IndraLab

Statements


CYLD is modified
| 1 3 403 58
CYLD is phosphorylated.
| 1 1 314 58
CYLD is phosphorylated. 10 / 315
| 1 1 261 52

sparser
"To understand further the role that CYLD phosphorylation may be playing in ATLL pathogenesis, we analyzed this modification in HTLV-1 transformed T-cell lines, representative of ATLL, as well as in primary human ATLL samples."

sparser
"We further confirmed the importance of IKKε and TBK1 for CYLD phosphorylation by treatment of cells with MRT67307, followed by immunoprecipitation of cell lysates with the phospho(Ser418)-CYLD-specific antibody (Figure xref )."

sparser
"CYLD phosphorylation and apoptosis of non-GCB-DLBCL cells were detected."

sparser
"Transient CYLD phosphorylation thus allows for NF-κB activation to proceed in a stimulus-dependent and transient manner prior to inhibition by the A20 ubiquitin-editing complex."

sparser
"Whether IKKε is involved in the CYLD phosphorylation in HTLV1-trnasformed T cells is yet to be investigated."

sparser
"CYLD treated with calf-intestinal phosphatase (CIP) following cotransfection with IKKε was no longer recognized by the phospho-substrate antibody, confirming that the IKKε phospho-substrate antibody specifically recognizes phosphorylated CYLD ( xref )."

sparser
"These findings not only establish CYLD as a negative regulator of Tax ubiquitination but also suggest a mutual regulatory mechanism in which HTLV1 stimulates CYLD phosphorylation and functional inactivation."

rlimsp
"Regarding the latter possibility, a recent study suggests that CYLD phosphorylation can also be mediated by the IKK-related kinase IKKε and contributes to IKKε-induced tumorigenesis [38]."

sparser
"Prostaglandins suppress CYLD and Smad2/3 phosphorylation through a proteasome-dependent mechanism."

sparser
"We developed experiments and successfully demonstrated BTKis could still promote apoptosis through regulating CYLD phosphorylation in rituximab resistant non-GCB-DLBCL."
CYLD is phosphorylated on S418. 10 / 59
| 53 6

sparser
"The TCR- and PMA/I-induced Ser418 phosphorylation of CYLD could be completely prevented by dual inhibition of IKKε and TBK1, using MRT67307, while the IKKβ inhibitor TPCA1 had no effect (Figure xref )."

sparser
"To further elucidate the importance of CYLD phosphorylation at Ser418 for proximal TCR signal transduction, we generated CYLD knockout cells by CRISPR/Cas9 to subsequently reconstitute with CYLD(S418A) or CYLD(S418E) mutants that prevent or mimic CYLD phosphorylation at Ser418, respectively."

sparser
"Application of either inhibitor reduced CYLD phosphorylation at S-418 in a dose-dependent manner ( xref )."

sparser
"We focused on CYLD phosphorylation at Ser418, which can be easily assessed using a phospho(Ser418)-CYLD-specific antibody."

sparser
"Phosphorylation of CYLD at serine 418 decreases its deubiquitinase activity and is necessary for IKKε-driven transformation."

sparser
"Phosphorylation of CYLD at Ser418 decreases CYLD activity."

sparser
"Further examination showed that phosphorylation of CYLD at S418 decreases its deubiquitinase activity and increases NF-κB activation."

rlimsp
"However, in the PSD fraction, CaMKII inhibitor CN21 could not completely block the phosphorylation of CYLD at S-418, implicating involvement of a second kinase in its phosphorylation (Fig."

sparser
"Together, these observations indicate that, in addition to CaMKII, a Ca 2+ -independent kinase at the PSD phosphorylates CYLD at S-418."

sparser
"These results demonstrate that phosphorylation of CYLD at Ser418 suppresses CYLD activity, resulting in increased NF-κB transcriptional activation."
CYLD is methylated.
| 49
CYLD is methylated. 10 / 49
| 49

sparser
"Integrated Gene Expression Analysis Identified NDRG4 as One of the Top Candidates Silenced by DNA Methylation in EAC."

sparser
"Genes (23%) on the array, including 7% of X-linked and 69% of imprinted genes, have shown statistically significant changes in methylation in EAC versus Barrett's esophagus (Wilcoxon P < 0.05)."

sparser
"In addition, no association was observed between CREB and CYLD methylation and the occurrence and metastasis of CRC."

sparser
"Other members of the highest ranked pathway which were aberrantly methylated in EAC are involved in chromosomal segregation and spindle assembly, these include the BUB3 , AURKA , DYNC1I1 and DCTN2 and CHFR genes."

sparser
"SST mRNA levels in native unmethylated EACs were significantly higher than in native methylated EACs (P < ."

sparser
"One aim of the present study was to observe whether the status of PCDH -γ- A12, SLC19A1 , CREB and CYLD promoter methylation had a correlation with the serum level of CEA and CA19-9."

sparser
"Different from ESCC, several cancer-associated pathway genes were aberrantly methylated in EAC, including genes in the epithelial-mesenchymal transition (EMT), cell adhesion, Wingless and Int-1 (WNT), and Transforming growth factor (TGF) pathways ( xref ; xref )."

sparser
"Among genes with frequent DNA hypermethylation, we found several gene clusters with significantly higher DNA methylation in EACs, as compared to normal tissues."

sparser
"In contrast, the promoter of PCDH10 was specifically methylated in EAC, and this gene was respressed in EAC only (Figure  xref C and xref D)."

sparser
"However, no significant correlation was identified between PCDH -γ- A12, SLC19A1 , CREB and CYLD methylation and the clinical features, which may be due to the lack of power in the samples used."
CYLD is ubiquitinated.
| 35
CYLD is ubiquitinated. 10 / 35
| 35

sparser
"The heightened ubiquitination and degradation of CYLD are recapitulated by hydroxylase inhibition, which suggests that post-translational hydroxylation plays a central role in E6-dependent, hypoxia-induced of CYLD degradation."

sparser
"First, co-transfection of haemagglutinin epitope tagged-MIB2 (HA-MIB2) [ xref ], CYLD (untagged) and His 6 -ubiquitin expression constructs clearly drove the ubiquitylation of CYLD compared to cells transfected with CYLD and His 6 -ubiquitin (Figure xref panel (i), compare lanes 1 and 2), suggesting that MIB2 may ubiquitylate CYLD."

sparser
"However, the identity of the upstream E3 ubiquitin ligase responsible for ubiquitinating CYLD has remained elusive."

sparser
"In addition to its function as a DUB, CYLD can also be ubiquitylated as a means of targeting it for proteasomal degradation."

sparser
"When serine in this region is mutated into alanine, CYLD cannot be phosphorylated, and its activity will be significantly enhanced, which will impact on CYLD ubiquitination function, resulting in the generation of apoptosis signal through NFκB signaling pathway [ xref , xref ]."

sparser
"Since optineurin knockdown cells accumulate higher levels of ubiquitinated RIP and CYLD fails to abolish NF-κB activation, it is plausible that optineurin is required for deubiquitination of RIP by CYLD."

sparser
"For these studies, we studied the state of CYLD ubiquitination in SiHa and HeLa cells that were treated with E6-specific siRNA or control siRNA."

sparser
"A proposed model explaining how p62 mutations lead to the Paget's disease of bone is the following: mutations of the UBA domain cause an impairment in the interaction between p62 and ubiquitinated TRAF6 and/or CYLD, an enzyme deubiquitinating TRAF6, which in turn enhances the activation of the NF-κB signaling pathway and the resulting increased osteoclastogenesis (Figure 3(b)) [160]."

sparser
"Hypoxia-induced degradation of CYLD is associated with E6-mediated CYLD ubiquitination."

sparser
"CYLD binding to one of its targets, TRAF6, requires the adaptor protein p62, which promotes the deubiquitylation of TRAF6 by CYLD xref and probably also modulates the DUB activity of CYLD through induction of CYLD ubiquitylation xref ."
CYLD is sumoylated.
| 5
CYLD is sumoylated. 5 / 5
| 5

sparser
"We observed that a short ATRA treatment of neuroblastoma causes a transient SUMOylation of CYLD that reduces its deubiquitin activity, as well as activation of NF-κB signaling via ubiquitination of TRAF2/TRAF6."

sparser
"The SUMOylation of CYLD at the Lys40 residue of its N-terminus can also reduce its activity against substrates TRAF2 and TRAF6 ( xref ), and block the activation of NF-kB signalling, which plays an essential role in inflammatory reactions ( xref )."

sparser
"However, prolonged ATRA treatment reduced CYLD SUMOylation and promoted cell death instead."

sparser
"Therefore, it was proposed that the balance between non-SUMOylated and SUMOylated CYLD can direct neuroblastoma cancer cells against differentiation or cell death via regulation of NF-κB signaling [ xref ]."

sparser
"SUMOylation of CYLD occurs at residue Lys40 in the N-terminus of CYLD and although it is separate from the USP domain, it is capable of inhibiting DUB activity [ xref ]."
CYLD is degraded.
| 2
CYLD is degraded. 2 / 2
| 2

reach
"A previous study found that Notch stimulates NF-κB activation by initiating the transcription of Hes1, which then suppresses the expression of CYLD, a negative regulator of IKK activity in T-ALL cells [23]; however, this finding does not rule out the possibility that other mechanisms co-exist."

reach
"Thus, the present study revealed that, in bladder cancer, NF-kappaB can maintain its activity by establishing a feedback loop, in which NF-kappaB induced the expression of miR-130b, which consequently inhibited the expression of CYLD, which in turn was an endogenous inhibitor of NF-kappaB activation."
CYLD affects NFkappaB
| 11 288 21
CYLD inhibits NFkappaB.
| 9 209 9
| 9 209 9

reach
"Our results show that reconsitituted expression of CYLD in miR-19a-replete cells only partially deactivates NF-kappaB, suggesting that CYLD might cooperate with other DUBs to switch off NF-kappaB signalling."

reach
"CYLD has been shown to negatively regulate the activation of NF-kappaB XREF_BIBR."

reach
"For instance, CYLD negatively regulates NFkappaB activation and is involved in other immune response mechanisms.39 When TSGs such as CYLD are down-regulated, excessive inflammation occurs and tumorigenic factors can be promoted.40 Conversely, TSGs that were up-regulated were more likely to be involved in cell cycle regulation, apoptosis, and cell growth, possibly as a response to cell stress in early stages of tumorigenesis."

reach
"Because CYLD inhibits NF-kappaB activation, it is probable that both PI3K-Akt and NF-kappaB signaling pathways are involved in CYLD regulated cell proliferation and survival."

reach
"In TLR mediated signaling, CYLD negatively regulates NF-kappaB signaling by cleaving K63 linked polyubiquitin chains and M1 linked polyubiquitin chains from RIPK1, TRAF2, and NEMO."

reach
"Interestingly, loss of CYLD causes constitutive NF-kappaB activation in developing NKT cells, which contributes to their defective IL-7 response and attenuated ICOS expression."

reach
"For instance, CYLD negatively regulates NFkappaB activation and is involved in other immune response mechanisms."

sparser
"Several studies showed that the tumor suppressor CYLD inhibits NF-kB as well as the p38 MAPK pathway activation by deubiquitinating several upstream regulatory signaling molecules of these pathways, thus suppressing these signaling pathways [ xref ]."

reach
"This promotes the cleavage of a limited number of proteins, including A20, CYLD and RelB that negatively regulate NF-kappaB activation."

reach
"The lack of requirement of linear polyubiquitination in K13 induced NF-kappaB activation was further supported by our results showing that CYLD, a deubiquitylating enzyme that can cleave linear ubiquitin chains, can not block K13 induced NF-kappaB activity."
CYLD activates NFkappaB.
| 2 68 7
| 2 65 7

sparser
"Although comparable CYLD mRNA levels were present in both tumor and normal tissue, direct binding of miR-182 to 3′UTR of CYLD activated NF-κB in tumor cells."

reach
"However, subsequent studies have indicated that although CYLD targets NF-kappaB signaling factors, its function may depend on the cell type and stimulating receptor [XREF_BIBR]."

reach
"These miR then directly target the tumor suppressor genes, phosphatase and tensin homolog (PTEN) and cylindomatosis (CYLD), thereby promote NF-kappaB activity which is required to maintain the transformed state [XREF_BIBR]."

reach
"Across all solid tumor types, frequent inactivating TRAF3 and CYLD alterations that are predicted to constitutively activate NF-kappaB pathways, while inhibiting innate immunity, occur only in HPV+ HNSCC."

reach
"Deubiquitinases A20 and Cezanne, but not CYLD, are induced by NF-kappaB to negatively regulate TAK1 and NF-kappaB activity by removing K63 polyubiquitin chains [XREF_BIBR]."

reach
"In addition, NF-kappaB deubiquitinases CYLD and A20, which negatively regulate canonical NF-kappaB signaling, can induce NF-kappaB downstream of the BCR in miR-17 ~ 92 overexpressing B cells, and thus, have also been proposed as targets of oncomiR-1, [XREF_BIBR]."

sparser
"The inhibition of NF-kB activation by CYLD is mediated, at least in part, by the deubiquitination and inactivation of TRAF2 and, to a lesser extent, TRAF6 [ xref ]."

sparser
"However, Treg development is not rescued in CARMA1/CYLD-double deficient mice, where the lack of the deubiquitinase CYLD activates NF-κB through TAK1/IKK."

reach
"Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling."

reach
"The inhibition of NF-kB activation by CYLD is mediated, at least in part, by the deubiquitination and inactivation of TRAF2 and, to a lesser extent, TRAF6 [XREF_BIBR]."
Mutated CYLD activates NFkappaB. 3 / 3
| 3

reach
"Our data also suggest that TRAF3 or CYLD mutations harbor episomal HPV and have activated NF-kappaB, which may be required for episomal maintenance."

reach
"On the other hand, ectopic expression of CYLD mutants was found to elevate NF-kappaB activity in NPC cells, thus demonstrating a mutational drive for NF-kappaB signaling by CYLD aberrations in NPC."

reach
"Our data also suggest that TRAF3 or CYLD mutations harbor episomal HPV and have activated NF-kappaB that may be required for episomal maintenance."
CYLD binds NFkappaB.
| 4 5
| 4 5

reach
"To find the association between CYLD and NF-kappaB, we examined the correlation between CYLD and activated NF-kappaB expression."

reach
"The Pearson 's correlation test was used to determine the association between activated NF-kappaB and CYLD, with the level of significance set at 0.05."

sparser
"We show that CYLD deficiency causes constitutive NF-kappaB activation in thymocytes, which is associated with enhanced frequency of Treg cells."

reach
"As previously mentioned CYLD can bind to NEMO and NF-kappaB that have been identified as its substrates."

sparser
"We have shown that NF-κB is constitutively active in our mGluR1-expressing melanoma cells, suggesting the potential involvement of mGluR1 in the CYLDNF-κB axis [ xref ]."

reach
"At this point, CYLD binds to NF-kappaB essential modulator (NEMO)/IKK-gamma and appears to regulate its activity through deubiquitination of TNF receptor associated factor 2 (TRAF 2) [XREF_BIBR]."

sparser
"NF-κB activation was mechanistically associated with miR-301b-mediated downregulation of CYLD."

sparser
"NF-κB activation was mechanistically associated with siRNA-mediated downregulation of CYLD."

sparser
"CYLD mutations are associated with constitutive activation of NF-κB in multiple myeloma cells and B cells from mice deficient for wild-type CYLD exhibited constitutive activation of NF-κB [ xref , xref , xref ]."
CYLD deubiquitinates NFkappaB.
| 7
CYLD deubiquitinates NFkappaB. 7 / 7
| 7

reach
"Deubiquitination of NF-kappaB members by CYLD is crucial in controlling the magnitude and nature of cell activation."

reach
"CYLD deubiquitinates several NF-kappaB regulators, including TRAF2, TRAF6, and NEMO as well as BCL3, a member of the NF-kappaB family of transcription factors."

reach
"In vivo, CYLD also reduced hepatic STAT3 K63 ubiquitination and activation, NF-kappaB activation, IL-6 and NOX2 mRNA production as well as fibrin production in murine listeriosis."

reach
"CYLD deubiquitinates NEMO, thus decreasing its stability and preventing the IKK complex from phosphorylating IkappaB, and NF-kappaB activation."

