknown mechanism."

reach
"Remarkably, the band intensity of p24 by USP15 was visibly weaker, when the cells were treated with Bafilomycin A1 (compare p24 intensity in Fig. 8 C with A), indicating that endosomal degradation inh[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
Associated deubiquitinating enzyme Ubp12p affects USP15
| 2
Associated deubiquitinating enzyme Ubp12p deubiquitinates USP15. 2 / 2
| 2

reach
"The CSN associated deubiquitinating enzyme Ubp12p and USP15 has been shown to also contribute to the CSN dependent protective effect [13,14]."

reach
"Indeed, the CSN associated deubiquitinating enzyme Ubp12p and USP15 has been shown to play an important role in reversing autoubiquitination and degradation of cullin based E3 ligase subunits [13,14]."
Acrylamide affects USP15
2 |
Acrylamide increases the amount of USP15.
1 |
Acrylamide increases the amount of USP15. 1 / 1
1 |

No evidence text available
Acrylamide decreases the amount of USP15.
1 |
Acrylamide decreases the amount of USP15. 1 / 1
1 |

No evidence text available
YAP1 affects USP15
1 | 1
1 | 1

sparser
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."

No evidence text available
USP21 affects USP15
2 |
2 |

No evidence text available

No evidence text available
USP15 affects tumor immunity
| 2
USP15 inhibits tumor immunity. 2 / 2
| 2

eidos
"USP15 suppresses tumor immunity via deubiquitylation and inactivation of TET2 ."

eidos
"USP15 suppresses tumor immunity via deubiquitylation and inactivation of TET2 USP15 deubiquitinase inactivates TET2 to suppress tumor immunity and is a potential therapeutic target of immunotherapy ."
| PMC
USP15 affects sev
| 2
USP15 inhibits sev. 2 / 2
| 2

reach
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-β (Supplementary Fig. S5)."

reach
"We found both USP15-HA and USP15-Myc dose-dependently inhibited the SEV- and RIG-I-N-induced activation of IFN-beta."
USP15 affects removal K1299-linked monoubiquitin
| 2
USP15 activates removal K1299-linked monoubiquitin. 2 / 2
| 2

eidos
"USP15 catalyzes the removal of K1299-linked monoubiquitin and negatively regulates TET2 activity ."
| PMC

eidos
"USP15 catalyzes the removal of K1299-linked monoubiquitin and negatively regulates TET2 activity ."

sparser
"However, we were not able to detect an interaction between USP15 and R-SMADs and, consistent with this, depletion or overexpression of USP15 from human and mouse cells as well as Xenopus embryos did not cause significant changes in the levels of endogenous SMAD1."

sparser
"Mechanistically, Usp15 interacts with R-Smads of the TGF–β (i.e. Smad2/3) and BMP (i.e. Smad1/5/8) branches and opposes their ubiquitylation."
| 2

reach
"Moreover, we report that USP15 is weakly inhibited by the antineoplastic agent mitoxantrone in vitro A USP15 and mitoxantrone complex structure disclosed that the anthracenedione interacts with the S1 ' binding site."

reach
"Crystal structure analysis by Ward et al. highlighted minute differences between the paralogs and noted that mitoxantrone binds and partially inhibits USP15, similar to USP11."
USP15 affects mitochondrial ubiquitination
| 1
USP15 inhibits mitochondrial ubiquitination. 1 / 2
| 1

eidos
"Knockdown of USP15 enhances Parkin-mediated mitochondrial ubiquitination ."
USP15 affects interaction
| 2
USP15 inhibits interaction. 2 / 2
| 2

eidos
"( f ) USP15 sequestered the interaction between RIG-I and IPS-1 ."

eidos
"Although we cannot rule out the possibility that USP15 exerts its effects in a third uncharacterized manner , the data in this study demonstrate that USP15 sequesters the interaction between RIG-I and IPS-1 , shedding light on the mechanisms underlying the catalytic-activity-independent antagonism of IFN by USP15 ."
USP15 affects foci
| 2
USP15 binds foci. 2 / 2
| 2

sparser
"WT MDC1 could restore USP15 foci formation, while both deletion mutants could not (Fig.  xref )."

sparser
"Of note, MDC1 BRCT domain is essential for itself recruitment to DSBs xref , xref , which explains why BRCT deletion mutant could not restore USP15 foci formation."
USP15 affects fbxw1
| 1 1
USP15 inhibits fbxw1.
| 1
USP15 inhibits fbxw1. 1 / 1
| 1

reach
"Therefore, USP15 does not antagonize betaTrCP at mitosis."
USP15 binds fbxw1.
| 1
| 1

sparser
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP/p97, and β-Trcp in an osteoclast line and HEK293 cells, respectively ( xref and unpublished data)."
USP15 affects expression
| 2
USP15 inhibits expression. 2 / 2
| 2

sparser
"These results indicate that USP15 may inhibit Nrf2 protein expression and thus, its activity, by increasing Nrf2 protein degradation."

sparser
"Conversely, when the Neh6 domain of Nrf2 is deleted, USP15 is still able to inhibit Nrf2 protein expression ( xref , lanes 7-8)."
USP15 affects cell death
| 2
| 2

reach
"In this report, we found that PdPT is an inhibitor of multiple DUBs including USP7, USP10, USP14, USP15, USP25 and UCHL5, which contributes to the accumulation of ubiquitinated proteins and subsequent cell death in NSCLC cell lines.Regulated cell death requires activation of various regulators and effectors (23)."

reach
"Depletion of USP15 in ovarian cancer cells causes decrease in p53-R175H protein levels and induces cell death in cancer cells expressing this mutant form of p53 [XREF_BIBR]."
USP15 affects autophagy
| 2
| 2

reach
"Taken together, our data demonstrate that USP15 can negatively regulate the TRAF6-BECN1 signaling axis for autophagy induction."

reach
"miR-26a also modifies the activity of the downstream target Usp15, which can inhibit mitochondrial autophagy by activating the PINK1 and PRKN pathway."
| 2

eidos
"USP15 interacts with lipid-accumulating proteins such as FABPs and perilipins to reduce ubiquitination and increase their protein stability ."

eidos
"USP15 inhibits the nuclear export , ubiquitination , and lysosome-mediated degradation of R175H mutp53 independently of MDM2 in ovarian cancer cells ( Padmanabhan et al ., 2018 ) ."
USP15 affects USP21
2 |
2 |

No evidence text available

No evidence text available
USP15 affects Th17 differentiation
| 1
USP15 activates Th17 differentiation. 1 / 2
| 1

eidos
"We previously revealed that USP15 promotes Th17 differentiation through removing a ubiquitin chain conjugated to Lys446 of RORgammat which prevents the recruitment of SRC116 ."
USP15 affects TRIM21
2 |
2 |

No evidence text available

No evidence text available
USP15 affects TNF
| 2
USP15 activates TNF. 2 / 2
| 2

reach
"Collectively, USP15 positively regulates TNFalpha- and IL-1beta-triggered NF-kappaB activation by distinct mechanisms, which reflects the potential nonredundant roles of TAB2 and TAB3."

reach
"Overexpression of USP15 potentiated TNFalpha- or IL-1beta-triggered NF-kappaB activation and downstream genes transcription, whereas knockdown of USP15 had opposite effects."
USP15 affects TGFbeta receptor
| 2
USP15 deubiquitinates TGFbeta receptor. 2 / 2
| 2

reach
"Moreover, Seoane and colleagues reported that the USP15 gene is amplified in breast cancer, ovarian cancer, and glioblastoma, and that USP15 deubiquitinates and stabilizes type I TGFbeta receptor, thereby enhancing TGFbeta signaling and tumor growth [XREF_BIBR] (XREF_FIG)."