reach
"In this investigation, we found that CYLD failed to inhibit TAK1 and TAB1 co-overexpression-induced TAK1 polyubiquitination and NF-kappaB activation (XREF_FIG, XREF_SUPPLEMENTARY)."

reach
"18 CYLD 's deubiquitination of NFkappaB inhibits NFkappaB activity without decreasing NFkappaB protein expression."

reach
"Mechanistically, our results reveal that miR-135b directly targets the 3 '-untranslated region (UTR) of the deubiquitinase CYLD, thereby modulating ubiquitination and activation of NF-kappaB signaling."
CYLD affects RIPK1
9 4 1 | 3 116 22
CYLD deubiquitinates RIPK1.
1 | 66
CYLD deubiquitinates RIPK1. 10 / 67
1 | 66

reach
"Deubiquitination of RIP by over-expressed CYLD was abrogated in optineurin knockdown cells."

reach
"Then, a tumor suppressor cylindromatosis (CYLD) protein promotes the deubiquitination of RIP1 in either complex I or complex II."

reach
"It does this by binding to ubiquitinated RIP (receptor interacting protein) to displace IKBKG (inhibitor of kappaB kinase gamma), and then bringing in cylindromatosis (CYLD) to deubiquitinate RIP and terminate the signaling pathway XREF_BIBR - XREF_BIBR."

reach
"In the course of complex II formation, RIP1 deubiquitination by CYLD, a deubiquitinase that cleaves linear- and K63-ubiquitin chains, plays a crucial role."

reach
"CYLD can deubiquitinate RIPK1, freeing it to be phosphorylated and complex with RIPK3 (Complex IIb) to form the necrosome [XREF_BIBR - XREF_BIBR]."

reach
"RIPK1 ubiquitylation can be restricted by cIAP inhibition or by the deubiquitylase activity of CYLD, which is recruited to the complex-I through the LUBAC binding protein SPATA2 XREF_BIBR - XREF_BIBR."

reach
"[XREF_BIBR] CYLD deubiquitination of TRAF6, RIP1, and NF-kappaB-essential modulator (NEMO) leads to inactivation of NF-kappaB signaling."

reach
"The suppression of CYLD by overexpression of LEF-1 stimulates sustained ubiquitination of RIPK1, causing the defection of necroptosis and survival of CLL cells."

reach
"The deubiquitination of RIPK1 by CYLD is critical for the activation of necroptosis and complex II formation [16]."

reach
"It regulates NF-kappaB signaling by facilitating deubiquitination of ubiquitinated RIP by CYLD [7,14]."
CYLD binds RIPK1.
4 | 16 21
4 | 16 19

sparser
"Close proximity of binding sites of both CYLD and RIP on optineurin provides support for the adaptor function of optineurin in facilitating interaction of RIP and CYLD."

reach
"The interaction of Flag-CYLD and Myc-RIP1 was taken as positive control."

sparser
"These results show that optineurin is essential for interaction of CYLD with ubiquitinated RIP."

sparser
"Moreover, siCLIPR-59 treatment disrupted the formation of protein complex of CYLD with RIP1 ( xref )."

reach
"In contrast, under TNFalpha treatment, binding between CYLD and RIP1 or TRAF2 was reduced, if the cells also expressed PrP (XREF_FIG B)."

reach
"The interaction of CYLD and RIP1 (Receptor Interaction protein 1) was taken as positive control."

sparser
"In contrast, in siCLIPR-59-treated cells, the association of CYLD with RIP1 was reduced ( xref )."

sparser
"Optineurin is essential for interaction of CYLD with ubiquitinated RIP."

reach
"Mediating the interaction between CYLD and polyUb RIP, optineurin may act as an adaptor protein bringing CYLD and the CYLD substrate RIP together to facilitate deubiquitination of ubiquitinated RIP by CYLD."

sparser
"The results presented in this manuscript suggest that optineurin mediates interaction of deubiquitinase CYLD with polyubiquitinated RIP and this interaction is essential for deubiquitination of RIP by CYLD."
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
CYLD ubiquitinates RIPK1.
9 | 10 1
CYLD ubiquitinates RIPK1. 10 / 11
| 10 1

reach
"It regulates NF-kappaB signaling by facilitating deubiquitination of ubiquitinated RIP by CYLD [7,14]."

reach
"A20 and CYLD block the de-ubiquitination of RIP1 block formation of Complex II and apoptosis."

reach
"Mediating the interaction between CYLD and polyUb RIP, optineurin may act as an adaptor protein bringing CYLD and the CYLD substrate RIP together to facilitate deubiquitination of ubiquitinated RIP by CYLD."

reach
"RIPK1 ubiquitination inhibits RIPK1 kinase activity, and the deubiquitinating enzyme CylD supports necroptosis by deubiquitinating RIP1 XREF_BIBR, XREF_BIBR."

reach
"In vitro, downregulation of CYLD increased RIP1 ubiquitination, prevented RIP1 and RIP3 complex formation, and protected neuronal cells from oxidative death."

sparser
"It seems that the ubiquitination of RIP1 protein by CYLD still via apoptosis signaling."

reach
"The cIAPs can ubiquitinate RIP1, which leads to activation of NF-κB and MAPK pathways to promote cell survival.39 40 Upon cIAP degradation, RIP1 can be de-ubiquitinated by deubiquitinase cylindromatosis (CYLD).41 Upon deubiquitination, Complex IIa forms (Fig. 3), which typically includes RIP1, caspase-8, and FADD.38 42 Formation of this complex can trigger cell death by apoptosis."

reach
"Thus an important function of optineurin in the regulation of NF-kappaB signalling is to act as an adaptor protein bringing CYLD and its substrate RIP together to facilitate deubiquitination of ubiquitinated RIP by CYLD."

reach
"CYLD can inhibit NF-kappaB activity by deubiquitinating and inactivating TRAF2 and TRAF6, RIP, NEMO, and the NF-kappaB co-activator BCL-3."

reach
"CYLD deficiency leads to hyperubiquitinated RIPK1 in the necrosome and impaired phosphorylation of RIPK1 and RIPK3, thereby blocking caspase-8 activation."
CYLD ubiquitinates RIPK1 on K377. 9 / 9
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CYLD activates RIPK1.
| 1 12
CYLD activates RIPK1. 10 / 14
| 1 12

reach
"Then, we found that RIP3 accounts for shikonin induced activation of MLKL, and activated MLKL reversely up-regulates the protein level of CYLD and promotes the activation of RIP1 and RIP3."

reach
"An alternative explanation for the embellished necroptotic sensitivity observed in casp8 deficient cells has been raised by Ting and colleagues, observing that casp8 mediated cleavage of the E3 ubiquitin ligase CYLD enhances RIP1 and RIP3 dependent necroptosis [XREF_BIBR]."

reach
"In addition we show that optineurin is required for CYLD mediated deubiquitnation of RIP."

eidos
"CYLD is an essential mediator of RIPK1 - and RIPK3-dependent necroptosis [ 145 ] ."

reach
"In contrast, overexpression of CYLD caused downregulation of RIPK1 in Mel-CV and ME1007 cells, which was nevertheless reversed by the treatment with the proteasome inhibitor MG132 (XREF_FIG), substantiating that downregulation of RIPK1 expression by CYLD is mediated by the proteasomal degradation XREF_BIBR."

reach
"Rather than inhibiting RipK1 degradation, knock-down of CYLD and/or A20 appeared to enhance the degradation of RipK1, suggesting that CYLD and A20 promote maintenance of RipK1."

reach
"These observations strongly suggest that in ATLL cells, either viral encoded oncogenic proteins or mutations sustain the early cell death checkpoint by driving multiple IKKs to phosphorylate and suppress CYLD in order to prevent RIPK1 from becoming a death-signaling molecule (Fig. 8a)."

reach
"Cylindromatosis (CYLD), an enzyme that deubiquitinates K63 specifically, can mediate the RIPK1 deubiquitinating process to expedite the complex IIb-forming process, covering pro-caspase-8, FADD and TRADD [33]."

reach
"CYLD destabilizes complex I and allows RIP1 to dissociate from the plasma membrane."

reach
"CYLD Is Critical for Protection Against the Apoptosis Inducing Potential of RIPK1 in a Subset of Melanoma Cells."
CYLD inhibits RIPK1.
| 2 10
CYLD inhibits RIPK1. 10 / 13
| 2 10

reach
"In support, overexpression of Snail1 reduced CYLD expression and upregulated RIP1 in Mel-CV."

eidos
"This was demonstrated by the findings that knockdown of CYLD resulted in upregulation of RIPK1 that was associated with enhancement in K63-linked polyubiquitination of the protein and that co-knockdown of RIPK1 diminished CYLD knockdown-induced apoptosis in sensitive cells ."

reach
"Formation of the secondary, receptor-free cytoplasmic complex II is largely dependent on the activity of DUBs, specifically cylindromatosis (CYLD), A20 (also known as TNFAIP3) and ubiquitin thioesterase OTULIN, which destabilize complex I, abrogate NF-kappaB activation and release RIPK1 from complex I, which then forms the cytosolic complex II XREF_BIBR, XREF_BIBR."

reach
"Thus, CYLD inhibits MyD88, RIP1 (receptor interacting serine/threonine protein kinase 1), TRAF2, TRAF6, TRAF7 and NEMO downstream to TLR signaling and regulates exaggerated inflammation which can lead to the development of severe infection causing sepsis and associated organ damage."
| DOI

reach
"We now report that phosphorylation of CYLD by IKK family kinases in HTLV-1 transformed T cells inhibits RIPK1 from activating the cell death pathway and inhibiting these kinases reactivates CYLD and RIPK1-dependent tumor cell death."

reach
"Then, we found that RIP3 accounts for shikonin induced activation of MLKL, and activated MLKL reversely up-regulates the protein level of CYLD and promotes the activation of RIP1 and RIP3."

reach
"Caspase-8 also targets the deubquitinase CYLD preventing RIPK1 initiation of necroptosis [XREF_BIBR, XREF_BIBR]."

reach
"Silencing of CYLD caused upregulation of RIPK1 in Mel-CV, ME1007, Mel-FH, and ME4405 cells regardless of their differential apoptotic responses (XREF_FIG)."

reach
"Our observations suggest that in cells transformed by HTLV-1, TAX induces the phosphorylation of CYLD to keep it inactive in order to prevent RIPK1 from inducing cell death."

reach
"This was demonstrated by the findings that knockdown of CYLD resulted in upregulation of RIPK1 that was associated with enhancement in K63 linked polyubiquitination of the protein and that co-knockdown of RIPK1 diminished CYLD knockdown induced apoptosis in sensitive cells."
CYLD decreases the amount of RIPK1.
| 2
CYLD decreases the amount of RIPK1. 2 / 12
| 2

reach
"In contrast, overexpression of CYLD caused downregulation of RIPK1 in Mel-CV and ME1007 cells, which was nevertheless reversed by the treatment with the proteasome inhibitor MG132 (XREF_FIG), substantiating that downregulation of RIPK1 expression by CYLD is mediated by the proteasomal degradation XREF_BIBR."

reach
"CYLD can also negatively regulate the expression of receptor interacting protein kinase 1 (RIPK1) that is emerging as an important determinant of cell fate in response to cellular stress through its deubiquitinase activity XREF_BIBR."
| 4 65 3

reach
"As we expected, the MTT assay results showed that overexpression of CYLD obviously decreased the proliferation of A549 cells or H460 cells compared with that of untreated cells (* p < 0.05, ** p < 0.01)."

reach
"These results suggest that TRIM15 promotes, while CYLD inhibits, proliferation of melanoma cells."

reach
"Together, these results indicate that the increased expression of RIPK1 is responsible for induction of apoptosis in Mel-CV and ME1007 cells with CYLD silenced and that it does not play a role in the promotion of proliferation by CYLD silencing in ME4405 cells."

eidos
"DISCUSSION As a tumor suppressor , CYLD inhibits cell proliferation in many cancer types including melanoma15 ."

reach
"In vitro cell proliferation was measured and the result shows that CYLD knockout causes cell proliferation enhancement and CYLD overexpression causes cell proliferation suppression (XREF_FIG C, D)."

reach
"MiR-501-5p upregulation corresponded with a downregulation of CYLD in the same tissues and cell lines, and overexpression of MiR-501-5p decreased CYLD expression, increased expression of cyclin D1 and c-myc and promoted the proliferation of hepatocellular carcinoma cells in vitro."

reach
"Full length CYLD but not CYLD C/S could significantly reduce proliferation rate of CYLD-/- MEFs after 72 hours (XREF_FIG) indicating that the deubiquitinating activity of CYLD is required for the observed phenotype."

reach
"CYLD inhibits proliferation and metastasis of melanoma cells in vivo."

reach
"Importantly, Vinc enhanced the expression of A20 and CYLD and inhibited the proliferation and survival of CML (K562) cells."

reach
"Functionally, CYLD inhibits cell proliferation and tumorigenesis through p18 in vivo."

reach
"The present study investigated whether abnormal ectopic CYLD expression is sufficient to promote the proliferation of HCC827 and Calu-3 cells."

reach
"CYLD downregulation reversed the inhibitory effects of the proliferation of melanoma cells A375 and WM35 after transfection with miR-767-in."

reach
"CYLD deficiency leads to spontaneous B-cell activation and proliferation."

reach
"Elimination of SRF by siRNA or inhibition of p38 MAPK reduced the expression level of CYLD and increased cell proliferation."

reach
"To conclude, we found that downregulation of CYLD induces tumor cell proliferation, consequently contributing to the aggressive growth of HCC."

reach
"In conclusion, we demonstrated that CYLD downregulation promoted NPC cell proliferation and apoptosis resistance."

reach
"Knockdown of CYLD significantly increased the proliferation activities of two melanoma cell lines (p < 0.05), along with BCL3 nuclear translocation followed by CCND1 overexpression."

reach
"CYLD has also been shown to deubiquitinate (and inactivate) the coactivator BCL-3 (117) , which switches the transcriptional properties of NF-jB from repressive to activating, and is known to strongly promote cell proliferation and oncogenesis (118, 119) ."

reach
"CYLD deficiency promotes cancer cell proliferation, cell survival and tumorigenesis."

reach
"Our knockout and overexpression results consistently show the CYLD expression inhibits NPC cell proliferation and delays cell transition from early S to G2 phase in the cell cycle in vitro."
CYLD affects TRAF6
2 4 2 1 | 1 56 33
CYLD binds TRAF6.
4 2 | 15 30
4 2 | 15 15

reach
"Perhaps because the levels of CYLD and the binding of CYLD to TRAF6 were already reduced following LPA stimulation, we only observed a reduction of this association by TRIP6 overexpression in unstimulated cells."

reach
"SPIO, HA and SPIO@15HA could notably suppress marker genes expression during osteoclastogenesis stimulated by RANKL and M-CSF (Fig. 7A), showing the capability to inhibit osteoclast differentiation.In our previous work, we have found that clinically used SPIOs can increase p62 expression though TLR4 activation [37], thus induce recruitment of CYLD to inhibited TRAF6 ubiquitination, leading to suppression of RANKL induced signal transduction for osteoclast differentiation [30]."

No evidence text available

sparser
"Given that TRAF6 interacts with CYLD in some cells ( xref , xref ), it is possible that CYLD recruitment was mediated by the initial interaction with TRAF6."

reach
"For example, the adaptor protein p62, which is required for CYLD binding to TRAF6, regulates the DUB activity of CYLD by promoting CYLD ubiquitination [XREF_BIBR]."

reach
"Furthermore, mice carrying the p62 and SQSTM1-P 392L mutation show loss of binding between CYLD and TRAF6, and loss of deubiquitination activity of CYLD towards TRAF6, supporting the critical role of CYLD in osteoclast differentiation."

reach
"However, it is unknown whether there is a direct interaction between CYLD and TRAF-6, and if so, how CYLD regulates TRAF signaling."

sparser
"These results show that CYLD is indeed physically associated with TRAF-6."

sparser
"Perhaps because U373-MG cells expressed very low levels of CYLD, we could barely detect the association of TRAF6 with CYLD even when TRIP6 was depleted."

sparser
"Next, we explored the physical relevance of this TRAF-6-CYLD interaction."
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
| 7

sparser
"Nonetheless, depletion of TRIP6 can significantly enhance the association of A20 or CYLD with TRAF6 in ovarian cancer cells and promote the binding of A20 to TRAF6 in glioblastoma cells, suggesting that targeting TRIP6 may prove to be an effective strategy to restore the function of A20 and CYLD in restricting the NF-κB activity in these cancer cells."

sparser
"To address this issue, we expressed FLAG-TRAF6 in HEK293T cells and treated cells with LPA for various times to determine how TRAF6 associates with deubiquitinase A20 or CYLD."

sparser
"Nonetheless, depletion of TRIP6 by either shRNA ( xref ) or Cas9/sgRNA ( xref ) not only enhanced the association of TRAF6 with A20, but also with CYLD in untreated and treated cells, suggesting a significant role for TRIP6 in antagonizing the binding of TRAF6 to both A20 and CYLD in ovarian cancer cells."

sparser
"On the other hand, in ovarian cancer cells and glioblastoma cells that show persistent NF-κB activity and high levels of TRIP6, both A20 and CYLD bind to TRAF6 very weakly."

sparser
"In this regard, here we provide evidence that the adaptor protein TRIP6 (thyroid hormone receptor-interacting protein 6), a specific interacting protein of the LPA2 receptor but not other LPA receptors, recruits TRAF6 to the LPA2 receptor and enhances the E3 ligase activity of TRAF6 by antagonizing the association of A20 and CYLD to TRAF6."

sparser
"Overexpression of TRIP6 interferes with the recruitment of A20 to TRAF6, whereas depletion of TRIP6 enhances the association of TRAF6 with A20 and CYLD, and eliminates LPA-promoted K63-linked polyubiquitination of TRAF6."

sparser
"In contrast, depletion of TRIP6 by TRIP6-specific shRNA or Cas9/sgRNA greatly enhances the association of TRAF6 with A20 and CYLD, and attenuates lysophosphatidic acid-induced muclear factor-κB and JNK/p38 activation in ovarian cancer cells."
CYLD inhibits TRAF6.
1 | 1 8 2
CYLD inhibits TRAF6. 10 / 19
1 | 1 8 2

reach
"As we described here for YOD1, CYLD is acting on TRAF6 and p62 complexes, but - in contrast to YOD1 - CYLD is not preventing the formation of TRAF6 and p62 aggregates, but is recruited to TRAF6 by p62."

reach
"Similarly, de-ubiquitinating enzyme cylindromatosis (CYLD) inhibits NF-kappaB signaling via de-ubiquitination and inactivation of TNFR associated factor 2 (TRAF2) and TRAF6 [XREF_BIBR, XREF_BIBR]; de-ubiquitinating protease A20 inhibits NF-kappaB activation induced by Toll like receptor 4 (TLR4) via removing K63 linked polyubiquitin chains of TRAF6 [XREF_BIBR]."

reach
"Thus, it is possible that CYLD functions in diverse pathways and loss of CYLD activity contributes to tumorigenesis via multiple mechanisms.Lys63-linked ubiquitin chains, synthesized in response to cy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The ubiquitin editing enzyme CYLD inhibits TRAF6 and -7 and TLR2 [XREF_BIBR]."

reach
"As shown in XREF_SUPPLEMENTARY, CYLD knockdown, using siCYLD, still enhanced TGF-beta-induced fibrotic response in TRAF6 depleted cells, thereby suggesting that CYLD inhibits Akt mediated fibrotic response at least in part by directly interacting with and deubiquitinating Akt."

sparser
"The ubiquitin-editing enzyme CYLD inhibits TRAF6 and -7 and TLR2 [ xref ]."

reach
"CYLD inhibits the ubiquitination of TNFα receptor-associated factor (TRAF6), while TRAF6 conjugated to a Lys-63 (K63)-linked polyubiquitin chain is required for the activation of IKK and downstream signalling events [45–47]."

sparser
"TRAF6 are inhibited by A20, CYLD and OTUB2 that specially remove TRAF6 K63‐linked ubiquitination."

eidos
"TRAF6 are inhibited by A20 , CYLD and OTUB2 that specially remove TRAF6 K63-linked ubiquitination ."

"The nf-kappab activation by cyld is mediated, at least in part, by the deubiquitination and inactivation of tnfr-associated factor 2 (traf2) and, to a lesser extent, traf6."
CYLD deubiquitinates TRAF6.
1 1 | 17
CYLD deubiquitinates TRAF6. 10 / 19
1 1 | 17

reach
"CYLD binding to one of its targets, TRAF6, requires the adaptor protein p62, which promotes the deubiquitylation of TRAF6 by CYLD 17 and probably also modulates the DUB activity of CYLD through induction of CYLD ubiquitylation 34."

reach
"Conversely, the PB1 domain of p62 also interacts with CYLD, a deubiquitinase, which inhibits TRAF6 polyubiquitination and serves as a negative regulator for RANK mediated NF-kappaB activation and osteoclastogenesis 113."

reach
"In support of this notion, in vivo poly-ubiquitination assays demonstrate that depletion of beta-TRCP impaired TRAF6 self ubiquitination likely due to enhancement of TRAF6 deubiquitination by CYLD, concomitant with a reduction in beta-TRCP-dependent ubiquitination of CYLD and impairment of auto-phosphorylation of TRAF6-downstream kinase IKKalpha."

reach
"CYLD deubiquitylates TRAF6, which transduces the RANK-mediated signal [99]."

reach
"For instance, p62, one adaptor protein, can promote the deubiquitylation of TRAF6 (one of p62 targets) by CYLD."

reach
"Here we demonstrated that during the RANKL dependent signaling pathway, CYLD stabilization by depletion of beta-TRCP decreased the ubiquitination of TRAF6 and impaired auto-phosphorylation of the TRAF6-downstream kinase IKKalpha."

reach
"OPTN negatively regulates IRAK-1 mediated NF-kappaB activation possibly by facilitating CYLD dependent deubiquitination of TRAF6."

reach
"Another example is already mentioned CYLD, which is an important inflammatory mediator that deubiquitinates TRAF2 and TRAF6, resulting in negative regulation of the NF-kappaB pathway [XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR]."

reach
"Previously it has been known that TNF receptor associated factor 6 (TRAF6) acts as an E3 ligase for Akt-K63 polyubiquitination, and CYLD deubiquitinates TRAF6."

reach
"CYLD also decreased IFN promotor activation by deubiquitinating TRAF2 and TRAF6 in HEK293 T cells, respectively [29, 30] ."
CYLD ubiquitinates TRAF6.
| 9 1
CYLD ubiquitinates TRAF6. 10 / 10
| 9 1

reach
"CYLD also decreased IFN promotor activation by deubiquitinating TRAF2 and TRAF6 in HEK293T cells, respectively [XREF_BIBR, XREF_BIBR]."

sparser
"On the other hand, over-expression of the H/N mutant CYLD potentiated TRAF-6 ubiquitination ( Fig. 3 C)."

reach
"In support of this notion, in vivo poly-ubiquitination assays demonstrate that depletion of beta-TRCP impaired TRAF6 self ubiquitination likely due to enhancement of TRAF6 deubiquitination by CYLD, concomitant with a reduction in beta-TRCP-dependent ubiquitination of CYLD and impairment of auto-phosphorylation of TRAF6-downstream kinase IKKalpha."

reach
"CYLD negatively regulates NF-kappaB activity by reducing TRAF6 autoubiquitination [XREF_BIBR, XREF_BIBR]."

reach
"CYLD also decreased IFN promotor activation by deubiquitinating TRAF2 and TRAF6 in HEK293 T cells, respectively [29,30]."

reach
"CYLD negatively regulated RANK signaling by inhibiting TRAF6 ubiquitination and activation of downstream signaling events in preosteoclasts XREF_BIBR."

reach
"Furthermore, CYLD negatively regulated RANK signaling by inhibiting TRAF6 ubiquitination and activation of downstream signaling events."

reach
"CYLD can inhibit NF-kappaB activity by deubiquitinating and inactivating TRAF2 and TRAF6, RIP, NEMO, and the NF-kappaB co-activator BCL-3."

reach
"The deubiquitinating enzymes such as cylindromatosis (CYLD) can inhibit the activation of MyD88 and TRIF dependent NF-kappaB by deubiquitinating TRAF6."

reach
"CYLD inhibits RANK signaling by deubiquitinating TRAF6, and CYLD requires the adaptor molecule p62 to interact with TRAF6 [XREF_BIBR]."
CYLD activates TRAF6.
| 7
CYLD activates TRAF6. 7 / 7
| 7

reach
"The deubiquitinating enzymes A20 and CYLD inhibit NF-kappaB signaling by targeting TRAF6 upstream of IKK, while a recent report shows that CUEDC2 inhibits IKK activity by recruiting a phosphatase PP1 and keeps IKK in an inactivated status."

reach
"CYLD has been shown to target TRAF6, TRAF2, and NEMO for deubiquitination, thus presumably reduced their activities in NF-kappaB activation."

reach
"40 RANKL stimulated osteoclastogenesis potently induces the expression of CYLD, and the accumulated CYLD targets TRAF6 by interacting with the adaptor protein, p62."

reach
"More importantly, we showed that TRAF-6-mediated over-expression of PAI-1 was inhibited by co-expression of wt-CYLD in S. p -infected A549 cells, suggesting that CYLD may target TRAF-6 in inhibiting P[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"It has been shown that the tumor suppressor CYLD targets TRAF6 for deubiquitination to terminate TLR triggered activation of NF-kappaB XREF_BIBR XREF_BIBR."

reach
"It has been demonstrated that the deubiquitinating enzymes A20 and CYLD inhibit NF-kappaB signaling by targeting TRAF6 upstream of IKK, while the deubiquitinating protein DUBA inhibits type I interferon activity by targeting TRAF3."

reach
"Thus, it is possible that CYLD functions in diverse pathways and loss of CYLD activity contributes to tumorigenesis via multiple mechanisms.Lys63-linked ubiquitin chains, synthesized in response to cy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
SPATA2 affects CYLD
8 | 1 25 47
SPATA2 binds CYLD.
8 | 1 16 44
8 | 1 8 30

sparser
"The binding of SPATA2CYLD or OTULIN to HOIP was shown to be mutually exclusive (Draber et al , xref ; Schlicher et al , xref )."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"LUBAC co-recruits SPATA2-CYLD to receptor signalling complexes where CYLD regulates Lys63-and Met1-Ub of substrates and thereby inflammatory and cell death signalling decisions [31, 33, 35, 57]."

sparser
"These results were corroborated by in vitro pull-downs and surface plasmon resonance (SPR), which revealed the CYLD-SPATA2 interaction to be high affinity (96 nM), and also showed no binding of the isolated B-box domain to SPATA2 ( xref C, 3D, xref D, and S3E)."

No evidence text available

sparser
"Our data indicate that CYLD-SPATA2, the IKK complex members, and WHIP itself are significantly enriched in isolates of endogenous UBASH3B. Using synthetic peptides spiked into the sample to perform absolute quantification of endogenously expressed proteins, we found that the binding of TNF-RSC components to UBASH3B was, with the exception of ubiquitin, highly substoichiometric ( xref )."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."

No evidence text available

sparser
"In line with the in vitro analysis, substitution of the conserved Tyr338 in the SPATA2 PIM to Ala (Y338A) or Phe (Y338F) largely abrogated the interaction of SPATA2 with HOIP in cells, without affecting SPATA2 binding to CYLD ( xref G)."

sparser
"The PUB domain of HOIP can also interact with SPATA2 that binds CYLD and thereby bridges this deubiquitinase to LUBAC (Elliott et al., xref ; Kupka et al., xref ; Schlicher et al., xref ; Wagner et al., xref )."
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD and PUB domain. 4 / 4
| 4

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

reach
"SPATA2 interacts with CYLD through its non canonical PUB domain, which binds the catalytic CYLD USP domain in a CYLD B-box-dependent manner."

reach
"The strongest effect on CYLD binding was observed when we mutated Tyr114, which points away from the PIM pocket (XREF_FIG E and 2G), supporting that CYLD binds the SPATA2 PUB domain in a PIM independent manner."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
SPATA2 activates CYLD.
| 7 3
SPATA2 activates CYLD. 10 / 14
| 7 3

reach
"Consistently, increased pro-inflammatory signaling in Cyld -/- Spata2 -/- cells depends on the presence of OTULIN."

reach
"To directly address if SPATA2 mediates the ability of CYLD to regulate baseline NF-kappaB activity, we ectopically expressed CYLD in WT, CYLD KO, and SPATA2 KO cells."

reach
"The location of the SPATA2 binding site at the back of the palm domain suggests that SPATA2 activates CYLD in a distinct manner."

sparser
"SPATA2 Activates CYLD."

reach
"Finally, the finding that SPATA2 activates CYLD adds SPATA2 to the growing list of allosteric DUB activators."

reach
"SPATA2 promotes CYLD activity and regulates TNF induced NF-kappaB signaling and cell death."

sparser
"Finally, the finding that SPATA2 activates CYLD adds SPATA2 to the growing list of allosteric DUB activators."

sparser
"The location of the SPATA2 binding site at the back of the palm domain suggests that SPATA2 activates CYLD in a distinct manner."

reach
"SPATA2 Links CYLD to LUBAC, Activates CYLD, and Controls LUBAC Signaling."

reach
"SPATA2 Activates CYLD."
SPATA2 inhibits CYLD.
| 2
SPATA2 inhibits CYLD. 2 / 4
| 2

reach
"The fact that KO of SPATA2 already prevents association of CYLD with the TNFR1 (XREF_FIG D) indicates that SPATA2L can not simply substitute for SPATA2, at least in the cellular systems tested."

reach
"SPATA2 restricts OTULIN-dependent LUBAC activity independently of CYLD."
| 6 79
CYLD activates apoptotic process.
| 5 56
| 5 56

eidos
"Yin et al. reported that CYLD could increase apoptosis and decrease autophagy to improve the chemosensitivity to gemcitabine in bladder cancer [ 26 ] ."

reach
"In the present study, CYLD overexpression inhibited cell growth and promoted cell apoptosis in colon cancer cells, while the expression levels of p-p65 and p65 were decreased and those of p-IkappaBalpha and IkappaBalpha were increased."

reach
"Increasing CYLD promotes apoptosis and increasing PNUTL enhances cell death via TGF."

reach
"Additionally, we observed that the CYLD specific promotion of NPC cell apoptosis was reversed by NDRG1 silencing (XREF_FIG and XREF_FIG)."

eidos
"Previous studies have also revealed that CYLD suppression leads to decreased apoptosis and increased proliferation by activating NF-kappaB [ 23 , 65 ] ."

reach
"This results in inhibition of NF-kappaB activation and loss of CYLD is shown to inhibit apoptosis."

reach
"We found that CYLD levels were significantly decreased in both NPC tissues and cell lines, and that CYLD overexpression inhibited NPC cell proliferation and promoted apoptosis."

reach
"The results demonstrated that miR-454 downregulated CYLD mRNA and protein expression which increased the apoptosis rate of cancer cells."

reach
"In this study, we demonstrated that CYLD expression is downregulated in NPC tissues, and that CYLD overexpression inhibits NPC cell proliferation and promotes apoptosis, whereas CYLD knockdown reverses these effects in NPC cells."

reach
"Another finding of this study is the increased rate of apoptosis induced by CYLD WT both in tumoral and non tumoral human keratinocytes."
| 1 23

reach
"Reversely, overexpression of CYLD could promote cell apoptosis, whereas inhibiting cell proliferation and antibody production."

reach
"Here we show that genetic deficiency of Cyld, a recently identified deubiquitinating enzyme, attenuates the early wave of germ cell apoptosis and causes impaired spermatogenesis in mice."

reach
"CYLD (C/S) tumors are also characterized by their elevated proliferation rate and decreased apoptosis."

reach
"Ablation of CYLD, NFKBIA, TRAF2, or TRAF3 induces hyperactivation of the canonical and/or noncanonical NF-kappaB pathways and subsequently diminishes CC-122-induced apoptosis in 5 of 6 DLBCL cell lines."

reach
"This was demonstrated by the findings that knockdown of CYLD resulted in upregulation of RIPK1 that was associated with enhancement in K63 linked polyubiquitination of the protein and that co-knockdown of RIPK1 diminished CYLD knockdown induced apoptosis in sensitive cells."

reach
"Furthermore, we uncovered a dual function of CYLD in the pathogenesis of ECM : (i) CYLD impaired activation of PKC-theta and NF-kappaB in CD8 + T cells and (ii) CYLD promoted apoptosis of endothelial cells, thereby augmenting brain pathology and preventing survival during ECM."

reach
"Since the proapoptotic function of RIPK1 can be prevented by phosphorylation of Ser320 or Ser25 XREF_BIBR, we introduced the RIPK1 mutant with Ser320 or Ser25 constitutively phosphorylated into Mel-CV and ME1007 cells to test whether it impinges on apoptosis induced by silencing of CYLD."

reach
"A previous study reported that CYLD inhibits cell proliferation and apoptosis resistance in triple negative breast cancer."

reach
"As Fas associated protein with death domain (FADD), cellular inhibitor of apoptosis 1 (cIAP1), and cIAP2 are all known to regulate RIPK1 mediated apoptosis XREF_BIBR, we compared the expression levels of FADD, cIAP1, and cIAP2 between Mel-FH and Mel-CV cells that displayed different sensitivity to apoptosis induced by silencing of CYLD."

reach
"To our surprise, amputation induced apoptosis was increased by RNAi of tak1 or p38-1, and decreased by RNAi of cyld-1 (XREF_FIG)."
CYLD affects TRAF2
9 2 7 1 1 | 39 21
CYLD binds TRAF2.
7 1 | 13 18
7 1 | 13 15

No evidence text available

reach
"TNFalpha treatment increases the binding between PrP and the deubiquitinase tumor suppressor cylindromatosis (CYLD), in these treated cells, binding of CYLD to RIP1 and TRAF2 is reduced."

sparser
"Thus, the loss of HSC dormancy that occurs in these mice is most likely solely caused by an impaired CYLDTRAF2 interaction."

reach
"Recently, it was reported that CYLD directly interacts with NEMO and IKKgamma and TRAF2 in the NF-kappaB signaling pathway."