reach
"For example, the closely related DUBs USP4, USP11 and USP15 have been reported to modulate TGFbeta signalling by deubiquitylating the type I TGFbeta receptor ALK5 [XREF_BIBR - XREF_BIBR]."
USP15 affects TGFB1
| 1
USP15 activates TGFB1. 1 / 2
| 1

reach
"Three examples of deubiquitinating enzymes for TbetaR-I are ubiquitin specific peptidase-4 (USP4), -11 (USP11) and -15 (USP15), all of which antagonize the effect of SMAD7 and strongly induce TGF-beta1 signalling [XREF_BIBR]."
USP15 affects TGF-beta pathway
| 2
USP15 activates TGF-beta pathway. 2 / 2
| 2

eidos
"USP15 has previously been shown to activate the TGF-beta pathway through deubiquitination of the type I TGF-beta receptor and receptor-activated SMAD proteins ( 26,27 ) ."

eidos
"38 , 39 , 40 , 41 For example , USP15 upregulates the TGF-beta pathway to promote cell proliferation in glioblastoma pathogenesis ."
USP15 affects TET2 binding DNA
| 2
USP15 inhibits TET2 binding DNA. 2 / 2
| 2

eidos
"USP15 inactivates TET2 and impairs TET2 binding to DNA ."
| PMC

eidos
"S3B ) , demonstrating that USP15 impairs TET2 binding to DNA in vitro ."
| PMC
USP15 affects TAB3
| 2
USP15 activates TAB3. 2 / 2
| 2

reach
"For TAB3, USP15 inhibited NBR1 mediated selective autophagic TAB3 degradation independent of its deubiquitinating activity."

reach
"USP15 potentiates NF-kappaB activation by differentially stabilizing TAB2 and TAB3."
USP15 affects STN1
2 |
2 |

No evidence text available

No evidence text available
USP15 affects STK33
2 |
2 |

No evidence text available

No evidence text available
USP15 affects SMAD4
2 |
2 |

No evidence text available

No evidence text available
USP15 affects SEV-induced phosphorylation NF-kappaB subunit p65 IRF3
| 2
USP15 inhibits SEV-induced phosphorylation NF-kappaB subunit p65 IRF3. 2 / 2
| 2

eidos
"( f ) USP15 inhibited SEV-induced phosphorylation of NF-kappaB subunit p65 and IRF3 ."

eidos
"To further confirm the results , SEV-induced phosphorylation of NF-kappaB subunit p65 and IRF3 were enhanced by the knockdown of USP15 ( Fig. 1g ) ."
USP15 affects SEV-induced phosphorylation NF-kappa B subunit p65 IRF3
| 2
USP15 inhibits SEV-induced phosphorylation NF-kappa B subunit p65 IRF3. 2 / 2
| 2

eidos
"To further confirm the results , SEV-induced phosphorylation of NF-kappa B subunit p65 and IRF3 were enhanced by the knockdown of USP15 ( Fig. 1g ) ."

eidos
"( f ) USP15 inhibited SEV-induced phosphorylation of NF-kappa B subunit p65 and IRF3 ."
USP15 affects SEV-induced activation promoter
| 2
USP15 inhibits SEV-induced activation promoter. 2 / 2
| 2

eidos
"( a ) USP15 inhibited the SEV-induced activation of the IFN-beta promoter ."

eidos
"Figure 2 : ( a ) USP15 inhibited the SEV-induced activation of the IFN-beta promoter ."
USP15 affects RNF20
1 | 1
1 | 1

reach
"In the nucleus, Usp15 indirectly associates with the ubH2B E3 ligase, RNF20 and RNF40, and directly associates with a component of the splicing machinery, SART3 (also known as TIP110 or p110)."

No evidence text available
USP15 affects Protease
| 2
| 2

reach
"To investigate Nef role in protein degradation, we seek to identify cellular proteins involved in the UPS mediated protein degradation through association with Nef and found ubiquitin specific protease 15 (USP15) which stabilizes proteins by deubiquitylation and by preventing autoubiquitylation of substrates."

reach
"To investigate Nef role in protein degradation, we seek to identify cellular proteins involved in the UPS mediated protein degradation through association with Nef and found ubiquitin specific proteas[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP15 affects PSMB9
2 |
2 |

No evidence text available

No evidence text available
USP15 affects PRPF4
2 |
2 |

No evidence text available

No evidence text available
USP15 affects PLOD2
1 | 1
1 | 1

sparser
"In addition, PLOD2 interacted with USP15 by stabilizing it in the cytoplasm and then activated the phosphorylation of AKT/mTOR, thereby promoting CRC progression."

No evidence text available
USP15 affects OMM proteins
| 2
USP15 deubiquitinates OMM proteins. 2 / 2
| 2

reach
"Parkin mediated ubiquitination of OMM proteins can be reversed by USP15 and USP30."

reach
"At present, the negative regulatory mechanisms against Parkin-mediated ubiquitination have been reported, with the discovery of several deubiquitinases including USP8, USP15 and USP30 that are able to cause the deubiquitination of Parkin and/or OMM proteins."
USP15 affects NP
| 2
USP15 binds FKBP5 and NP. 2 / 2
| 2

sparser
"Our results demonstrated that there was a stronger interaction between FKBP5 and USP15 in degenerative NP cells (Figure  xref )."

sparser
"Finally, the co‐immunoprecipitation (Co‐IP) assay was performed to determine the interaction between FKBP5 and USP15 in degenerative NP cells."
USP15 affects NFASC
| 2
USP15 inhibits NFASC. 2 / 2
| 2

reach
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63-based chains [55], [56], and USP15 inhibits the NFκB pathway by removing K48-Ub from IκBα, preventing its degradation [57]."

reach
"73 USP15 inhibits the NF‐κB pathway by removing K48‐Ub from IκBα and consequently prevent degradation it."
USP15 affects NCOA1
| 2
USP15 activates NCOA1. 2 / 2
| 2

reach
"He et al. [130] recently reported that deubiquitination of K446 by ubiquitin-specific protease USP15 enhanced the recruitment of steroid receptor coactivator 1 (SRC1), thereby stimulating RORγt activity."

reach
"He et al. [130] recently reported that deubiquitination of K446 by ubiquitin-specific protease USP15 enhanced the recruitment of steroid receptor coactivator 1 (SRC1), thereby stimulating RORγt activity."
USP15 affects MMP9
| 2
USP15 increases the amount of MMP9. 2 / 2
| 2

reach
"Consistently, USP15 shRNA impaired the protein levels of MMP9, N-cadherin, and Vimentin, but recovered E-cadherin expression in GINS1-overexpressing A172 cells, while the USP15 plasmid restored the protein levels of MMP9, N-cadherin, and Vimentin, but attenuated E-cadherin expression in GINS1-silenced U251 cells (Figure 6Q)."

reach
"Biochemical analysis revealed that USP15 knockdown inhibited matrix metalloproteinase (MMP)3 and MMP9 expression."
USP15 affects MEK
| 1
USP15 inhibits MEK. 1 / 2
| 1

reach
"In summary, despite markedly reducing BRAP protein levels, USP15 depletion does not promote but rather inhibits MEK activation in response to EGF."
USP15 affects MAVS
| 1
USP15 inhibits MAVS. 1 / 2
| 1

reach
"During human papillomavirus (HPV) infection, the E6 oncoprotein interacts with TRIM25 and ubiquitin-specific peptidase 15 (USP15), which enhances TRIM25 degradation and subsequently inhibits RLR/MAVS signaling."
USP15 affects LUBAC-dependent TRIM25
| 2
USP15 inhibits LUBAC-dependent TRIM25. 2 / 2
| 2

eidos
"In contrast , USP15 deubiquitylates TRIM25 , preventing the LUBAC-dependent degradation of TRIM25 [ 77 ] ."

eidos
"Ubiquitin specific protease 15 ( USP15 ) prevents LUBAC-dependent degradation of TRIM25 which also promotes RIG-I signaling pathways [ 151 ] ."
| PMC
USP15 affects L-glutamine
| 2
| 2

reach
"Despite increasing aggregation, overexpression of Usp15 did not increase toxicity of the expanded polyglutamine protein."

reach
"However, changes in expression of Usp15 did not modulate toxicity of a model polyglutamine protein in cell culture."
USP15 affects KIF15
| 1 1
USP15 binds KIF15 and DEK. 1 / 1
| 1

sparser
"USP15 physically interacted with both DEK and KIF15 in the cells."
| 1

reach
"USP15 physically interacted with both DEK and KIF15 in the cells."
USP15 affects K63-polyUb
| 2
USP15 deubiquitinates K63-polyUb. 2 / 2
| 2

reach
"Further experiment supported the idea that USP15 deubiquitinates K63-polyUb from RIG-I [XREF_BIBR]."

reach
"Further experiment supported the idea that USP15 deubiquitinates K63-polyUb from RIG-I [16]."
USP15 affects Imatinib resistance cells
| 2
USP15 inhibits Imatinib resistance cells. 2 / 2
| 2

eidos
"Downregulation of USP15 contributes to Imatinib resistance of CML cells Because previously studies have reported that dysregulation of USP15 could result in paclitaxel resistance in HeLa cells [ 9 ] , we wanted to investigate whether USP15 downregulation is associated with CML Imatinib resistance ."

eidos
"Downregulation of USP15 contributes to Imatinib resistance of CML cells ."
USP15 affects ISRE-Luc
| 1 1
USP15 inhibits ISRE-Luc. 2 / 2
| 1 1

eidos
"In addition , USP15 dose-dependently inhibited RIG-I-N-triggered IFN-beta-Luc , ISRE-Luc , NF-kappaB-Luc , and IRF3-Luc reporter activities ( Supplementary Fig. S3 ) ."

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-beta-Luc, ISRE-Luc, NF-kappaB-Luc, and IRF3-Luc reporter activities."
USP15 affects FKBP5
| 2
USP15 binds FKBP5 and NP. 2 / 2
| 2

sparser
"Our results demonstrated that there was a stronger interaction between FKBP5 and USP15 in degenerative NP cells (Figure  xref )."

sparser
"Finally, the co‐immunoprecipitation (Co‐IP) assay was performed to determine the interaction between FKBP5 and USP15 in degenerative NP cells."
USP15 affects EIF4A1 protein stability
| 2
USP15 activates EIF4A1 protein stability. 2 / 2
| 2

eidos
"Furthermore , a weak fluorescent signal of EIF4A1 was observed in the USP15 - / - mice , indicating that USP15 could also promote EIF4A1 protein stability in vivo ( Figure 5E ) ."

eidos
"Moreover , we have observed EIF4A1 protein expression was significantly upregulated ( Figure 5D , 2nd panel ) while the RNA expression of EIF4A1 remain unchanged ( Supplementary Figure S6B ) which demonstrated that USP15 could interact with and deubiquitinate EIF4A1 , thus promoting EIF4A1 protein stability ."
USP15 affects Collagen
| 2
| 2

reach
"USP15 enhances the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TβRI in vitro."

reach
"The authors hypothesized that USP15 was up-regulated and enhanced the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TGF-β receptor I (TβRI) in vitro."

reach
"The authors hypothesized that USP15 was up-regulated and enhanced the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TGF-β receptor I (TβRI) in vitro."

reach
"USP15 enhances the proliferation, migration, invasion, and collagen deposition of hypertrophic scar-derived fibroblasts by deubiquitinating TβRI in vitro."
| 1
| 1

reach
"In conclusion, the results of this study indicate that PRP-Exo-derived USP15 is a key mediator of HaCaT cell survival and migratory activity, with EIF4A1 playing an important role in the process of USP15 induced epithelialization (XREF_FIG)."
USP15 affects CYCS
| 2
USP15 decreases the amount of CYCS. 2 / 2
| 2

reach
"Remarkably, USP15 KD led to significantly reduced cytochrome c release following treatment with STS or TNFα/AcD, in the presence of zVAD (Figures 5D–5F)."

reach
"Moreover, KD of Rab5A, Rab5C and USP15 reduced cytochrome c release, including from BAX+ mitochondria, while Rabex-5 KD impaired both cytochrome c release and mitochondrial BAX accumulation (Figures 7P and 7Q)."
USP15 affects CXCL12
| 2
USP15 increases the amount of CXCL12. 2 / 2
| 2

reach
"Excessive IFN-gamma production in USP15 deficient mice promotes expression of the immunosuppressive molecule PD-L1 and the chemokine CXCL12, causing accumulation of T-bet + regulatory T cells and CD11b + Gr-1 + myeloid derived suppressor cells at tumor site."

reach
"The tumor of the Usp15 -/- chimeric mice had upregulated expression of PD-L1 and CXCL12 (XREF_FIG)."
USP15 affects COPS4
| 2
| 2

sparser
"The function of USP15 has been mainly associated with the COP9 signalosome (CSN)."

sparser
"Indeed, USP15 interactions with the COP9 signalosome are reported to be important for regulation of the NFκB pathway and the canonical WNT pathway [ xref , xref ]."
USP15 affects CDKN1A
| 2
USP15 activates CDKN1A. 2 / 2
| 2

reach
"XREF_BIBR, XREF_BIBR Indeed, when U2OS cells were treated with TGF-beta, the levels of USP15 were increased (XREF_FIG), concomitant with an increase in p53 stability and synthesis of p21."

reach
"USP15 knockdown disrupted p53 stability and p21 synthesis mediated by TGF-beta, indicating that TGF-beta modulated p53 stability through upregulation of USP15 synthesis (XREF_FIG)."
USP15 affects CD274
| 2
USP15 increases the amount of CD274. 2 / 2
| 2

reach
"The tumor of the Usp15 -/- chimeric mice had upregulated expression of PD-L1 and CXCL12 (XREF_FIG)."

reach
"Excessive IFN-gamma production in USP15 deficient mice promotes expression of the immunosuppressive molecule PD-L1 and the chemokine CXCL12, causing accumulation of T-bet + regulatory T cells and CD11b + Gr-1 + myeloid derived suppressor cells at tumor site."

reach
"Together, these results demonstrate that USP15 and RIG-I form a complex through the UCH domain of USP15, and that the N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."

reach
"(d) The N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."
USP15 affects BMPR1B
1 |
1 |

No evidence text available
USP15 affects BMP receptors
| 2
USP15 binds BMP receptors. 2 / 2
| 2

reach
"It was shown that USP15 interacts with type I BMP receptors, including ALK3, co-localises with ALK3 at the membrane and deubiquitylates ALK3, thereby countering the inhibition of the BMP pathway caused by SMAD6 XREF_BIBR."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."

reach
"Additionally, the alteration frequency of USP15 in TCGA-LUAD data showed an increased USP15 expression that contributes to lung adenocarcinoma (LUAD) development."

eidos
"The increased USP15 expression contributes to the lung adenocarcinoma ( LUAD ) development and shows significantly lower disease-specific survival of patients with USP15 alteration ."
TRIM21 affects USP15
2 |
2 |

No evidence text available

No evidence text available
TP53 affects MDM2
| 2
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
TAFAZZIN affects USP15
| 1 1
| 1 1

reach
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."

sparser
"Coimmunoprecipitation assays indicated that USP15 could interact with YAP1, while TAZ bound to USP15 after hypoxia treatment."
STN1 affects USP15
2 |
2 |

No evidence text available

No evidence text available
STK33 affects USP15
2 |
2 |

No evidence text available

No evidence text available
| 1 1
| 1 1

reach
"USP15 binds to the SMAD7–SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

sparser
"For example, the binding of USP15 to the SMAD7-specific E3 ubiquitin ligase 2 (SMURF2) complex results in the deubiquitination and stabilization of TGF-β receptor 1 (TβRI) and promotes TGF-β activity."
SMAD4 affects USP15
2 |
2 |

No evidence text available

No evidence text available
SMAD1 affects USP15
2 |
2 |

No evidence text available

No evidence text available
RNF20 affects USP15
1 | 1
1 | 1

reach
"In the nucleus, Usp15 indirectly associates with the ubH2B E3 ligase, RNF20 and RNF40, and directly associates with a component of the splicing machinery, SART3 (also known as TIP110 or p110)."