No evidence text available

No evidence text available

sparser
"This phenotype is dependent on the interactions between CYLD and its substrate TRAF2 (tumor necrosis factor–associated factor 2)."

reach
"CYLD interacts directly with TRAF2, an adaptor molecule involved in signaling by members of the family of TNF and nerve growth factor receptors."

No evidence text available

reach
"It was also shown that CYLD, a de-ubiquitinase known to remove K63 linked polyubiquitin chains from other proteins, binds TRAF2 [68]."
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
CYLD ubiquitinates TRAF2.
9 | 8 1
CYLD ubiquitinates TRAF2. 9 / 10
| 8 1

reach
"We show that CYLD binds to the NEMO (also known as IKKgamma) component of the IkappaB kinase (IKK) complex, and appears to regulate its activity through de-ubiquitination of TRAF2, as TRAF2 ubiquitination can be modulated by CYLD."

reach
"CYLD mediated regulation of the JNK signaling pathway appears to target TRAF2 ubiquitylation, as CYLD knockdown increases both TRAF2 ubiquitylation and JNK activation, further enhancing cell survival [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CYLD also decreased IFN promotor activation by deubiquitinating TRAF2 and TRAF6 in HEK293T cells, respectively [XREF_BIBR, XREF_BIBR]."

sparser
"Ubiquitination of TRAF2 by CYLD was found to be nearly abolished in the presence of a dominant negative ubiquitin-specific protease mutant deficient in CYLD ( xref )."

reach
"A20 also suppresses necroptosis by deubiquitinating RIPK3 at K5, whereas CYLD mediates necroptotic effects by deubiquitinating TNF receptor associated factor 2 (TRAF2)."

reach
"Ubiquitination of TRAF2 by CYLD was found to be nearly abolished in the presence of a dominant negative ubiquitin specific protease mutant deficient in CYLD."

reach
"CYLD knockdown by siRNA results in constitutive ubiquitination of TRAF2."

reach
"CYLD also decreased IFN promotor activation by deubiquitinating TRAF2 and TRAF6 in HEK293 T cells, respectively [29,30]."

reach
"CYLD can inhibit NF-kappaB activity by deubiquitinating and inactivating TRAF2 and TRAF6, RIP, NEMO, and the NF-kappaB co-activator BCL-3."
CYLD ubiquitinates TRAF2 on lysine. 9 / 9
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CYLD deubiquitinates TRAF2.
1 1 | 16
CYLD deubiquitinates TRAF2. 10 / 18
1 1 | 16

"Cyld also interacts directly with tumour-necrosis factor receptor (tnfr)-associated factor 2 (traf2), an adaptor molecule involved in by members of the family of tnf/nerve growth factor receptors. (articolo-abstract)"

reach
"Using an shRNA approach, Brummelkamp et al. showed that CYLD inhibits NF-kappaB signaling by counteracting TRAF2 ubiquitination [XREF_BIBR]."

reach
"The steady state association of TRAF2 with MLKL was diminished upon TNF induced necroptosis induction, and this correlated with CYLD dependent deubiquitylation of TRAF2."

reach
"Numerous studies in vitro and in vivo have validated that CYLD mediates NF-κB activation by deubiquitinating TRAF2, TRAF6, and NEMO, making it an important regulator in the adaptive immune response."

reach
"The Cylindroma tumour suppressor protein (CYLD) de-ubiquitinates NEMO and TRAF2 [XREF_BIBR - XREF_BIBR], while USP15 reverses betaTRCP mediated ubiquitination of IkappaBalpha [XREF_BIBR]."

reach
"Here we described that the adenoviral vector expressing CYLD (Ad/hTERT-CYLD) augmented the cytotoxicity of TRAIL in HCC cells by negatively regulating NF-kappaB activity since CYLD could reverse the ubiquitination of TNF receptor associated factor 2 (TRAF2) and interact with the IkappaB kinasegamma (IKKgamma)."

reach
"Contributing to the " death signal ", CYLD deubiquitylates TRAF2 and RIPK1, allowing the formation of the ripoptosome."
| PMC

reach
"Another example is already mentioned CYLD, which is an important inflammatory mediator that deubiquitinates TRAF2 and TRAF6, resulting in negative regulation of the NF-kappaB pathway [XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR]."

reach
"Because the target of CYLD in the NF-kappaB pathway is known to be deubiquitination of TRAF2, we also confirmed the deubiquitination of TRAF2 by CYLD in ECs."

"We conclude that PrP traps CYLD, preventing it from binding and deubiquitinating RIP1 and TRAF2."
CYLD inhibits TRAF2.
1 | 2 2
CYLD inhibits TRAF2. 5 / 8
1 | 2 2

reach
"CYLD also inhibits TRAF2 and NEMO (NF-kappaB essential modulator, a regulatory subunit of IKK), and blocks NF-kappaB signaling downstream to TLR activation [176] [177] [178]."
| DOI

"Cyld also interacts directly with tumour-necrosis factor receptor (tnfr)-associated factor 2 (traf2), an adaptor molecule involved in by members of the family of tnf/nerve growth factor receptors. (articolo-abstract)"

reach
"Similarly, de-ubiquitinating enzyme cylindromatosis (CYLD) inhibits NF-kappaB signaling via de-ubiquitination and inactivation of TNFR associated factor 2 (TRAF2) and TRAF6 [XREF_BIBR, XREF_BIBR]; de-ubiquitinating protease A20 inhibits NF-kappaB activation induced by Toll like receptor 4 (TLR4) via removing K63 linked polyubiquitin chains of TRAF6 [XREF_BIBR]."

sparser
"Similarly to active-site C601 CYLD mutants ( Trompouki et al. , 2003 ; this work), CYLD-D681G was unable to inhibit TRAF2- or TRAF6-mediated activation of NF- κ B and TNF α activation of JNK, and to[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"CYLD also inhibits TRAF2 and NEMO (NF-κB essential modulator, a regulatory subunit of IKK), and blocks NF-κB signaling downstream to TLR activation [176] [177] [178] ."
| DOI
RNF31 affects CYLD
8 | 24 43
8 | 23 21

reach
"Here, we identify SPATA2 as a constitutive direct binding partner of HOIP that bridges the interaction between CYLD and HOIP."

sparser
"However, the binding systems differ in that OTULIN directly binds to HOIP via the PIM motif of OTULIN [ xref , xref , xref ], whereas CYLD interacts with HOIP through spermatogenesis-associated 2 (SPATA2) [ xref , xref , xref , xref ]."
| PMC

reach
"Unexpectedly, CYLD was recently reported to interact with HOIP, the catalytic subunit of LUBAC, and to inhibit LUBAC dependent activation of NF-kappaB."

reach
"Interestingly, CYLD also binds the HOIP PUB and B-box domains despite lacking a discernible PIM."

reach
"Together, these results show that CYLD and OTULIN interact with HOIP via the same or an overlapping site and that HOIP 's interactions with CYLD and OTULIN are mutually exclusive."

sparser
"In this study, we report that HOIP also interacts with the deubiquitinase CYLD but that CYLD does not regulate ubiquitination of LUBAC components."

sparser
"SPATA2 mediates the recruitment of CYLD to immune receptor complexes by bridging the interaction of CYLD with the linear ubiquitylation assembly complex (LUBAC) component HOIP."

No evidence text available

reach
"We here show that CYLD interacts with HOIP via spermatogenesis associated protein 2 (SPATA2)."

No evidence text available
| 15

sparser
"Concomitant Loss of OTULIN and CYLD Interaction with HOIP Increases M1 Ubiquitination at the TNF-RSC and Enhances TNF-Induced Gene Activation."

sparser
"HOIP interacts with both CYLD and OTULIN even in unstimulated cells."

sparser
"Mutually Exclusive Binding of CYLD and OTULIN to HOIP Causes CYLD-Selective Recruitment to SCs."

sparser
"The HOIP missense mutation affects the conserved PUB domain of HOIP ( xref ), which has recently been shown to be important for the interaction of HOIP with OTULIN and CYLD, two deubiquitinases ( xref ; xref ; xref )."

sparser
"Additionally, we used a HOIP-PUB domain point mutant (N102A), which abolishes the interaction of both OTULIN and CYLD with HOIP ( xref , xref )."

sparser
"In line with recent reports ( xref , xref , xref , xref , xref ), our data showed that prior to stimulation, both CYLD and OTULIN interacted with HOIP ( xref B–S1D)."

sparser
"In contrast to these findings, Draber et al. demonstrated that, although both OTULIN and CYLD interact with HOIP under basal conditions, OTULIN is absent from RSCs [ xref ] (Fig.  xref ) and that knock-out of OTULIN resulted in an increase of Met1-linked poly-Ub chains in the cytosol but not at TNFR1 or NOD2 RSCs [ xref ]."

sparser
"The explanation was provided by our discovery that HOIP cannot simultaneously bind OTULIN and CYLD as both require HOIP-Asn102 for binding."

sparser
"An interaction between HOIP and OTULIN or CYLD at first inspection would seem contradictory, as a futile energy-consuming cycle would exist."

sparser
"This suggested that steric hindrance may prevent simultaneous interaction of HOIP with CYLD and OTULIN."
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
CYLD affects SPATA2
8 | 1 16 44
8 | 1 8 30

sparser
"The binding of SPATA2CYLD or OTULIN to HOIP was shown to be mutually exclusive (Draber et al , xref ; Schlicher et al , xref )."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"LUBAC co-recruits SPATA2-CYLD to receptor signalling complexes where CYLD regulates Lys63-and Met1-Ub of substrates and thereby inflammatory and cell death signalling decisions [31, 33, 35, 57]."

sparser
"These results were corroborated by in vitro pull-downs and surface plasmon resonance (SPR), which revealed the CYLD-SPATA2 interaction to be high affinity (96 nM), and also showed no binding of the isolated B-box domain to SPATA2 ( xref C, 3D, xref D, and S3E)."

No evidence text available

sparser
"Our data indicate that CYLD-SPATA2, the IKK complex members, and WHIP itself are significantly enriched in isolates of endogenous UBASH3B. Using synthetic peptides spiked into the sample to perform absolute quantification of endogenously expressed proteins, we found that the binding of TNF-RSC components to UBASH3B was, with the exception of ubiquitin, highly substoichiometric ( xref )."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."

No evidence text available

sparser
"In line with the in vitro analysis, substitution of the conserved Tyr338 in the SPATA2 PIM to Ala (Y338A) or Phe (Y338F) largely abrogated the interaction of SPATA2 with HOIP in cells, without affecting SPATA2 binding to CYLD ( xref G)."

sparser
"The PUB domain of HOIP can also interact with SPATA2 that binds CYLD and thereby bridges this deubiquitinase to LUBAC (Elliott et al., xref ; Kupka et al., xref ; Schlicher et al., xref ; Wagner et al., xref )."
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD and PUB domain. 4 / 4
| 4

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

reach
"SPATA2 interacts with CYLD through its non canonical PUB domain, which binds the catalytic CYLD USP domain in a CYLD B-box-dependent manner."

reach
"The strongest effect on CYLD binding was observed when we mutated Tyr114, which points away from the PIM pocket (XREF_FIG E and 2G), supporting that CYLD binds the SPATA2 PUB domain in a PIM independent manner."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
CYLD affects IKBKG
2 11 1 1 | 38 18
CYLD binds IKBKG.
11 1 | 23 17
11 1 | 23 14

reach
"NEMO, another potential adaptor of CYLD, directly binds CYLD and associates with various IKK regulators, such as RIP1 and TRAF2 [XREF_BIBR]."

sparser
"Interestingly, the association of CYLD with IKKγ coincides with the appearance of a phosphorylated form of CYLD, though it has not been shown that this modification is required for interaction and deubiquitinating activities xref ."

No evidence text available

reach
"Three independent studies have recently shown that CYLD binds to NEMO and facilitates the disassembly of K63 linked polyubiquitin chains on TRAF2, TRAF6 and NEMO [22 ** -24 **]."

reach
"However, the SUMOylation effectively impairs the interaction between NEMO and CYLD, suggesting that the SUMO-moiety (~ 12 kDa) might directly mask the binding surface."

sparser
"Strikingly, GST-CYLD (470–684 aa) could pull down neither the NEMO-SUMO-3 nor the SUMOylated NEMO ( xref , left panel and xref ), whereas GST-IKKβ (644–756 aa) could pull down both the NEMO-SUMO-3 and the SUMOylated NEMO ( xref , right panel and xref ), indicating that the SUMO-3 modification specifically impaired the interaction between NEMO and CYLD."

reach
"Removal of Lys-63-chains from TRAFs requires that CYLD physically (and transiently) interact with NEMO, e.g. in response to TNF-alpha stimulation."

No evidence text available

reach
"For example, CYLD directly associates and deubiquitinates NEMO and TRAF-6, thus inhibiting TNF-alpha-induced nuclear factor-kappaB (NF-kappaB) signaling [13,15-17]."

sparser
"Following TLR signaling, NF-κB essential modifier (NEMO/IKKγ) undergoes SUMO-2/3 modification, which prevents NEMO binding to the deubiquitinase CYLD and thus indirectly enhancing the IKK activation."
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
CYLD deubiquitinates IKBKG.
2 1 | 10
CYLD deubiquitinates IKBKG. 10 / 11
1 | 10

reach
"To confirm that Tax- or TRAF6 induced polyubiquitination of NEMO is blocked by CYLD expression, NEMO and an HA tagged ubiquitin mutant (HA-K63Ub) were co-expressed with Tax or TRAF6 in the presence or[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"When transfected into mammalian cells, CYLD deubiquitinates NEMO as well as several IKK upstream regulators, including TRAF2, TRAF6, TRAF7, RIP1, and Tak1."