No evidence text available
RAF1 affects USP15
| 2
RAF1 increases the amount of USP15. 2 / 2
| 2

reach
"However, we were unable to observe an effect of USP15 depletion on luciferase transcription driven from a previously described CRAF-promoter, although we can not fully exclude that USP15 may regulate CRAF transcription via an upstream or downstream element not contained in this 1.2-kb promoter construct."

reach
"Instead, our data show a marked decrease of CRAF mRNA levels in USP15 depleted cells, suggesting that USP15 may regulate CRAF transcription."
PSMB9 affects USP15
2 |
2 |

No evidence text available

No evidence text available
PRPF4 affects USP15
2 |
2 |

No evidence text available

No evidence text available
PRP-Exos affects USP15
| 2
PRP-Exos activates USP15. 2 / 2
| 2

reach
"PRP-Exos Promotes HaCaT Cell Migration and Proliferation in a USP15 Dependent Manner."

reach
"Western blotting indicated that USP15 levels were highest for HaCaT cells treated with PRP-Exos (XREF_FIG)."
PGR affects USP15
| 1 1
PGR inhibits USP15. 2 / 2
| 1 1

sparser
"Therefore, we selected a broad-spectrum inhibitor, PR619, which currently inhibits USP15, for consideration."

reach
"Loss of the receptors ER, PR and HER2 promotes USP15-dependent stabilization of PARP1 in triple-negative breast cancer."
NP affects USP15
| 2
USP15 binds FKBP5 and NP. 2 / 2
| 2

sparser
"Our results demonstrated that there was a stronger interaction between FKBP5 and USP15 in degenerative NP cells (Figure  xref )."

sparser
"Finally, the co‐immunoprecipitation (Co‐IP) assay was performed to determine the interaction between FKBP5 and USP15 in degenerative NP cells."
MYOD1 affects USP15
2 |
MYOD1 decreases the amount of USP15. 2 / 2
2 |

No evidence text available

No evidence text available
MEIS1 affects USP15
2 |
MEIS1 decreases the amount of USP15. 2 / 2
2 |

No evidence text available

No evidence text available
MDM2 affects TP53, and USP15
| 2
TP53 binds USP15 and MDM2. 2 / 2
| 2

sparser
"Although MDM2 and p53 interact with the different regions of USP15, USP15/p53/MDM2 cannot form a ternary complex."

sparser
"These results suggest that USP15 physically interacts with MDM2 in a p53-independent manner."
KIF15 affects USP15
| 1 1
USP15 binds KIF15 and DEK. 1 / 1
| 1

sparser
"USP15 physically interacted with both DEK and KIF15 in the cells."
| 1

reach
"USP15 physically interacted with both DEK and KIF15 in the cells."
Interferon affects USP15
| 2
| 2

reach
"Together, these results suggest that USP15 is not induced by IFN or viral infection, but instead is recruited to TRIM25 upon viral infection."

reach
"In contrast to these host- or virus encoded DUBs that inhibit RIG-I signaling, our study identifies USP15 as a positive regulator of the TRIM25-RIG-I signaling pathway, which is required for a sustained, IFN mediated antiviral response."
HMBS affects USP15
| 2
HMBS inhibits USP15. 2 / 2
| 2

reach
"These data collectively demonstrate that USP15 and Nef could be degraded by the UPS and that these two proteins are involved in regulating degradation of both viral and cellular proteins.Nef is known [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These data collectively demonstrate that USP15 and Nef could be degraded by the UPS and that these two proteins are involved in regulating degradation of both viral and cellular proteins."
H2BC21 affects USP15
2 |
2 |

No evidence text available

No evidence text available
GATA1 affects USP15
2 |
GATA1 decreases the amount of USP15. 2 / 2
2 |

No evidence text available

No evidence text available
FKBP5 affects USP15
| 2
USP15 binds FKBP5 and NP. 2 / 2
| 2

sparser
"Our results demonstrated that there was a stronger interaction between FKBP5 and USP15 in degenerative NP cells (Figure  xref )."

sparser
"Finally, the co‐immunoprecipitation (Co‐IP) assay was performed to determine the interaction between FKBP5 and USP15 in degenerative NP cells."
E3_Ub_ligase affects SMAD7, and USP15
| 1 1
| 1 1

reach
"USP15 binds to the SMAD7–SMAD-specific E3 ubiquitin protein ligase 2 (SMURF2) complex, and deubiquitylates and stabilizes the type I TGFβ receptor, leading to enhanced TGFβ signalling."

sparser
"For example, the binding of USP15 to the SMAD7-specific E3 ubiquitin ligase 2 (SMURF2) complex results in the deubiquitination and stabilization of TGF-β receptor 1 (TβRI) and promotes TGF-β activity."
COPS4 affects USP15
| 2
| 2

sparser
"The function of USP15 has been mainly associated with the COP9 signalosome (CSN)."

sparser
"Indeed, USP15 interactions with the COP9 signalosome are reported to be important for regulation of the NFκB pathway and the canonical WNT pathway [ xref , xref ]."

reach
"Together, these results demonstrate that USP15 and RIG-I form a complex through the UCH domain of USP15, and that the N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."

reach
"(d) The N-terminal CARD domain and the C-terminal domain of RIG-I both bind to USP15."
BMPR1B affects USP15
1 |
1 |

No evidence text available
BMP receptors affects USP15
| 2
USP15 binds BMP receptors. 2 / 2
| 2

reach
"It was shown that USP15 interacts with type I BMP receptors, including ALK3, co-localises with ALK3 at the membrane and deubiquitylates ALK3, thereby countering the inhibition of the BMP pathway caused by SMAD6 XREF_BIBR."

reach
"Moreover, we show that USP15 interacts with other type I BMP receptors ALK2 and ALK6, as well as TGFbeta receptor ALK5."
PLVX-Puro-USP15 affects USP15
| 1
PLVX-Puro-USP15 increases the amount of USP15. 1 / 1
| 1

reach
"PLVX-Puro-USP15 transfection in RPMI 8226 and U266 cells significantly increased USP15 protein expression by 1.79-fold and 1.28-fold compared to the blank vector, respectively."
P53-R175H affects USP15
| 1
USP15 binds p53-R175H. 1 / 1
| 1

reach
"Next, we performed p53 immunoprecipitation, from the p53 R175H mutant expressing TYK-Nu cells, to determine whether p53-R175H interacted with USP15."
Morphine affects USP15
1 |
Morphine decreases the amount of USP15. 1 / 1
1 |

No evidence text available
Methyl methanesulfonate increases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Methotrexate decreases the amount of USP15. 1 / 1
1 |

No evidence text available
Manganese(II) chloride decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-7853-5p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
Hsa-miR-607 affects USP15
1 |
Hsa-miR-607 decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-520g-3p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-520c-3p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-520b decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-497-5p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-373-3p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-302e decreases the amount of USP15. 1 / 1
1 |

No evidence text available
1 |
Hsa-miR-222-3p decreases the amount of USP15. 1 / 1
1 |

No evidence text available
Fbxw1 affects USP15
| 1
| 1

sparser
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP/p97, and β-Trcp in an osteoclast line and HEK293 cells, respectively ( xref and unpublished data)."
Curcusone D affects USP15
| 1
Curcusone D inhibits USP15. 1 / 1
| 1

eidos
"As a non-selective DUBs inhibitor , curcusone D was shown to inhibit USP5 , USP7 , USP8 , USP13 , USP14 , USP15 , and USP22 , but had no effect on UCHL1 , UCHL3 , and UCHL5 ."
1 |
1 |

No evidence text available
1 |
1 |

No evidence text available
Abrine affects USP15
1 |
Abrine increases the amount of USP15. 1 / 1
1 |

No evidence text available
YP_009227201 affects USP15
1 |
USP15 binds YP_009227201. 1 / 1
1 |

No evidence text available
YOD1 affects USP15
1 |
1 |

No evidence text available
USP7 affects USP4
| 1
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."
USP15 affects α-SMA
| 1
USP15 leads to the ubiquitination of α-SMA. 1 / 1
| 1

reach
"Our results intriguingly showed that USP15 overexpression increased ubiquitination of XIAP and α-SMA, which cannot be directly mediated by USP15."
USP15 affects thrb
| 1
USP15 deubiquitinates thrb. 1 / 1
| 1

reach
"USP15 binds to Smurf2 complex and deubiquitinates and stabilizes TRbeta1, and that apparently leads to boosting of TGF-beta-mediated signaling."
USP15 affects tamoxifen
| 1
| 1

reach
"Meanwhile, USP15 knockdown notably enhanced the antitumor activities of tamoxifen on breast cancer cells."
USP15 affects oncogenic capacity patient-derived glioma-initiating cells owing TGFbeta signalling
| 1
USP15 activates oncogenic capacity patient-derived glioma-initiating cells owing TGFbeta signalling. 1 / 1
| 1

eidos
"Depletion of USP15 reduces the oncogenic capacity of patient-derived glioma-initiating cells owing to diminished TGFbeta signalling , suggesting therapeutic potential for development of USP15 inhibitors ."
USP15 affects lysosome-mediated R175H mutp53
| 1
USP15 inhibits lysosome-mediated R175H mutp53. 1 / 1
| 1

eidos
"USP15 inhibits the nuclear export , ubiquitination , and lysosome-mediated degradation of R175H mutp53 independently of MDM2 in ovarian cancer cells ( Padmanabhan et al ., 2018 ) ."

reach
"USP15 auto-deubiquitination promotes HR."

eidos
"USP15 Represses Hepatocellular Carcinoma Progression by Regulation of Pathways of Cell Proliferation and Cell Migration : A System Biology Analysis ."
USP15 affects global 5hmC
| 1
USP15 inhibits global 5hmC. 1 / 1
| 1

eidos
"Next , we used a more quantitative colorimetric assay to determine the 5hmC in the genome and obtained the same result that depletion of Usp15 increased global 5hmC in a manner that is dependent on Tet2 ( Fig. 3D ) ."
| PMC
USP15 affects functions several proteins involved signaling pathways
| 1
USP15 activates functions several proteins involved signaling pathways. 1 / 1
| 1

eidos
"The functions of several other proteins involved in these signaling pathways may also be mediated by USP15 ."

reach
"Thus, USP15 negatively regulates T cell cytokine production via its DUB function."
USP15 affects cell
| 1
USP15 activates cell. 1 / 1
| 1

eidos
"Human pulmonary artery smooth muscle cells ( hPASMCs ) were exposed to hypoxia to mimic PH in vitro , and USP15 knockdown significantly inhibited cell proliferation , migration , and YAP1 / TAZ signaling in hypoxic hPASMCs ."
USP15 affects cell viability ovarian cancer cells expressing p53-R175H mutant protein
| 1
USP15 activates cell viability ovarian cancer cells expressing p53-R175H mutant protein. 1 / 1
| 1

eidos
"Depletion of USP15 causes decreased cell viability of ovarian cancer cells expressing the p53-R175H mutant protein , suggesting that targeting USP15 in p53-R175H mutant-containing tumors would facilitate the inhibition of oncogenic mutant p53 and enhance cancer immunotherapy [ 81 ] ."
USP15 affects autophagy cargo receptor
| 1
USP15 inhibits autophagy cargo receptor. 1 / 1
| 1

eidos
"On the other hand , USP15 inhibited autophagy cargo receptor 1 ( NBR1 ) - mediated selective autophagic degradation of TAB3 ."
USP15 affects apoptosis degenerative nucleus pulposus cells
| 1
USP15 activates apoptosis degenerative nucleus pulposus cells. 1 / 1
| 1

eidos
"USP15 promotes the apoptosis of degenerative nucleus pulposus cells by suppressing the PI3K / AKT signalling pathway ."
USP15 affects activation NF-kappaB p = 1.92E-04 IRF3 p = 1.04E-03 reporter assays
| 1
USP15 inhibits activation NF-kappaB p = 1.92E-04 IRF3 p = 1.04E-03 reporter assays. 1 / 1
| 1

eidos
"As shown in Fig. 1e and 1f , knockdown of USP15 increased the activation of NF-kappaB ( 5.9 vs 12.9 , p = 1.92E-04 ) and IRF3 ( 15.6 vs 26.5 , p = 1.04E-03 ) through reporter assays ."
USP15 affects aberrant CARD9
| 1
USP15 inhibits aberrant CARD9. 1 / 1
| 1

eidos
"Importantly , we observed that USP15 binds to CARD9 in BMDCs in the absence of stimulation and that this interaction is largely unaffected by Dectin-1 ligand binding , indicating that USP15 constitutively interacts with CARD9 and may act to prevent aberrant CARD9 signaling at steady state ."
USP15 affects YP_009227201
1 |
USP15 binds YP_009227201. 1 / 1
1 |

No evidence text available
USP15 affects YOD1
1 |
1 |

No evidence text available
USP15 affects VDAC1
1 |
USP15 deubiquitinates VDAC1. 1 / 1
1 |
USP15 affects USP4, and USP7
| 1
USP15 binds USP4 and USP7. 1 / 1
| 1

sparser
"For example, USP11 has been found to interact with USP4, USP7 and USP15; and PSMD7 interacts with USP15 and PSMD14 [ xref ]."
USP15 affects USP15 mitophagy depended
| 1
USP15 inhibits USP15 mitophagy depended. 1 / 1
| 1

eidos
"To determine whether the effect of USP15 on mitophagy depended on its enzymatic activity , we generated a catalytically inactive form of USP15 by replacing the active site cysteine residue at position 269 with alanine ( 26,27 ) ."
USP15 affects USP10
1 |
1 |

No evidence text available
USP15 affects UBL
| 1
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
USP15 affects UBE2S
1 |
1 |

No evidence text available
USP15 affects UBE2G2
1 |
1 |

No evidence text available
USP15 affects TRIM17
1 |
1 |

No evidence text available
USP15 affects TET2 binding substrate DNA Monoubiquitylation TET2
| 1
USP15 inhibits TET2 binding substrate DNA Monoubiquitylation TET2. 1 / 1
| 1

eidos
"USP15 inactivates TET2 and inhibits TET2 binding to substrate DNA Monoubiquitylation of TET2 is important for its activity and is required for TET2 binding to chromatin ( 39 ) ."
| PMC
USP15 affects TET binding TET
| 1
USP15 inhibits TET binding TET. 1 / 1
| 1

eidos
"Together , these results demonstrate that USP15 inhibits TET binding to DNA and TET activity in vivo ."
| PMC
USP15 affects TCR+CD28
| 1
USP15 activates TCR+CD28. 1 / 1
| 1

reach
"However, the USP15 deficiency promoted the TCR+CD 28 stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma (IFN-gamma), in naive CD4 + T cells, as assessed by quantitative real-time RT-PCR (qRT-PCR) (XREF_FIG), intracellular cytokine staining (XREF_FIG) and ELISA (XREF_FIG)."
USP15 affects TCR
| 1
USP15 activates TCR. 1 / 1
| 1

reach
"found that USP15 was abundantly expressed in immune cells, and the USP15 deficiency promoted the TCR + CD28 - stimulated production of cytokines, such as interleukin 2 (IL-2) and interferon-gamma in naive CD4 + T cells."
USP15 affects T cell responses
| 1
USP15 inhibits T cell responses. 1 / 1
| 1

eidos
"Furthermore , Usp15 deficiency promotes T cell activation and enhances T cell responses to tumor challenge in vivo ."
| PMC
USP15 affects SPAG9
1 |
1 |