"Other identified CYLD substrates include TNF receptor associated factor 7 (TRAF7), TRAF interacting protein (TRIP), transforming growth factor beta-activated kinase 1 (TAK1), NF-kappa-B essential modifier (NEMO), lymphocyte cell specific protein-tyrosine kinase (LCK), receptor-interacting protein 1 (RIP1), retinoic acid inducible gene (RIG), and polo-like kinase 1 (PLK1)"

reach
"CYLD deubiquitinates NEMO, thus decreasing its stability and preventing the IKK complex from phosphorylating IkappaB, and NF-kappaB activation."

reach
"Deubiquitinating enzyme CYLD inhibits NEMO linear ubiquitination, possibly by disassembling both K63 linked and linear polyubiquitin."

reach
"Numerous studies in vitro and in vivo have validated that CYLD mediates NF-κB activation by deubiquitinating TRAF2, TRAF6, and NEMO, making it an important regulator in the adaptive immune response."

reach
"The Cylindroma tumour suppressor protein (CYLD) de-ubiquitinates NEMO and TRAF2 [XREF_BIBR - XREF_BIBR], while USP15 reverses betaTRCP mediated ubiquitination of IkappaBalpha [XREF_BIBR]."

reach
"CYLD also deubiquitinates IkappaB kinase gamma (IKKgamma, also known as NEMO), the regulatory subunit of IKK thus inhibiting the activation of IKK."

reach
"CYLD physically interacts with and deubiquitinates NEMO, thereby negatively regulating NF-kappaB activation [XREF_BIBR]."

reach
"CYLD can deubiquitinate NEMO, preventing it from causing phosphorylation of IkB, thereby killing the signal [XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR]."
CYLD deubiquitinates IKBKG on K285. 2 / 2
2 |

No evidence text available

No evidence text available
CYLD ubiquitinates IKBKG.
| 4
CYLD leads to the ubiquitination of IKBKG. 4 / 4
| 4

reach
"CYLD can inhibit NF-kappaB activity by deubiquitinating and inactivating TRAF2 and TRAF6, RIP, NEMO, and the NF-kappaB co-activator BCL-3."

reach
"The effect appears to be related to inhibition of IKKgamma ubiquitination mediated by cIAP1 rather than to stimulation of IKKgamma deubiquitination by the deubiquitinases A20 and CYLD (cylindromatosis)."

reach
"CYLD, a deubiquitinating enzyme that targets both M1- and K63 linked ubiquitin chains, is recruited to TNF-RSC to negatively regulate ubiquitinations of RIPK1, TNFR1, NEMO and TRADD to attenuate the NF-kappaB pathway and promote both apoptosis and necroptosis."

reach
"Expression of CYLD significantly reduced K63 polyubiquitination of NEMO induced by either Tax or TRAF6."
CYLD inhibits IKBKG.
| 1 1
CYLD inhibits IKBKG. 2 / 4
| 1 1

sparser
"CYLD also inhibits TRAF2 and NEMO (NF-κB essential modulator, a regulatory subunit of IKK), and blocks NF-κB signaling downstream to TLR activation [176] [177] [178] ."
| DOI

reach
"CYLD also inhibits TRAF2 and NEMO (NF-kappaB essential modulator, a regulatory subunit of IKK), and blocks NF-kappaB signaling downstream to TLR activation [176] [177] [178]."
| DOI
CYLD affects AKT
| 47 4
CYLD inhibits AKT.
| 12
CYLD inhibits AKT. 10 / 26
| 12

reach
"Overexpression of CYLD, a DUB for K63 linked ubiquitination of AKT, decreases AKT activity mediated by TRAF6 [XREF_BIBR]."

reach
"Thus, we next explored the possibility that CYLD may inhibit Akt mediated fibrotic response via deubiquitinating TRAF6."

reach
"In search of underlying molecular mechanisms, we find that CYLD knockout mice display marked overactivation of Akt and mTOR and reduced autophagic flux, and conversely, CYLD overexpression potently suppresses Akt and mTOR activity and promotes autophagy."

reach
"On the other hand, the deubiquitinating enzyme CYLD and ubiquitin specific peptidase 1 can remove K63-linked polyubiquitin chains on Akt and then inhibit Akt activation [105, 106]."

reach
"Taken together, these data provide strong evidence that CYLD negatively regulates Akt by directly interacting with and deubiquitinating K63 polyubiquitinated Akt, both in vitro in a cell-free system and in vivo under endogenous condition."

reach
"The results indicated that lncRNA CRAL could sponge miRNA-505 to upregulate the cylindromatosis gene (CYLD) expression, which subsequently inhibited AKT activation and resulted in an enhancement in the sensitivity of GC cells to DDP 71."

reach
"To further determine how CYLD negatively regulates Akt, we first examined whether CYLD physically interacts with Akt by performing co-immunoprecipitation experiments."

reach
"Furthermore, the results indicated that CRAL mainly resided in the cytoplasm and could sponge endogenous miR-505 to upregulate cylindromatosis (CYLD) expression, which further suppressed AKT activation and led to an increase in the sensitivity of gastric cancer cells to cisplatin in vitro and in preclinical models."

reach
"These results suggest that CYLD suppresses Akt activation to inhibit prostate cancer cells growth and development."

reach
"Nonetheless, these data demonstrate that CYLD indeed inhibits Akt mediated fibrotic response by at least in part directly interacting with and deubiquitinating Akt."
CYLD binds AKT.
| 16 4
| 16 4

reach
"In this study we provided experimental evidences for direct interaction between Akt and CYLD, and also showed that CYLD does directly deubiquitinate Akt under both endogenous and exogenous conditions."

reach
"We next determined whether Akt associates with CYLD."

sparser
"As shown in xref , endogenous CYLD indeed directly interacts with endogenous Akt and S. pneumoniae treatment increased their direct interaction."

reach
"Moreover, we found that endogenous Akt interacted with CYLD under serum starved conditions in a reciprocal immunoprecipitation assay (XREF_FIG)."

reach
"The finding that CYLD interacts with Akt and suppresses ubiquitination of Akt prompted us to determine whether CYLD prevents phosphorylation of Akt in response to growth factor stimulation."

reach
"CYLD interacts with and keeps Akt in a hypoubiquitinated and inactive stage by directly removing Akt ubiquitination under serum starvation conditions."

reach
"As shown in XREF_FIG, endogenous CYLD indeed directly interacts with endogenous Akt and S. pneumoniae treatment increased their direct interaction."

reach
"We next determined whether endogenous CYLD directly interacts with endogenous Akt and if such a direct interaction is further increased on S. pneumoniae treatment by performing Duolink in vivo protein protein interaction detection assay XREF_BIBR XREF_BIBR and co-immunoprecipitation assay."

reach
"These results suggest that CYLD interacts with Akt under serum starvation conditions and dissociates from Akt upon growth factor stimulation, which may allow E3 ligases to bind to and ubiquitinate Akt."

reach
"Because IGF-1 disrupts the interaction between Akt and CYLD, we also determined whether phosphorylation of Akt attenuated (or disrupted) its interaction with CYLD."
CYLD deubiquitinates AKT.
| 8
CYLD deubiquitinates AKT. 8 / 8
| 8

reach
"Because CYLD suppresses ubiquitination and activation of Akt, it is possible that CYLD may also inhibit cancer cell proliferation and survival."

reach
"To determine whether CYLD is a direct DUB for Akt, we performed in vitro deubiquitination assays and found that deubiquitination of Akt was mediated by wild-type CYLD but not the C601A mutant (XREF_FIG)."

reach
"Because CYLD is a known deubiquitinase and Akt ubiquitination is critical for its functional activity XREF_BIBR, we next investigated whether CYLD deubiquitinates Akt."

reach
"In this study we provided experimental evidences for direct interaction between Akt and CYLD, and also showed that CYLD does directly deubiquitinate Akt under both endogenous and exogenous conditions."

reach
"Among the DUBs, only CYLD effectively reduced the ubiquitination of Akt (XREF_FIG and XREF_SUPPLEMENTARY)."

reach
"Both E3 ligases TRAF6 [158] and Skp2 [159] regulate Akt activity through K63 linked ubiquitination while CYLD promotes deubiquitination of Akt [160]."

reach
"Reversely, CYLD negatively regulates Akt signaling by deubiquitinating Akt in TGFbeta signaling [XREF_BIBR]."

reach
"CYLD repression by miR-130b restores Akt ubiquitination and activation, GSK3beta and FoxO3a phosphorylation, FoxO3a removal from Bim promoter as well as Bim downregulation during 6-OHDA administration."
CYLD activates AKT.
| 5
CYLD activates AKT. 5 / 7
| 5

reach
"Lim and co-workers showed that CYLD suppresses TGF-beta signalling and prevents lung fibrosis by (indirectly) reducing the stability of Smad3, in an AKT, GSK3beta and E3 ligase carboxy terminus of Hsc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"To determine whether CYLD inhibits cell proliferation and survival by suppressing activation of Akt, we performed cell proliferation and apoptosis assays on control and CYLD-knockdown prostate cancer cells treated with or without the PI3K inhibitors LY294002 or wortmannin."

reach
"Overall, YTHDC2 inhibited cell proliferation and induced apoptosis in PTC cells by regulating CYLD-mediated inactivation of Akt pathway."

reach
"CYLD decreases Smad3 stability by inhibiting Akt."

reach
"Together, these data suggest that CYLD decreases Smad3 stability and TGF-beta-signalling by inhibiting Akt."
CYLD ubiquitinates AKT.
| 3
CYLD leads to the ubiquitination of AKT. 3 / 3
| 3

reach
"Indeed, Cyld -/- MEFs displayed higher basal phosphorylation of Akt (at 0 min) and slightly enhanced IGF-1 mediated phosphorylation of Akt compared to wild-type MEFs (XREF_FIG), which correlated with the increased basal ubiquitination of Akt caused by Cyld deficiency (XREF_FIG)."

reach
"CYLD dissociated from Akt upon growth factor stimulation, thereby allowing E3 ligases to induce ubiquitination and activation of Akt."

reach
"We next determined whether CYLD deficiency promotes ubiquitination of endogenous Akt in response to IGF-1 stimulation."
CYLD dephosphorylates AKT.
| 3
CYLD leads to the dephosphorylation of AKT. 3 / 3
| 3

reach
"The finding that CYLD interacts with Akt and suppresses ubiquitination of Akt prompted us to determine whether CYLD prevents phosphorylation of Akt in response to growth factor stimulation."

reach
"CYLD repression by miR-130b restores Akt ubiquitination and activation, GSK3beta and FoxO3a phosphorylation, FoxO3a removal from Bim promoter as well as Bim downregulation during 6-OHDA administration."

reach
"Conversely, restoration of wild-type CYLD, but not the C601A mutant, into CYLD knockdown cancer cells reversed IGF-1-induced phosphorylation of Akt, suggesting that the enzymatic activity of CYLD plays a critical role in suppressing growth factor induced phosphorylation of Akt (XREF_FIG)."
IKK_complex affects CYLD
| 40 22 6
IKK_complex phosphorylates CYLD.
| 30 18 6
IKK_complex phosphorylates CYLD. 10 / 43
| 26 15 2

sparser
"IKK family kinases phosphorylate CYLD in the ATLL MT4 cell line."

sparser
"Additionally, in primary adult T-cell leukemia/lymphoma (ATLL) samples and cell lines, increased IKK-induced CYLD phosphorylation was observed."

reach
"IKKɛ also phosphorylates and inactivates the tumor suppressor CYLD, preventing CYLD from deubiquitinating specific substrates in the NF-κB signaling pathway."

reach
"To examine if IKK directly phosphorylates CYLD, 0.25 mug of purified CYLD was incubated with purified IKKbeta, at a final concentration of 15 nM, in medium containing 1mM EGTA, 5 mM MgCl 2, 50 mug/uL leupeptin, 2.5 mM DTT, 1 mg/mL BSA, 6.5% glycerol, in 20 mM HEPES, pH 7.4, with or without 100 muM ATP in a final volume of 20 muL at 37degreesC for one hour."

reach
"Interestingly, TBK1 or IKKε specifically causes CYLD to shift to higher molecular bands, suggesting phosphorylation of CYLD by these kinases."

sparser
"These results suggest that IKK phosphorylates CYLD at the PSD under basal condition."

reach
"These results suggest that IKK phosphorylates CYLD at the PSD under basal condition."

reach
"CYLD interacts with NEMO and is phosphorylated by IKK as a mechanism to inactivate CYLD DUB activity."

sparser
"Therefore, IKK phosphorylates CYLD to inactivate its DUB function thus providing a window of NF-κB activation prior to signal-induced termination by A20."

reach
"Phosphorylation of the tumor suppressor CYLD by the breast cancer oncogene IKK."
IKK_complex phosphorylates CYLD on S436. 4 / 4
| 1 3

rlimsp
"Notably, among the four reported IKK phosphorylation sites [34] (S418, S422, S432 and S436) that may create two putative β-TRCP binding motifs (Figure 3E), mutating both phospho-degrons of CYLD abolished the interaction between CYLD and β-TRCP (Figures 3D-E)."

rlimsp
"These results support the notion that phosphorylation of CYLD by IKK at Ser432 and Ser436 is associated with β-TRCP-mediated poly-ubiquitination and subsequent degradation of CYLD."

rlimsp
"Here, we report that SCFβ-TRCP regulates the ubiquitination and degradation of CYLD, a process dependent on prior phosphorylation of CYLD at Ser432/Ser436 by IKK."

sparser
"These results support the notion that phosphorylation of CYLD by IKK at Ser432 and Ser436 is associated with β-TRCP-mediated poly-ubiquitination and subsequent degradation of CYLD."
IKK_complex phosphorylates CYLD on S432. 3 / 3
| 1 1 1

sparser
"These results support the notion that phosphorylation of CYLD by IKK at Ser432 and Ser436 is associated with β-TRCP-mediated poly-ubiquitination and subsequent degradation of CYLD."

reach
"These results support the notion that phosphorylation of CYLD by IKK at Ser432 and Ser436 is associated with beta-TRCP-mediated poly-ubiquitination and subsequent degradation of CYLD."

rlimsp
"In further support of this finding, mutating Ser432 and Ser436 to Alanine abolished IKK-dependent, β-TRCP-mediated poly-ubiquitination of CYLD in 293T cells (Figure 3H). Together, these results demonstrate that IKK-mediated phosphorylation of Ser432 and Ser436 might play a pivotal role in triggering SCFβ-TRCP-dependent CYLD poly-ubiquitination."
IKK_complex phosphorylates CYLD on S418. 2 / 2
| 2

reach
"Moreover, IKKepsilon, a noncanonical IKK family member, phosphorylates CYLD at serine 418 and reduces its deubiquitinase activity, leading to induction of oncogenic transformation [XREF_BIBR]."

reach
"Conversely, IKKɛ directly phosphorylates CYLD at Ser418, hereby decreasing its deubiquitinating potential but increasing the IKKɛ-induced cell transformation [41] (Fig. 3) (see Section 6)."
IKK_complex phosphorylates CYLD on serine. 2 / 2
| 1 1

sparser
"Indeed, CYLD is phosphorylated on multiple serine residues in a stimulus-dependent manner by IKK [ xref ]."

reach
"Indeed, CYLD is phosphorylated on multiple serine residues in a stimulus dependent manner by IKK [XREF_BIBR]."
IKK_complex binds CYLD.
| 3 3
| 3 3

sparser
"It will be interesting to examine whether the binding of CYLD to the IKK regulators is dependent on NEMO."

reach
"We show that CYLD binds to the NEMO (also known as IKKgamma) component of the IkappaB kinase (IKK) complex, and appears to regulate its activity through de-ubiquitination of TRAF2, as TRAF2 ubiquitination can be modulated by CYLD."

sparser
"Biochemical and genetic evidence suggests that IKK is a kinase that mediates CYLD phosphorylation. xref As CYLD physically interacts with the IKK regulatory subunit, NEMO, it is likely that CYLD is recruited to the IKK holoenzyme by NEMO."

reach
"It will be interesting to examine whether the binding of CYLD to the IKK regulators is dependent on NEMO."

sparser
"Thus, future work should examine how the interaction of CYLD and IKK fits into overall landscape of IKK-mediated neuronal function and pathology."

reach
"Thus, future work should examine how the interaction of CYLD and IKK fits into overall landscape of IKK mediated neuronal function and pathology."
IKK_complex inhibits CYLD.
| 4 1
| 4 1

reach
"On the contrary, ectopic expression of IKK significantly reduced CYLD protein abundance in 293T cells ectopically expressing HA tagged CYLD."

reach
"IKK blockade reactivates CYLD, as evidenced by the reduction in RIPK1 ubiquitination, which leads to the association of RIPK1 with the death inducing signaling complex (DISC) to trigger cell death."

reach
"IKK blockade reactivated CYLD, as evidenced by the reduction in RIPK1 ubiquitination, which led to the association of RIPK1 with the DISC, triggering cell death."

reach
"IKK blockade reactivates CYLD, as evidenced by the reduction in RIPK1 ubiquitination, which leads to the association of RIPK1 with the death-inducing signaling complex (DISC) to trigger cell death."

sparser
"Reiley et al have shown that NEMO is required for the IKK complex to phosphorylate and inhibit the deubiquitinase CYLD [ xref ], a critical component of the necrotic machinery [ xref ], as can the TNF-inducible IKKε [ xref ]."
IKK_complex ubiquitinates CYLD.
| 3
IKK_complex ubiquitinates CYLD. 3 / 3
| 3

reach
"Together, these results demonstrate that IKK mediated phosphorylation of Ser432 and Ser436 might play a pivotal role in triggering SCF beta-TRCP -dependent CYLD poly-ubiquitination."