No evidence text available
USP15 affects SMURF1
1 |
1 |

No evidence text available
USP15 affects SELENBP1
1 |

No evidence text available
USP15 affects RP23-440M18.7
1 |
USP15 binds RP23-440M18.7. 1 / 1
1 |

No evidence text available
USP15 affects RNF144B
1 |
1 |

No evidence text available
USP15 affects RLR
| 1
USP15 inhibits RLR. 1 / 1
| 1

reach
"During human papillomavirus (HPV) infection, the E6 oncoprotein interacts with TRIM25 and ubiquitin-specific peptidase 15 (USP15), which enhances TRIM25 degradation and subsequently inhibits RLR/MAVS signaling."
USP15 affects RIG-I-N
| 1
USP15 binds RIG-I-N. 1 / 1
| 1

reach
"Because our results demonstrated that USP15 interacts with RIG-I-N, it is reasonable to infer that USP15 is an alternative substrate of RIG-I, which impairs the recruitment of IPS-1 by RIG-I."
USP15 affects R-SMADs
| 1
USP15 binds R-SMADs. 1 / 1
| 1

reach
"However, we were not able to detect an interaction between USP15 and R-SMADs and, consistent with this, depletion or overexpression of USP15 from human and mouse cells as well as Xenopus embryos did not cause significant changes in the levels of endogenous SMAD1."
USP15 affects R-SMAD
| 1
USP15 deubiquitinates R-SMAD. 1 / 1
| 1

reach
"Supporting our observation, one report found that USP15 deubiquitinates R-SMAD in both the cytoplasm and nucleus [14]."
USP15 affects R-SMAD monoubiquitination
| 1
USP15 inhibits R-SMAD monoubiquitination. 1 / 1
| 1

eidos
"In this pathway , USP15 inhibits R-SMAD monoubiquitination , which targets R-SMAD 's DNA-binding domain and prevents promoter recognition , resulting in increased TGF-beta and BMP signaling [ 48 ] ."
USP15 affects PPP4R2
1 |
1 |

No evidence text available
USP15 affects PPIH
1 |
1 |

No evidence text available
USP15 affects PJA1
| 1
| 1

sparser
"For example, TRAF6, TRIM63, PJA1, MDM2, and HUWE1 each interact with USP7, and all except PJA1 interact with USP15 ( xref , xref , xref , and references therein)."
USP15 affects PHB2
1 |
1 |

No evidence text available
| 1

eidos
"Inhibition of USP15 led to decreases in HG-evoked apoptosis , oxidative stress , and inflammation in podocytes ."
USP15 affects Nrf2/HO-1
| 1
USP15 inhibits Nrf2/HO-1. 1 / 1
| 1

reach
"Inhibition of USP15 Prevent Glutamate Induced Oxidative Damage by Activating Nrf2/HO -1 Signaling Pathway in HT22 Cells."
USP15 affects NUP153
| 1
USP15 increases the amount of NUP153. 1 / 1
| 1

isi
"Expression of NR5A2, NUP153, HNF4A, USP15 and FNDC3B is consistent with their use as novel biomarkers for bovine mammary stem/progenitor cells."
USP15 affects MYH4
1 |
1 |

No evidence text available
USP15 affects MFN2
1 |
USP15 deubiquitinates MFN2. 1 / 1
1 |

No evidence text available
USP15 affects MED4
1 |
1 |

No evidence text available
USP15 affects MDM4
| 1
USP15 activates MDM4. 1 / 1
| 1

reach
"Whether USP15 also modulates MDMX stability, how the activity of USP15 is regulated, and whether DNA damage impacts USP15 activity toward MDM2 remain to be elucidated."
USP15 affects MCM4
1 |
1 |

No evidence text available
USP15 affects Lys734 ubiquitination
| 1
USP15 activates Lys734 ubiquitination. 1 / 1
| 1

eidos
"Here , USP15 modulates Lys734 ubiquitination within the C-lobe of SMURF2 , which is required for its catalytic activity [ 45 ] ."

reach
"Mechanistic dissection further revealed that MFSD4A-AS1 functioned as ceRNA to sequester miR-30c-2-3p, miR-145-3p and miR-139-5p to disrupt the miRNAs-mediated inhibition of VEGFA and VEGFC, and further activated TGF-β signaling by sponging miR-30c-2-3p that targeted TGFBR2 and USP15, both of which synergistically promoted lymphangiogenesis and lymphatic metastasis of PTC."
USP15 affects Luc
| 1
USP15 inhibits Luc. 1 / 1
| 1

reach
"In addition, USP15 dose-dependently inhibited RIG-I-N-triggered IFN-β–Luc, ISRE–Luc, NF-κB–Luc, and IRF3–Luc reporter activities (Supplementary Fig. S3)."
USP15 affects LYAR
| 1
| 1

sparser
"In this analysis, USP15 and LYAR were detectably physically associated with mysterin, whereas the other two proteins were not ( xref )."
USP15 affects LMNA
1 |
1 |

No evidence text available
USP15 affects KRT35
1 |
1 |

No evidence text available
USP15 affects KDM1A
| 1
USP15 increases the amount of KDM1A. 1 / 1
| 1

reach
"We therefore screened a panel of DUBs in which 23 DUBs ' cDNA plasmids were transfected into 293T cells, and found that USP15, USP21, USP22, and USP28 upregulated KDM1A levels (XREF_SUPPLEMENTARY)."
USP15 affects K63-linked ubiquitination RIG-I-N
| 1
USP15 inhibits K63-linked ubiquitination RIG-I-N. 1 / 1
| 1

eidos
"Presence of USP15 reduced K63-linked ubiquitination of RIG-I-N in HEK293T cells ( lane 3 ) ; in contrast , USP15 failed to reduce K63-linked ubiquitination of RIG-I-N in GLTSCR2 knockdown cells ( lane 4 ) ."
USP15 affects JAK
| 1
USP15 inhibits JAK. 1 / 1
| 1

reach
"Moreover, the deubiquitinating enzyme ubiquitin-specific peptidase 15 expression level was significantly downregulated in CML patients by blocking JAK/STAT5 pathway and involved in imatinib resistance (27)."
USP15 affects IPS-1-RIG-I binding
| 1
USP15 inhibits IPS-1-RIG-I binding. 1 / 1
| 1

eidos
"The second possibility is that USP15 interacts with RIG-I to reduce IPS-1-RIG-I binding ."
USP15 affects IFNs independent DUB
| 1
USP15 inhibits IFNs independent DUB. 1 / 1
| 1

eidos
"It is indicated that still have some USP15 inhibits IFNs production independent of its DUB activity ."
USP15 affects IFN1
| 1
USP15 inhibits IFN1. 1 / 1
| 1

reach
"Interestingly, USP15 competes with IPS-1 to bind to RIG-1, limiting IPS-1 activation and IFN1 production."
USP15 affects Histone
| 1
| 1

reach
"Interactions between USP15 and IGFBP3 and linker histones have not been reported previously."
| 1

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
USP15 affects Harhaj
| 1
USP15 ubiquitinates Harhaj. 1 / 1
| 1

reach
"USP15 negatively regulates NFκB activation by deubiquitinating IκB (Harhaj and Dixit 2011), while USP7 decreases NFkB signalling by deubiquitinating TRAF6 and IKK (Nanduri et al. 2013)."
USP15 affects HSF1
1 |
1 |

No evidence text available
USP15 affects HMOX
| 1
USP15 decreases the amount of HMOX. 1 / 1
| 1

reach
"Furthermore, USP15 inhibition induced nuclear factor erythroid derived 2 related factor2 (Nrf2) nuclear translocation and promoted protein expression level of heme oxygenase (HO-1)."
USP15 affects H2AC20
1 |
1 |

No evidence text available
USP15 affects Glioma
| 1
USP15 activates Glioma. 1 / 1
| 1

reach
"In addition, USP15 overexpression reversed the inhibited proliferation and migration ability of glioma cells induced by GINS1 silencing in U251 cells, whereas USP15 knockdown impaired the elevated proliferation and migration ability of glioma cells induced by GINS1 overexpression in A72 cells."
USP15 affects FlaG
| 1

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
USP15 affects FHA
| 1
USP15 binds MDC1 and FHA. 1 / 1
| 1

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."
USP15 affects FDH
| 1
RORC binds USP15 and FDH. 1 / 1
| 1

sparser
"RORγt-USP15 interaction in the RORγt-flag EL4 cells was confirmed by immunoprecipitation analysis ( xref )."
USP15 affects ERK
| 1
USP15 increases the amount of phosphorylated ERK. 1 / 1
| 1

reach
"Interestingly, USP15 did not regulate the stability of ERK2 but increased the level of p-ERK1/2 to further enhance the TGF-beta and SMAD2 signaling pathway."
USP15 affects DNA Damage
| 1
| 1

reach
"Whether USP15 also modulates MDMX stability, how the activity of USP15 is regulated, and whether DNA damage impacts USP15 activity toward MDM2 remain to be elucidated."
USP15 affects Cul3-Keap1-E3 ubiquitin
| 1
USP15 activates Cul3-Keap1-E3 ubiquitin. 1 / 1
| 1

reach
"USP15 increases the degradation of Nrf2 by stabilizing the Cul3-Keap1-E3 ubiquitin ligase complex."
USP15 affects Cartilage
| 1
| 1

eidos
"Our results indicated that USP15 stimulated TGF-beta / SMAD2 signaling and the cartilage phenotype ."
USP15 affects CUL3
| 1

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
USP15 affects COPS7B
1 |
1 |

No evidence text available
USP15 affects CDK11A
1 |
1 |

No evidence text available
USP15 affects CBX3
| 1
USP15 binds CBX3 and BARD1. 1 / 1
| 1

sparser
"As shown in Fig.  xref , knockout of USP15 decreased BARD1HP1γ interaction in cells, and this effect is dependent on USP15 deubiquitinating enzyme activity."
USP15 affects CALML3
1 |
1 |

No evidence text available
USP15 affects BTRC
1 |
1 |

No evidence text available
USP15 affects BMI1
| 1
USP15 deubiquitinates BMI1 at position 81. 1 / 1
| 1

reach
"Further analysis showed that USP15 deubiquitinated BMI1 at lysine 81 (Figure 4F), which could also be confirmed by an in vitro deubiquitination assay (Figure 4G)."
USP15 affects BIRC5
| 1
Modified USP15 increases the amount of BIRC5. 1 / 1
| 1

reach
"USP15 overexpression promotes the expression of Bcl-2, Bcl-xL, Survivin, and NF-kappaBp65."
USP15 affects BIRC3
1 |
1 |

No evidence text available
USP15 affects BCR
1 |
1 |

No evidence text available

reach
"As shown in XREF_FIG, co-expression of USP15 enhanced the AP-1, AP-2, AP-3, SP-1 and NF-kappaB signal pathways transactivated by ectopically expressed HBx although these signal pathways were also affected to a lesser extent by USP15 overexpression alone (XREF_FIG)."
USP15 affects AXIN2
| 1
| 1

sparser
"The significant negative association of USP15 expression with the canonical WNT pathway target gene AXIN2 in a human GBM dataset is consistant with a negative regulatory role of USP15 as proposed by our in vitro study."
USP15 affects ATL3
1 |
1 |

No evidence text available
USP15 affects ANK3
1 |
1 |

No evidence text available
USP15 affects AKT
| 1
USP15 inhibits AKT. 1 / 1
| 1

reach
"USP15 promotes the apoptosis of degenerative nucleus pulposus cells by suppressing the PI3K and AKT signalling pathway."
USP15 affects 5hmC mouse liver
| 1
USP15 inhibits 5hmC mouse liver. 1 / 1
| 1

eidos
"We found that knockdown of Usp15 increased 5hmC levels in mouse liver ( Fig. 3H and fig ."
| PMC

reach
"T cell intrinsic USP15 deficiency promotes excessive IFN-gamma production and an immunosuppressive tumor microenvironment in MCA induced fibrosarcoma."
USP15 sgRNA A1 CCAAGTTACTTAGGCCACAG sgRNA B2 affects USP15
| 1
USP15 sgRNA A1 CCAAGTTACTTAGGCCACAG sgRNA B2 activates USP15. 1 / 1
| 1

eidos
"CRISPR-generated USP15 - / - THP-1 cell lines and NF-kappaB luciferase assay The USP15 - / - THP-1 cell lines were generated by a CRISPR-based approach using USP15 sgRNA A1 ( CCAAGTTACTTAGGCCACAG ) and sgRNA B2 ( AAGGTGTTCCTTAAGTGACT ) ."
USP10 affects USP15
1 |
1 |

No evidence text available
UBL affects USP15
| 1
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
UBE2S affects USP15
1 |
1 |

No evidence text available
UBE2G2 affects USP15
1 |
1 |

No evidence text available
TRIM25 affects DDX58
| 1
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
TRIM17 affects USP15
1 |
1 |

No evidence text available
TIFAB mutant affects USP15
| 1
TIFAB mutant activates USP15. 1 / 1
| 1

eidos
"As a negative control , a TIFAB mutant that lacks amino acids in its C-terminal domain is unable to increase USP15 activity ( Figure S1D ) ."
TGIF affects USP15
1 |
TGIF decreases the amount of USP15. 1 / 1
1 |

No evidence text available
SPAG9 affects USP15
1 |
1 |

No evidence text available
SP1 affects USP15
1 |
SP1 decreases the amount of USP15. 1 / 1
1 |

No evidence text available
SMURF1 affects USP15
1 |
1 |

No evidence text available
| 1

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
SELENBP1 affects USP15
1 |

No evidence text available
SART3 affects UBL
| 1
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."

reach
"IR induced USP15 translocation to the nucleus."
RP23-440M18.7 affects USP15
1 |
USP15 binds RP23-440M18.7. 1 / 1
1 |

No evidence text available
RORC affects FDH
| 1
RORC binds USP15 and FDH. 1 / 1
| 1

sparser
"RORγt-USP15 interaction in the RORγt-flag EL4 cells was confirmed by immunoprecipitation analysis ( xref )."
RNF144B affects USP15
1 |
1 |

No evidence text available
RIG-I-N affects USP15
| 1
USP15 binds RIG-I-N. 1 / 1
| 1

reach
"Because our results demonstrated that USP15 interacts with RIG-I-N, it is reasonable to infer that USP15 is an alternative substrate of RIG-I, which impairs the recruitment of IPS-1 by RIG-I."
R-SMADs affects USP15
| 1
USP15 binds R-SMADs. 1 / 1
| 1

reach
"However, we were not able to detect an interaction between USP15 and R-SMADs and, consistent with this, depletion or overexpression of USP15 from human and mouse cells as well as Xenopus embryos did not cause significant changes in the levels of endogenous SMAD1."
PRPF3 affects USP15
1 |
1 |