reach
"Here, we report that SCF beta-TRCP regulates the ubiquitination and degradation of CYLD, a process dependent on prior phosphorylation of CYLD at Ser432 and Ser436 by IKK."

reach
"IKK promotes CYLD ubiquitination and subsequent degradation."
CYLD affects MAP3K7
2 1 | 2 57 4
CYLD inhibits MAP3K7.
| 2 28
| 2 26

reach
"This is explained by loss of CYLD mediated TAK1 K63 deubiquitination [XREF_BIBR], which suppresses TAK1 activation in wild-type lymphocytes (XREF_FIG)."

reach
"Genetic deletion of CYLD or ITCH, essential ubiquitin regulators for TAK1 deactivation, causes strong and sustained TAK1 activation with enhanced production of tumor promoting proinflammatory cytokines that mediate liver fibrosis, tumor development, and metastasis [XREF_BIBR, XREF_BIBR]."

reach
"161 Cylindromatosis (CYLD) has been shown to inhibit NFkappaB activation 160 and more recent results indicate that this inhibition might be mediated via the ability of CYLD to hydrolyze unanchored polyubiquitin chains and thus inhibit TAK1 and IKK activation."

reach
"Additionally, in both macrophages and T cells, CYLD inhibits the ubiquitylation and subsequent activation of Tak1, a kinase that activates both IKK and JNK."

reach
"The fact that loss of CYLD causes spontaneous activation of TAK1 implies that TAK1 ubiquitylation is a dynamic event that occurs even in resting T cells."

reach
"Surprisingly, the loss of CYLD did not result in the basal activation of IKKbeta or Tak1 in macrophages."

eidos
"For instance , Ub-specific protease-14 ( USP14 ) negatively regulates the activity of proteasomes by removing Lys48-linked Ub chains , whereas cylindromatosis tumour suppressor ( CYLD ) only acts on lysine 63 linkage-specific Ub polymers.29 For example , CYLD attenuates TAK1 signalling by removing K63-linked polyubiquitin chain of TAK1 ."

reach
"Taken together, these findings indicated that CYLD negatively regulates the activation of TAK1, p38, and AP-1."

reach
"Deubiquitinating enzyme CYLD negatively regulates the ubiquitin dependent kinase Tak1 and prevents abnormal T cell responses."

reach
"Consistent with this result, we also found that overexpression of CYLD did not inhibit TAK1 and TAB1 co-overexpression-induced NF-kappaB activation in a reporter assay (XREF_FIG)."
CYLD-Y485A bound to ITCH inhibits MAP3K7. 2 / 2
| 2

reach
"Reconstitution of wild-type Cyld but not mutant Cyld (Y485A), which can not associate with Itch, blocked the sustained Tak1 activation and proinflammatory cytokine production by Cyld -/- bone marrow derived macrophages."

reach
"Reconstitution of wild-type Cyld but not the mutant Cyld (Y485A), which can not associate with Itch, blocked sustained Tak1 activation and proinflammatory cytokine production by Cyld (-/-) bone marrow derived macrophages."
CYLD binds MAP3K7.
2 | 6 4
2 | 6 4

reach
"Finally, we showed that CYLD interacts with and deubiquitinates TAK1 to negatively regulate the activation of the downstream MKK3/6-p 38alpha/beta pathway."

sparser
"Mechanistically, CYLD interacts directly with the kinase TAK1 and removes its K63-linked polyubiquitin chain, which blocks downstream activation of the JNK-p38 cascades."

reach
"Koga et al. had reported that CYLD interacted with and deubiquitinates TAK1 by negatively regulating the activation of the downstream MKK3/6-p 38alpha/beta pathway to resist the infection of gram positive bacterium Streptococcus pneumonia [XREF_BIBR]."

sparser
"In our opinion, a good explanation for this additive effect on prognosis is that this combined score better reflects the overall activity of the Cyld-Tak1 axis and that higher activity is correlated with worse prognosis."

reach
"CYLD interacts with and negatively regulates TAK1, reducing TAK1 mediated stimulation of IKK and hence activation of NFkappaB."

sparser
"Multivariate analysis, including the combined Tak1-Cyld classes, illustrated that high nuclear Tak1 and low nuclear Cyld expression clearly represents a strong and statistically independent prognostic factor."

reach
"This hypothesis is supported by a previous study in T cells showing that CYLD physically interacts with TAK1 and inhibits its ubiquitination and catalytic activity following T cell receptor stimulation."

No evidence text available

reach
"We show in this study that CYLD physically interacts with Tak1 and inhibits its ubiquitination and catalytic activity."

reach
"Interestingly, endogenous CYLD and Tak1 indeed formed a complex in T cells, which was readily detected by co-immunoprecipitation (IP) assays using the anti-CYLD antibody (XREF_FIG)."
CYLD activates MAP3K7.
| 11
CYLD activates MAP3K7. 10 / 12
| 11

reach
"In an analysis of the mechanism of this finding, we noted first that TGF-beta-stimulated T cells lacking CYLD exhibit increased TAK1 and p38 mitogen activated protein kinase (MAP kinase) activity."

reach
"Reconstitution of Cyld -/- MEFs with Cyld (WT) restored transient Tak1 activation (XREF_FIG) and normalized IL-6 production."

reach
"Deubiquitinases A20 and Cezanne, but not CYLD, are induced by NF-kappaB to negatively regulate TAK1 and NF-kappaB activity by removing K63 polyubiquitin chains [XREF_BIBR]."

reach
"XREF_BIBR, XREF_BIBR Similarly, in a hepatocytespecific cylindromatosis deficient (CYLD Deltahep) mouse model, which typically has increased hepatocyte TAK1 and NF-kappaB activation, TAK1 deletion decreased HCC development."

reach
"Deficiency in ITCH or CYLD causes sustained activation of TAK1 and increased cytokine production in bone marrow derived macrophages, and tumorigenesis and metastasis of transplanted Lewis lung carcinoma, suggesting that sustained activation of TAK1 leads to the progression of non-small-cell lung cancer (NSCLC) [XREF_BIBR]."

reach
"Thus, it was logical to examine whether CYLD targets Tak1 and regulates its ubiquitination."

reach
"CYLD targets and inhibits the ubiquitin dependent IKKbeta kinase TAK1 and therefore prevents aberrant lymphocyte activation [XREF_BIBR, XREF_BIBR], while A20 dampens NF-kappaB activity by trimming K63-ubiquitin chains attached to MALT1 [XREF_BIBR, XREF_BIBR]."

reach
"In mature T cells, CYLD targets TAK1 for inactivation to downregulate IKK and NF-kappaB activation [XREF_BIBR]."

reach
"It has been reported that an adequate amount of CYLD impairs the progression of NASH by inhibiting TAK1 signaling, and the E3 ligase TRIM47 has been revealed to be a key regulator of CYLD degradation, revealing that both of the above targets could be significant for the treatment of NAFLD.92 Caspase Inhibitor : Emricasan is a caspase inhibitor which can reduce the portal hypertension via blocking the activation of inflammatory caspase and inhibiting hepatocyte cell death."

reach
"By using CYLD knock-out mice, a recent study shows that in TGF-beta-treated T cells, CYLD deficiency causes enhanced TAK1 and p38 mitogen activated protein kinase activities."
CYLD deubiquitinates MAP3K7.
1 | 8
CYLD deubiquitinates MAP3K7. 9 / 9
1 | 8

reach
"Although it is not yet clear precisely how CYLD regulates the function of the CARMA1-BCL-10-MALT1 signalosome, CYLD deubiquitylates TAK1 and thereby suppresses its catalytic activity 19."

reach
"These results indicate that USP4 mainly inhibits inducible TAK1 polyubiquitination and activation whereas CYLD mainly inhibits basal level of TAK1 polyubiquitination and activation."

reach
"Finally, we showed that CYLD interacts with and deubiquitinates TAK1 to negatively regulate the activation of the downstream MKK3/6-p 38alpha/beta pathway."

reach
"In this investigation, we found that CYLD failed to inhibit TAK1 and TAB1 co-overexpression-induced TAK1 polyubiquitination and NF-kappaB activation (XREF_FIG, XREF_SUPPLEMENTARY)."

reach
"CYLD does not inhibit TAK1 and TAB1 co-overexpression-induced TAK1 polyubiquitination."

"The E3 ligase Itch and deubiquitinase Cyld act together to regulate Tak1 and inflammation.&CYLD targets a ubiquitin-dependent kinase, transforming growth factor-beta-activated kinase 1 (Tak1), and inhibits its ubiquitination and autoactivation."

reach
"Indeed, our data suggest that CYLD directly targets Tak1 and inhibits Tak1 ubiquitination."

reach
"Koga et al. had reported that CYLD interacted with and deubiquitinates TAK1 by negatively regulating the activation of the downstream MKK3/6-p 38alpha/beta pathway to resist the infection of gram positive bacterium Streptococcus pneumonia [XREF_BIBR]."

reach
"Inclusion of Cyld (WT) (XREF_FIG, lane3) but not Cyld (C601A) mutant (XREF_FIG, lane4) that lacks the DUB activity 37 resulted in diminished Tak1 ubiquitination suggesting that Cyld deubiquitinated Tak1."
CYLD ubiquitinates MAP3K7.
| 4
CYLD leads to the ubiquitination of MAP3K7. 4 / 4
| 4

reach
"CYLD also downregulates Streptococcus pneumoniae induced NFAT (nuclear factor for activated T cells) activation and inflammation by inhibiting TAK1 ubiquitination."

reach
"The deubiquitinase CYLD also impairs T-cell activation via NF-κB, but in this case by deubiquitinating Lys63-ubiquitin chains from the TAK1 kinase downstream of the CBM complex (Figure 2)."
| PMC

reach
"Inclusion of Cyld (WT) (XREF_FIG, lane3) but not Cyld (C601A) mutant (XREF_FIG, lane4) that lacks the DUB activity 37 resulted in diminished Tak1 ubiquitination suggesting that Cyld deubiquitinated Tak1."

reach
"CYLD has been shown to prevent spontaneous NF-kappaB activation in T cells in the absence of receptor engagement by inhibiting the ubiquitination and autoactivation of TAK1."
IKBKE affects CYLD
| 2 22 36 4
IKBKE phosphorylates CYLD.
| 19 33 4
IKBKE phosphorylates CYLD. 10 / 35
| 12 21 1

sparser
"We confirmed that CYLD is directly phosphorylated by IKKε, and that IKKε phosphorylates serine 418 in vivo ."

sparser
"More recently, IKKɛ was identified as an additional CYLD kinase — also at Ser 418 — and indeed, IKKɛ phosphorylates CYLD much more efficiently than either IKKα or IKKβ."

reach
"We next investigated if CYLD can be phosphorylated by IKKepsilon or TBK1 in the context of TCR signaling."

reach
"However, these findings suggest that the regulation of CYLD phosphorylation by IKKepsilon contributes to the NF-kappaB activity necessary for IKKepsilon mediated cell transformation."

reach
"A recent study demonstrated that IKBKE but not IKKalpha and beta phosphorylates CYLD XREF_BIBR, which is a deubiquitinase of several NF-kappaB regulators, including TRAF2, TRAF6, and NEMO, to activate the NF-kappaB pathway XREF_BIBR - XREF_BIBR."

sparser
"Since CYLD is a known tumor suppressor and IKKε is a newly-discovered oncoprotein ( xref ; xref ; xref ), we hypothesized that phosphorylation of CYLD by IKKε might play a role in the regulation of IKKε-mediated cell transformation."

sparser
"We found that transfected TBK1 and IKKε phosphorylate transfected CYLD in a 293T overexpression system, whereas the kinase-dead TBK1-K38A did not ( xref , xref )."

sparser
"We next investigated if CYLD can be phosphorylated by IKKε or TBK1 in the context of TCR signaling."

sparser
"Here we showed direct in vitro phosphorylation of CYLD by IKKε, and have used mass spectrometry and an IKKε phospho-substrate antibody to show that Ser418 of CYLD is, in fact, the in vivo site phosphorylated by IKKε."

sparser
"We show here that CYLD is a substrate of IKKε and that phosphorylation of CYLD by IKKε contributes to cell transformation."
IKBKE phosphorylates CYLD on S418. 10 / 22
| 7 12 3

sparser
"Conversely, IKKe directly phosphorylates CYLD at Ser418, hereby decreasing its deubiquitinating potential but increasing the IKKeinduced cell transformation [41] (Fig. 3 ) (see Section 6) ."

sparser
"Taken together, these findings demonstrate that phosphorylation of CYLD by IKKε at serine 418 is necessary for IKKε to fully induce transformation."

sparser
"Jessica Hutti presented evidence that IKKε can phosphorylate CYLD at Ser418, and that CYLD phosphorylation is required for IKKε-induced transformation of cells in culture."

sparser
"IKKε and TBK1 are activated upon T cell activation and can directly phosphorylate CYLD at Ser418."

rlimsp
"We confirmed that CYLD is directly phosphorylated by IKKepsilon and that IKKepsilon phosphorylates serine 418 in vivo. Phosphorylation of CYLD at serine 418 decreases its deubiquitinase activity and is necessary for IKKepsilon-driven transformation."

rlimsp
"Of these potential substrates, serine 418 of the tumor suppressor CYLD was identified as a likely site of IKKepsilon phosphorylation. We confirmed that CYLD is directly phosphorylated by IKKepsilon and that IKKepsilon phosphorylates serine 418 in vivo. Phosphorylation of CYLD at serine 418 decreases its deubiquitinase activity and is necessary for IKKepsilon-driven transformation."

sparser
"Conversely, IKKɛ directly phosphorylates CYLD at Ser418, hereby decreasing its deubiquitinating potential but increasing the IKKɛ-induced cell transformation [41] (Fig. 3 ) (see Section 6)."

reach
"Conversely, IKKepsilon directly phosphorylates CYLD at Ser418, hereby decreasing its deubiquitinating potential but increasing the IKKepsilon induced cell transformation XREF_BIBR (XREF_FIG) (see Section 6)."

sparser
"IKKε-induced phosphorylation at Ser418 of CYLD decreased its activity ( xref ) and completely blocked CYLD-mediated deubiquitination of TRAF2, thereby promoting tumorigenesis in breast cancer cells ( xref ; xref ; xref )."

rlimsp
"We confirmed that CYLD is directly phosphorylated by IKKepsilon and that IKKepsilon phosphorylates serine 418 in vivo."
IKBKE inhibits CYLD.
| 2 3
IKBKE inhibits CYLD. 5 / 6
| 2 3

reach
"In addition, IKKepsilon has been reported to decrease the activity of CYLD, a deubiquitinating enzyme that negatively regulates IRF3/7 activation, thereby indirectly increasing IRF mediated signaling [XREF_BIBR, XREF_BIBR]."

sparser
"IKKɛ also phosphorylates and inactivates the tumor suppressor CYLD, preventing CYLD from deubiquitinating specific substrates in the NF-κB signaling pathway."

sparser
"A similar mechanism is thought to occur in breast carcinogenesis where IKKε phosphorylates and inactivates CYLD ( xref )."

reach
"IKKepsilon inhibits CYLD activity through phosphorylation, which results in the blockage of the deubiquination of TRAF2 and NF-kB essential modulator (NEMO), positive regulators of the classical NF-kB pathway."

sparser
"IKKe also phosphorylates and inactivates the tumor suppressor CYLD, preventing CYLD from deubiquitinating specific substrates in the NF-kB signaling pathway."
IKBKE activates CYLD.
| 2 1
IKBKE activates CYLD. 3 / 3
| 2 1

reach
"Moreover, we recognize that IKKepsilon may also modulate other substrates in addition to CYLD during cell transformation."

eidos
"IKKepsilon also phosphorylates and inactivates the tumor suppressor CYLD , preventing CYLD from deubiquitinating specific substrates in the NF-kappaB signaling pathway ."

eidos
"IKKe also phosphorylates and inactivates the tumor suppressor CYLD , preventing CYLD from deubiquitinating specific substrates in the NF-kB signaling pathway ."
CYLD affects BCL3
2 1 1 | 31 22
CYLD binds BCL3.
1 | 9 21
1 | 9 21

sparser
"In contrast, wild-type keratinocytes have reduced proliferation rates compared to the knockout cells due to the interaction of BCL3 with CYLD in the cytoplasm, where removal of K63 ubiquitin chains by CYLD occurs [ xref ]."