No evidence text available
PRNP affects USP15
| 1
PRNP activates USP15. 1 / 1
| 1

reach
"To understand the functional effects of USP15 on HaCaT cells, they were next treated with PBS, PRP, and PRP-Exos."
PPP4R2 affects USP15
1 |
1 |

No evidence text available
PPIH affects USP15
1 |
1 |

No evidence text available
PJA1 affects USP15
| 1
| 1

sparser
"For example, TRAF6, TRIM63, PJA1, MDM2, and HUWE1 each interact with USP7, and all except PJA1 interact with USP15 ( xref , xref , xref , and references therein)."
PHB2 affects USP15
1 |
1 |

No evidence text available
NOP53 affects DDX58
| 1
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
MicroRNAs affects USP15
| 1
| 1

eidos
"USP15 is a direct target of miR-202-5p Because we found that USP15 downregulation led to decreased apoptosis in CML cells by lowering the level of Caspase-6 protein , we sought to know whether the expression of USP15 is suppressed in CML cells by a microRNA that targets 3 ' - untranslated region ( 3 ' - UTR ) of USP15 mRNA ."
MYH4 affects USP15
1 |
1 |

No evidence text available
MED4 affects USP15
1 |
1 |

No evidence text available
MDC1 affects FHA
| 1
USP15 binds MDC1 and FHA. 1 / 1
| 1

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."
MCM4 affects USP15
1 |
1 |

No evidence text available
MCB-613 affects USP15
| 1
MCB-613 activates USP15. 1 / 1
| 1

reach
"Interestingly, MCB-613 treatment resulted in decreased USP15 protein levels in TYK-Nu (R175H) and OVCA420 (R273H) cells, suggesting that MCB-613 causes depletion of USP15 protein through a post-translational mechanism."
LYAR affects USP15
| 1
| 1

sparser
"In this analysis, USP15 and LYAR were detectably physically associated with mysterin, whereas the other two proteins were not ( xref )."
LMNA affects USP15
1 |
1 |

No evidence text available
KRT35 affects USP15
1 |
1 |

No evidence text available
KIF15 affects DEK
| 1
USP15 binds KIF15 and DEK. 1 / 1
| 1

sparser
"USP15 physically interacted with both DEK and KIF15 in the cells."
| 1

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
IFNG affects USP15
| 1
IFNG activates USP15. 1 / 1
| 1

reach
"T cells are major source of aberrant IFN-gamma production in Usp15 -/- mice."
Hypoxia affects USP15
| 1
Hypoxia increases the amount of USP15. 1 / 1
| 1

reach
"Furthermore, a western blot analysis showed that hypoxia suppresses the expression of the USP15 protein, while RT-qPCR showed hypoxia-induced downregulation of USP15 mRNA levels."
Histone affects USP15
| 1
| 1

reach
"Interactions between USP15 and IGFBP3 and linker histones have not been reported previously."
| 1

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
HSF1 affects USP15
1 |
1 |

No evidence text available
H2AC20 affects USP15
1 |
1 |

No evidence text available
FlaG affects USP15
| 1

sparser
"This is consistent with our previous observations showing that even under overexpression conditions, HA-USP15 does not interact with FLAG-SMADs 1, 3, 4 and 7 [ xref ]."
FHA affects USP15
| 1
USP15 binds MDC1 and FHA. 1 / 1
| 1

sparser
"We also found that MDC1-FHA domain bound phosphorylated USP15, and Ser678 phosphorylation was essential for this binding (Fig.  xref )."
FDH affects USP15
| 1
RORC binds USP15 and FDH. 1 / 1
| 1

sparser
"RORγt-USP15 interaction in the RORγt-flag EL4 cells was confirmed by immunoprecipitation analysis ( xref )."
E6 affects DDX58
| 1
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
| 1

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
DUSP affects UBL
| 1
DUSP binds USP15, SART3, and UBL. 1 / 1
| 1

sparser
"The GST-pull down assay with the indicated purified proteins showed that the DUSP-UBL domain of USP15 directly interacted with SART3 ( xref ) similar to what was shown earlier ( xref , xref )."
DEK affects USP15
| 1
USP15 binds KIF15 and DEK. 1 / 1
| 1

sparser
"USP15 physically interacted with both DEK and KIF15 in the cells."
DDX58 affects TRIM25
| 1
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
DDX58 affects NOP53, and USP15
| 1
| 1

sparser
"It appeared that GLTSCR2 supported and inhibited the ability of USP15, respectively, to remove K63-linked and K48-linked ubiquitination of RIG-I. These results taken together indicated that GLTSCR2 interacted with RIG-I and USP15 in a complex to support the activity of USP15 to remove K63-linked polyubiquitin chains from RIG-I, leading to inactivation of RIG-I and blockage of IFN-β induction."
DDX58 affects E6, TRIM25, and USP15
| 1
USP15 binds TRIM25, DDX58, and E6. 1 / 1
| 1

sparser
"RIG-I signaling was also disrupted by E6 binding to TRIM25 and USP15, two upstream regulators of RIG-I [ xref ]."
| PMC
CYLD affects OTUB1, SMAD, UCHL5, USP11, USP15, and USP4
| 1
| 1

sparser
"Numerous studies have implicated the potential of DUBs to regulate the TGF-β signaling pathway including USP4, USP11, USP15, CYLD, OTUB1, and UCHL5, which interact with Smads to regulate TGF-β signaling [ xref , xref – xref ]."
CUL3 affects USP15
| 1

sparser
"We believe that the interaction between USP15 and the Keap1-Cul3-E3 ligase complex is most likely mediated by the CSN complex and is therefore difficult to detect due to the dynamic interaction between the E3 ligase and the CSN complex."
COPS7B affects USP15
1 |
1 |

No evidence text available
CHMP5 affects fbxw1
| 1
| 1

sparser
"Furthermore, immunoprecipitation analysis confirmed that both endogenous and overexpressed CHMP5 interact with USP15, VCP/p97, and β-Trcp in an osteoclast line and HEK293 cells, respectively ( xref and unpublished data)."
CDK11A affects USP15
1 |
1 |

No evidence text available
CBX3 affects USP15
| 1
USP15 binds CBX3 and BARD1. 1 / 1
| 1

sparser
"As shown in Fig.  xref , knockout of USP15 decreased BARD1HP1γ interaction in cells, and this effect is dependent on USP15 deubiquitinating enzyme activity."
CALML3 affects USP15
1 |
1 |

No evidence text available
BTRC affects USP15
1 |
1 |

No evidence text available
BIRC3 affects USP15
1 |
1 |

No evidence text available
BCR affects USP15
1 |
1 |

No evidence text available
BARD1 affects CBX3, and USP15
| 1
USP15 binds CBX3 and BARD1. 1 / 1
| 1

sparser
"As shown in Fig.  xref , knockout of USP15 decreased BARD1HP1γ interaction in cells, and this effect is dependent on USP15 deubiquitinating enzyme activity."
AXIN2 affects USP15
| 1
| 1

sparser
"The significant negative association of USP15 expression with the canonical WNT pathway target gene AXIN2 in a human GBM dataset is consistant with a negative regulatory role of USP15 as proposed by our in vitro study."
ATL3 affects USP15
1 |
1 |

No evidence text available
ANK3 affects USP15
1 |
1 |

No evidence text available
4-hydroxyphenyl retinamide decreases the amount of USP15. 1 / 1
1 |

No evidence text available
17alpha-ethynylestradiol decreases the amount of USP15. 1 / 1
1 |

No evidence text available