reach
"The increased tumour incidence was attributed to the loss of an inhibitory interaction between CYLD and the proto-oncogene Bcl-3."

reach
"The colocalization of Cyld and Bcl-3 in the perinuclear region of TPA- or UV-B-treated keratinocytes suggested that Cyld may associate with Bcl-3 and regulate its activity."

sparser
"In addition to cell motility, HDAC6 regulates the cell cycle through deacetylating α-tubulin and promoting the interaction of CYLD and BCL3 [ xref , xref ] (Fig.  xref )."

sparser
"CYLD physically interacts with Bcl3 through a specific region that is different from the domain that mediates binding to TRAF2 and NEMO. xref CYLD inhibits K63-linked ubiquitination and nuclear translocation of Bcl3, thus suggesting a role for ubiquitination in the regulation of Bcl3 nuclear expression ( xref )."

sparser
"HDAC6 inactivation promotes an increase in the cellular levels of acetylated tubulin surrounding the perinuclear region and facilitates the association of CYLD with its downstream substrate, B-cell CL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available

sparser
"In our experiments, the inhibitory effect of CYLD on the nuclear accumulation of phosphorylated STAT3 resembles CYLD-Bcl3 interaction, since CYLD also deubiquitinates Bcl-3 in perinuclear regions and prevents its translocation to the nucleus, a process which significantly contributes to the development of keratinocyte hyperproliferation and development of benign tumors of the skin appendage called cylindromatosis xref ."

reach
"To examine whether the interaction between Cyld and Bcl-3 is achieved through a direct or an indirect interaction, we performed yeast two-hybrid assays."

sparser
"In Cyld+/+ keratinocytes, TPA or UV light triggers the translocation of Cyld from the cytoplasm to the perinuclear region, where Cyld binds and deubiquitinates Bcl-3, thereby preventing nuclear accumulation of Bcl-3 and p50/Bcl-3- or p52/Bcl-3-dependent proliferation."
CYLD deubiquitinates BCL3.
1 1 | 10
CYLD deubiquitinates BCL3. 10 / 12
1 1 | 10

reach
"The CYLD protein deubiquitinates Bcl-3 and inhibits its nuclear translocation, so alterations in these gene or upstream events to it present an additional layer of regulation."

reach
"CYLD is also able to deubiquitinate Bcl-3 and prevent it from entering nucleus, where Bcl-3 can interact with NFkappaB family members (p50 and p52) to activate the transcription of NFkappaB target genes."

reach
"In addition to its deubiquitination effects on TRAFs and IKKgamma, CYLD also deubiquitinates Bcl-3, and in so doing prevents its nuclear localization."

reach
"CYLD deubiquitinates several NF-kappaB regulators, including TRAF2, TRAF6, and NEMO as well as BCL3, a member of the NF-kappaB family of transcription factors."

reach
"CYLD deubiquitylates BCL-3 inhibiting its nuclear translocation and so decreases the transcription of BCL-3 target genes including CCND [XREF_BIBR]."

"In this region, CYLD associates with its substrate Bcl-3 and prevents the nuclear localization of Bcl3"

reach
"In the present study, the cytoplasmic and perinuclear expression levels of CYLD suggest that CYLD may play a role in the deubiquitination of BCl-3 and/or TRAF in NF-kappaB signaling within the cytoplasm or perinuclear region in keratinocytes of normal skin and cholesteatoma, in agreement with previously reported results."

reach
"In these cases, mutated CYLD is unable to deubiquitinate Bcl-3, allowing increased proliferation in cell of the skin adnexa [XREF_BIBR]."

reach
"In this issue of Cell, Massoumi et al. (2006) show that CYLD deubiquitinates the coactivator Bcl-3, thereby preventing its translocation into the nucleus, where it normally interacts with NF-kappaB and activates transcription of proliferation genes in response to growth signals."

reach
"As for CYLD, studies have shown that CYLD binds to and deubiquitylates BCL-3 inhibiting its nuclear translocation, leading to decreased transcription of CCND, and delayed cells from entering S-phase 35."
CYLD inhibits BCL3.
1 | 8 1
CYLD inhibits BCL3. 10 / 11
1 | 8 1

reach
"Interestingly, the ubiquitin ligase CYLD, which negatively regulates bcl3 nuclear localization, was increased 2.7-fold in the RNA-Seq analysis (XREF_SUPPLEMENTARY)."

sparser
"CYLD inhibits Bcl3 by antagonizing the K63-linked polyubiquitination of Bcl3 thus preventing its nuclear translocation."

"Cyld binds and deubiquitinates bcl-3in cyld+/+ keratinocytes, tpa or uv light triggers the translocation of cyld from the cytoplasm to the perinuclear region, where cyld binds and deubiquitinates bcl-3, thereby preventing nuclear accumulation of bcl-3 and p50/bcl-3- or p52/bcl-3-dependent proliferation."

reach
"CYLD negatively regulates BCL3, preventing nuclear entry where it forms a dimer with p50 and p52, resulting in transcription of genes involved in proliferation including cyclin D1."

reach
"CYLD prevents nuclear accumulation of BCL-3 and hence reduces Cyclin D1 expression and proliferation of keratinocytes."

reach
"CYLD, but not C/S-CYLD, abrogated BCL-3 binding of IL-10 promoter, confirming the important role of CYLD in the regulation of BCL-3."

reach
"Furthermore, siRNA against Snail1, which up-regulated CYLD expression (XREF_FIG), reduced nuclear BCL-3 levels, confirming that reexpression of CYLD blocks nuclear translocation of BCL-3 in melanoma (XREF_FIG)."

reach
"Here, decreasing CYLD levels activated BCL3 accumulation followed by its import into the nucleus, probably mediated by an interaction between the polyubiquitin chains of BCL-3 and importins."

reach
"It was observed in malignant melanoma that loss of CYLD also induces nuclear accumulation of BCL-3 and NF-kappaB activation, with the consequence of induced N-cadherin (migration) and cyclin D1 (proliferation) activity."

reach
"CYLD inhibits Bcl3 by antagonizing the K63 linked polyubiquitination of Bcl3 thus preventing its nuclear translocation."
CYLD decreases the amount of BCL3.
| 2
CYLD decreases the amount of BCL3. 2 / 5
| 2

reach
"CYLD deubiquitylates BCL-3 inhibiting its nuclear translocation and so decreases the transcription of BCL-3 target genes including CCND [XREF_BIBR]."

reach
"In agreement with the mechanism in keratinocytes, CYLD markedly reduced expression of Cyclin D1 (XREF_FIG), cyclin D1 promoter activity (XREF_FIG), and BCL-3 recruitment to the cyclin D1 promoter in a complex with p50 or p52 (XREF_FIG, left) as compared with cells transduced with viral vectors carrying a catalytically inactive mutant of CYLD (C/S-CYLD), a GFP expression cassette or noninfected cells."
CYLD activates BCL3.
| 2
CYLD activates BCL3. 2 / 3
| 2

reach
"Interestingly, coexpression of MKK7 and CYLD restored the nuclear presence of Bcl3 in melanoma tissues (XREF_SUPPLEMENTARY)."

reach
"Of importance, catalytically inactive CYLD overexpression allowed Bcl-3 to be located predominantly in the nucleus."
| 2 47
| 2 29

reach
"Specific deletion of CYLD in Foxp3 Treg cells caused inflammation in the lungs correlating with their increased migratory activity into the lungs."

reach
"In addition, it is also possible that CYLD may inhibit ERK activation and inflammation via up-regulation of MAPK phosphatase-1 (MKP-1)."

reach
"CYLD also inhibited inflammation and proliferation in vascular cells and represented a novel target for the treatment or prevention of atherosclerosis [XREF_BIBR]."

reach
"NTHi induced CYLD, in turn, negatively regulates NTHi induced NF-kappaB activation through deubiquitinating TRAF6 and 7 and down-regulates inflammation."

reach
"Spontaneous lung inflammation caused by the CYLD cKO deficiency was also ameliorated by Scinderin deletion (Fig 6, F and G)."

reach
"As very recently described, the deubiquitinase Cyld regulates the function of the NLRP6 inflammasome and prevents excessive inflammation via the production of IL-18."

reach
"CYLD suppresses NF-kappaB-dependent inflammation by removing K63 linked polyubiquitin chains from TRAF2, TRAF6, NEMO, TAK1, Bcl3 and RIP1."

reach
"Since the majority of correlations were between IA genes and pro-inflammatory pathways and signatures, the dysregulation of CYLD represents an exception, and we hypothesize that CYLD may be expressed as a response to attenuate excessive inflammation."

reach
"Foxp3 restricted CYLD conditional knockout mice (cKO) were examined in mouse models of allergen induced airway inflammation and Nippostrongylus brasiliensis infection."

reach
"Similar results are seen in vivo; Cyld knockout mice, generated by Zhang et al. [21], were susceptible to induced colonic inflammation by using colitis associated cancer (CAC)."
| 18

reach
"These results suggest that PDE4B negatively regulates CYLD expression and mediates inflammation via the JNK pathway."

reach
"Hypoxia suppresses cylindromatosis (CYLD) expression to promote inflammation in glioblastoma : possible link to acquired resistance to anti-VEGF therapy."

reach
"Taken together, it is evident that PDE4B negatively regulates CYLD expression and mediates NTHi induced inflammation via specific activation of JNK2 but not JNK1 pathway."

reach
"Thus, we sought to determine whether increased cAMP does have an important role in inhibiting JNK2 activation, which in turn enhances CYLD expression and suppresses inflammation."

reach
"Vinpocetine suppresses Streptococcus pneumoniae-induced inflammation via inhibition of ERK1 by CYLD."

reach
"CYLD is upregulated in both COVID-19 and cardiomyopathy and was found to correlate with the activation of FGFR2, an important promoter of inflammation [51], and TXA2, a gene that is upregulated in platelets (See Appendix A, Figure A2A) [52]."

reach
"These data collectively suggested that Cyld deficiency leads to severe colonic inflammation and increased disruption of the epithelial barrier."

reach
"Knockdown of CYLD rescued compromised inflammatory response of macrophages induced by Notch blockade in I/R injury in vitro."

reach
"Inhibition of PDE4B markedly increased the expression of CYLD and subsequently suppressed bacteria induced inflammation in well established models of both lung and middle ear inflammation."

reach
"MiR-181b and miR-21 target cylindromatosis (CYLD) and phosphatase and tensin homolog (PTEN), respectively, and down-regulation of CYLD and PTEN leads to NF-kappaB activation, therefore also acting as a part of the epigenetic switch linking inflammation to cancer [XREF_BIBR]."
CYLD affects DDX58
1 1 1 | 2 32 15
CYLD binds DDX58.
1 1 | 7 15
1 1 | 5 15

sparser
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination ( xref )."

sparser
"SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-ICYLD interaction and potentiates the K63-linked deubiquitination of RIG-I. Collectively, our findings uncover a mechanism by which SDC4 antagonizes the activation of RIG-I in a CYLD-mediated deubiquitination-dependent process, thereby balancing antiviral signalling to avoid deleterious effects on host cells."

sparser
"Here the authors show that Syndecan-4 via its cytosolic domain negatively regulates antiviral immunity by enhancing RIG-I interaction with a deubiquitinating enzyme CYLD, thus inhibiting the activating K63-linked RIG-I ubiquitination."

sparser
"Interestingly, SDC4ΔC was also unable to bind CYLD ( xref ), which indicates that the CP region of SDC4 is necessary for its interaction with either RIG-I or CYLD."

reach
"CYLD binds to RIG-I and inhibits the ubiquitination and signaling function of RIG-I XREF_BIBR, XREF_BIBR."

sparser
"As shown in xref , similar to the sub-cellular pattern of RIG-I, SDC4 and CYLD were also accumulated in a perinuclear pattern on SeV infection, raising a possibility that SDC4 has a potential role in affecting the RIG-ICYLD interaction and their perinuclear localization as well."

reach
"Newly synthesized SDC4 then recruits CYLD and RIG-I to form a large complex in the membrane compartment in a perinuclear pattern, which assists the interaction between CYLD and RIG-I, as well as the deubiquitination of the K63 linked ubiquitin of RIG-I."

sparser
"We provide extensive biochemical evidence to demonstrate that SDC4, via its carboxyl-terminal intracellular domain, interacts with RIG-I and CYLD, thereby facilitating the interaction between RIG-I and CYLD."

sparser
"USP4 and ovarian tumor-domain-containing ubiquitin aldehyde-binding protein 1 (OTUB1) stabilize RIG-I proteins by eliminating the K48-linked ubiquitin chains conjugated to RIG-I. xref , xref Conversely, CYLD , a tumor suppressor gene expressed in cylindromatosis, negatively regulates RIG-I activation by deubiquitinating the K63-linked ubiquitin chains on RIG-I. xref Moreover, syndecan-4 (SDC4), which is a TM protein, complexes with both RIG-I and CYLD to promote the CYLD-mediated deubiquitination of RIG-I, leading to subsequent signaling inhibition. xref Furthermore, USP3, xref USP21, xref USP14, xref and USP27X xref also deubiquitinate the K63-linked ubiquitin of RIG-I to inhibit RIG-I function."

sparser
"CYLD binds to RIG-I and inhibits the ubiquitination and signaling function of RIG-I xref , xref ."
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
CYLD inhibits DDX58.
| 8
CYLD inhibits DDX58. 8 / 9
| 8

reach
"USP3, USP21 and CYLD inhibit RIG-I K63-linked ubiquitination and activation."

reach
"For example, the 3C protein of enterovirus 71 (EV71), a member of the Picornaviridae family that causes hand, foot and mouth disease, and occasionally severe central nervous system diseases, downregulates the host microRNA miR-526a to increase the expression of the cellular DUB enzyme CYLD, thus inhibiting the activation of RIG-I 74."

reach
"For example, the 3C protein of enterovirus 71 (EV71), a member of the Picornaviridae family that causes hand, foot and mouth disease, and occasionally severe central nervous system diseases, downregulates the host microRNA miR-526a to increase the expression of the cellular DUB enzyme CYLD, thus inhibiting the activation of RIG-I ."

reach
"Conversely, the removal of Lys63 linked ubiquitylation by the cellular deubiquitylating enzymes (DUBs) ubiquitin C-terminal hydrolase 3 (USP3), USP21 and CYLD, represses RIG-I signalling."

reach
"XREF_BIBR, XREF_BIBR Conversely, CYLD, a tumor suppressor gene expressed in cylindromatosis, negatively regulates RIG-I activation by deubiquitinating the K63 linked ubiquitin chains on RIG-I."

reach
"The tumor suppressor CYLD (cylindromatosis), another OTU de-ubiquitinating enzyme that removes Lys 63 linked polyubiquitin chains, was also recently shown to negatively regulate RIG-I."

reach
"Conversely, the removal of Lys63-linked ubiquitylation by the cellular deubiquitylating enzymes (DUBs) ubiquitin C-terminal hydrolase 3 (USP3), USP21 and CYLD, represses RIG-I signalling (reviewed in Ref."

reach
"Another ubiquitin ligase RNF135 (also known as Riplet) is similarly involved in the positive regulation of RIG-I signaling, while RNF125 and the deubiquitinase CYLD are known to negatively regulate RIG-I signaling."
CYLD deubiquitinates DDX58.
1 | 8
CYLD deubiquitinates DDX58. 9 / 9
1 | 8

reach
"CYLD (cylindromatosis) deubiquitinates RIG-I and several downstream molecules to prevent premature RIG-I activation in uninfected cells [17], while USP3 deubiquitinates RIG-I specifically after viral infection, likely serving as a negative feedback regulator [18]."

reach
"ORF64, USP25, USP21, USP15, USP3, Cylindromatosis (CYLD), porcine epidemic diarrhea virus papain-like protease 2 (PEDV PLP2) and transmissible gastroenteritis virus papain-like protease1 (TGEV PL1) are the DUBs found to deubiquitinate RIG-I."

reach
"CYLD (cylindromatosis) deubiquitinates RIG-I and several downstream molecules to prevent premature RIG-I activation in uninfected cells [XREF_BIBR], while USP3 deubiquitinates RIG-I specifically after viral infection, likely serving as a negative feedback regulator [XREF_BIBR]."

reach
"Tumor suppressor protein cylindromatosis (CYLD) reduced the baseline Lys63-linked ubiquitination of RIG-I in uninfected cells [69]."

reach
"CYLD can inhibit ubiquitination of the RIG1 cytoplasmic viral RNA sensor and also downregulate antiviral Interferon production by controlling IKK activation [XREF_BIBR]."

"SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-I-CYLD interaction and potentiates the K63-linked deubiquitination of RIG-I."

reach
"XREF_BIBR, XREF_BIBR We and others have recently shown that RIG-I ubiquitination and TBK1 and IKKepsilon activation are negatively regulated by CYLD, XREF_BIBR, XREF_BIBR a deubiquitinase known to digest K63 linked ubiquitin chains."

reach
"CYLD has been shown to deubiquitinate, or prevent ubiquitination of RIG-I in cells."

reach
"A simple explanation for this result is that the carboxyl-terminal fragment of SDC4 brings RIG-I and CYLD close together, which promotes the deubiquitination of RIG-I by CYLD."
CYLD ubiquitinates DDX58.
| 6
CYLD ubiquitinates DDX58. 6 / 6
| 6

reach
"K63 linked ubiquitination of RIG-I by TRIM25, MEX3C, and TRIM4 and deubiquitination of RIG-I by CYLD, USP3, and USP21 occur in the CARDs, whereas K63 linked ubiquitination by the RNF135 and Riplet occurs in the RD (K788), which has a positive effect on TRIM25 mediated K63 linked ubiquitination in the CARDs XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR - XREF_BIBR."

reach
"CYLD was initially thought to inhibit IFN signaling by deubiquitinating the PRR, RIG1, and downstream kinases TBK-1 and IKKepsilon 44, but surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated 45."

reach
"It was initially believed that CYLD inhibited IFN signaling by deubiquitinating the PRR, RIG-1, and downstream kinases TANK binding kinase 1 (TBK-1) and inhibitor of NF-kappaB kinase Epsilon (IKKEpsilon) 44; but, surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated.45 On the basis of these reports, TRAF3 and CYLD may serve similar functions after viral infection, namely, to inhibit NF-kappaB and activate IFN."

reach
"Tumor suppressor protein cylindromatosis (CYLD) reduced the baseline Lys63 linked ubiquitination of RIG-I in uninfected cells XREF_BIBR."

reach
"Other DUBs that target the RIG-I and MDA5 pathway include CYLD and DUBA which target RIG-I and TRAF3 ubiquitination respectively (XREF_FIG)."

reach
"To the best of our knowledge, at least nine DUBs, A20, CYLD, USP3, USP5, USP14, USP15, USP21, USP25, and USP27X, have been proposed to counteract the K63linked ubiquitination of RIG-I and, thereby attenuate downstream signaling and IFN-b production ( Table 1 and Figure 3 ) (58, 76, 93) ."
CYLD activates DDX58.
| 2 3
CYLD activates DDX58. 5 / 5
| 2 3

eidos
"The effect of CYLD was not specific to RIG-I , as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKepsilon ."

eidos
"Ubiquitylation events are reversible processes , and , accordingly , severaldeubiquitylating enzymes , in particular ubiquitin specific peptidase 3 ( USP3 ) , USP21 and CYLD lysine 63 deubiquitinase ( CYLD ) , modulate RIG-I signalling by removing K63-polyubiquitin chains , although with unique kinetics ( reviewed elsewhere112 ,118 ) ."

reach
"The data indicate that CYLD targets RIG-I as well as TBK1 for deubiquitination that leads to inactivation of the signaling."

reach
"miR-526a downregulates the expression of the deubiquitylating enzyme CYLD, which ultimately promotes RIG-I K63 linked ubiquitylation and interferon responses 152."

reach
"Ubiquitylation events are reversible processes, and, accordingly, several deubiquitylating enzymes, in particular ubiquitin specific peptidase 3 (USP3), USP21 and CYLD lysine 63 deubiquitinase (CYLD), modulate RIG-I signalling by removing K63-polyubiquitin chains, although with unique kinetics."
IKBKG affects CYLD
11 1 | 23 17
11 1 | 23 14

reach
"NEMO, another potential adaptor of CYLD, directly binds CYLD and associates with various IKK regulators, such as RIP1 and TRAF2 [XREF_BIBR]."

sparser
"Interestingly, the association of CYLD with IKKγ coincides with the appearance of a phosphorylated form of CYLD, though it has not been shown that this modification is required for interaction and deubiquitinating activities xref ."

No evidence text available

reach
"Three independent studies have recently shown that CYLD binds to NEMO and facilitates the disassembly of K63 linked polyubiquitin chains on TRAF2, TRAF6 and NEMO [22 ** -24 **]."

reach
"However, the SUMOylation effectively impairs the interaction between NEMO and CYLD, suggesting that the SUMO-moiety (~ 12 kDa) might directly mask the binding surface."

sparser
"Strikingly, GST-CYLD (470–684 aa) could pull down neither the NEMO-SUMO-3 nor the SUMOylated NEMO ( xref , left panel and xref ), whereas GST-IKKβ (644–756 aa) could pull down both the NEMO-SUMO-3 and the SUMOylated NEMO ( xref , right panel and xref ), indicating that the SUMO-3 modification specifically impaired the interaction between NEMO and CYLD."

reach
"Removal of Lys-63-chains from TRAFs requires that CYLD physically (and transiently) interact with NEMO, e.g. in response to TNF-alpha stimulation."

No evidence text available

reach
"For example, CYLD directly associates and deubiquitinates NEMO and TRAF-6, thus inhibiting TNF-alpha-induced nuclear factor-kappaB (NF-kappaB) signaling [13,15-17]."

sparser
"Following TLR signaling, NF-κB essential modifier (NEMO/IKKγ) undergoes SUMO-2/3 modification, which prevents NEMO binding to the deubiquitinase CYLD and thus indirectly enhancing the IKK activation."
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
TRAF6 affects CYLD
4 2 | 15 30
4 2 | 15 15

reach
"Perhaps because the levels of CYLD and the binding of CYLD to TRAF6 were already reduced following LPA stimulation, we only observed a reduction of this association by TRIP6 overexpression in unstimulated cells."

reach
"SPIO, HA and SPIO@15HA could notably suppress marker genes expression during osteoclastogenesis stimulated by RANKL and M-CSF (Fig. 7A), showing the capability to inhibit osteoclast differentiation.In our previous work, we have found that clinically used SPIOs can increase p62 expression though TLR4 activation [37], thus induce recruitment of CYLD to inhibited TRAF6 ubiquitination, leading to suppression of RANKL induced signal transduction for osteoclast differentiation [30]."

No evidence text available

sparser
"Given that TRAF6 interacts with CYLD in some cells ( xref , xref ), it is possible that CYLD recruitment was mediated by the initial interaction with TRAF6."

reach
"For example, the adaptor protein p62, which is required for CYLD binding to TRAF6, regulates the DUB activity of CYLD by promoting CYLD ubiquitination [XREF_BIBR]."

reach
"Furthermore, mice carrying the p62 and SQSTM1-P 392L mutation show loss of binding between CYLD and TRAF6, and loss of deubiquitination activity of CYLD towards TRAF6, supporting the critical role of CYLD in osteoclast differentiation."

reach
"However, it is unknown whether there is a direct interaction between CYLD and TRAF-6, and if so, how CYLD regulates TRAF signaling."

sparser
"These results show that CYLD is indeed physically associated with TRAF-6."

sparser
"Perhaps because U373-MG cells expressed very low levels of CYLD, we could barely detect the association of TRAF6 with CYLD even when TRIP6 was depleted."

sparser
"Next, we explored the physical relevance of this TRAF-6-CYLD interaction."
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
| 7

sparser
"Nonetheless, depletion of TRIP6 can significantly enhance the association of A20 or CYLD with TRAF6 in ovarian cancer cells and promote the binding of A20 to TRAF6 in glioblastoma cells, suggesting that targeting TRIP6 may prove to be an effective strategy to restore the function of A20 and CYLD in restricting the NF-κB activity in these cancer cells."

sparser
"To address this issue, we expressed FLAG-TRAF6 in HEK293T cells and treated cells with LPA for various times to determine how TRAF6 associates with deubiquitinase A20 or CYLD."

sparser
"Nonetheless, depletion of TRIP6 by either shRNA ( xref ) or Cas9/sgRNA ( xref ) not only enhanced the association of TRAF6 with A20, but also with CYLD in untreated and treated cells, suggesting a significant role for TRIP6 in antagonizing the binding of TRAF6 to both A20 and CYLD in ovarian cancer cells."

sparser
"On the other hand, in ovarian cancer cells and glioblastoma cells that show persistent NF-κB activity and high levels of TRIP6, both A20 and CYLD bind to TRAF6 very weakly."

sparser
"In this regard, here we provide evidence that the adaptor protein TRIP6 (thyroid hormone receptor-interacting protein 6), a specific interacting protein of the LPA2 receptor but not other LPA receptors, recruits TRAF6 to the LPA2 receptor and enhances the E3 ligase activity of TRAF6 by antagonizing the association of A20 and CYLD to TRAF6."

sparser
"Overexpression of TRIP6 interferes with the recruitment of A20 to TRAF6, whereas depletion of TRIP6 enhances the association of TRAF6 with A20 and CYLD, and eliminates LPA-promoted K63-linked polyubiquitination of TRAF6."

sparser
"In contrast, depletion of TRIP6 by TRIP6-specific shRNA or Cas9/sgRNA greatly enhances the association of TRAF6 with A20 and CYLD, and attenuates lysophosphatidic acid-induced muclear factor-κB and JNK/p38 activation in ovarian cancer cells."
| 21 13 11
CAMK2_complex phosphorylates CYLD.
| 13 11 11
CAMK2_complex phosphorylates CYLD. 10 / 37
| 13 11 11

rlimsp
"To confirm that CaMKII phosphorylates CYLD at the PSD directly rather than via sequential phosphorylation through activation of other kinases, phosphorylation of purified CYLD by purified CaMKII was tested."

reach
"While CaMKII enzymatic activity does not appear to be necessary for CYLD recruitment to the PSD, CaMKII nonetheless can phosphorylate CYLD."

rlimsp
"Two in vitro phosphorylation protocols were used to identify CaMKII-mediated phosphorylation sites on CYLD and test whether CaMKII phosphorylates CYLD directly."

sparser
"CaMKII phosphorylates CYLD on multiple residues."

sparser
"Among the three sites on CYLD phosphorylated by CaMKII, S-418 has been reported to be phosphorylated by IKK, resulting in an inhibition of CYLD activity xref , xref ."

reach
"Since CYLD is a major protein in isolated PSDs XREF_BIBR and is phosphorylated by CaMKII, it is presumed that the observed changes in deubiquitination are a result of CaMKII mediated activation of CYLD."

sparser
"Having established that CaMKII phosphorylates CYLD, we further tested the effect of CaMKII-mediated phosphorylation on its activity."

sparser
"Purified CaMKII phosphorylates CYLD on at least three residues (S-362, S-418, and S-772 on the human CYLD protein Q9NQC7-1) and promotes its deubiquitinase activity."

rlimsp
"Since CYLD is a major protein in isolated PSDs [20] and is phosphorylated by CaMKII, it is presumed that the observed changes in deubiquitination are a result of CaMKII-mediated activation of CYLD."

reach
"Addition of ATP led to phosphorylation of the same three residues, indicating that CaMKII directly phosphorylates CYLD on these residues."
CAMK2_complex activates CYLD.
| 4 2
| 4 2

sparser
"It was previously shown that, under excitatory conditions, CaMKII activates CYLD in a Ca 2+ -dependent manner."

sparser
"These results with purified proteins show that CaMKII activates CYLD via phosphorylation."

reach
"It was previously shown that, under excitatory conditions, CaMKII activates CYLD in a Ca 2+ -dependent manner."

reach
"Activation of CaMKII by the addition of ATP promotes activation of CYLD, as indicated by the increase in the rate of degradation of polyubiquitins (XREF_FIG)."

reach
"Since CYLD is a major protein in isolated PSDs XREF_BIBR and is phosphorylated by CaMKII, it is presumed that the observed changes in deubiquitination are a result of CaMKII mediated activation of CYLD."

reach
"These results with purified proteins show that CaMKII activates CYLD via phosphorylation."
| 4

reach
"Potential association between CYLD and CaMKII was examined by immunoprecipitation."

reach
"The association between CYLD and CaMKII may not require CaMKII kinase activity because CYLD appears to colocalize with CaMKII in tatCN21 induced polyribosome aggregates, despite the inhibition of CaMKII activity by tatCN21."

reach
"Although CaMKII and CYLD co-immunoprecipitate from solubilized PSDs, the association between CYLD and CaMKII may require additional factors such as posttranslational modifications or adaptor proteins."

reach
"Co-immunoprecipitation of the two proteins from solubilized PSD fractions confirmed an association between CYLD and CaMKII."
TNF affects CYLD
2 | 42 1
TNF activates CYLD.
| 22
TNF activates CYLD. 10 / 25
| 22

reach
"In addition, TRAF2 and TRAF6 appear to be differentially involved in NF-kappaB-dependent induction of CYLD by TNF-alpha and NTHi."

reach
"However, although A20 and CYLD are induced by TNFalpha for the establishment of a negative feedback loop, neither OTULIN (XREF_FIG F) nor LUBAC are induced by TNFalpha, again suggesting that they function as a differentially regulated signaling module."

reach
"The stable cell line of CYLD overexpressing A549 cells was treated with 10ng/mL of TNF-alpha alone, or 20ng/mL of TNF-alpha combinated with 10muM of a pancaspase inhibitor, z-VAD-fmk, for 12 hours, and the cell apoptosis rate and necrosis rate were determined by Annexin v-FITC/PI dual staining analysis following the kit protocols (Santa Cruz, USA)."

reach
"On the other hand, CYLD also acts as a mediator of immune activation and inflammation.38, 39 We found that both SPATA2 and CYLD are induced by TNF-alpha and IL-1beta in vitro, indicating a similar regulation in OC."

reach
"After 48 h of infection, cells were transfected with CYLD expression plasmid or left untransfected and treated with TNFalpha for 10 min after 30 h of transfection."

reach
"Furthermore, NF-kappaB-dependent induction of CYLD by TNF-alpha triggers an autoregulatory feedback mechanism through deubiquitylation of TRAF2 and TRAF6 [37]."

reach
"In the other treatment, the stable cell line H460 cells with overexpression of CYLD-flag or negative control plasmid were treated with TNF-alpha at the increasing concentration of 0ng/mL, 1ng/mL, 20ng/mL, and 400ng/mL for 20 hours."

reach
"Interestingly, the tumor suppressor CYLD, which is induced by TNFalpha and negatively regulates NF-kappaB signaling and adlican, which is involved in colon cancer progression, were both up-regulated in cartilage from patients with late-stage OA."

reach
"Moreover, CYLD overexpressed H460 cells were treated with 100ng/mL of TNF-alpha in combination with or without 10muM of z-VAD-fmk for 24 hours."

reach
"Hence, up-regulation of CYLD by TNFalpha can occur independent of PrP."
TNF increases the amount of CYLD.
| 12
TNF increases the amount of CYLD. 10 / 15
| 12

reach
"Indeed, both TNF-alpha and non typeable Haemophilus influenzae (NTHi), a common Gram negative bacterial pathogen that causes respiratory infections, can upregulate CYLD expression, suggesting that CYL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"32 In mouse bone marrow derived macrophages, CYLD expression is strongly induced by RANKL, but not by TNF-alpha or LPS."

reach
"In the present study, we found that both LPS and TNF-α did not increase the mRNA level of CYLD."

reach
"At this time, the underlying mechanism by which TNFalpha up-regulates the expression of CYLD is not clear."

reach
"Such a function of CYLD was suggested by the finding that the expression of CYLD is induced by proinflammatory cytokines, TNF-alpha and IL-1beta, and the Gram negative bacterium Haemophilus influenzae."

reach
"Several early reports indicated that CYLD expression was upregulated by LPS or TNF-α treatment [31–33]."

reach
"In cultured human tubular epithelial HK-2 cells, tumor necrosis factor-alpha (TNFalpha) up-regulated CYLD expression."

reach
"Similarly, mRNA levels of CYLD or cIAP1, which are involved in the regulation of complex I activity (Annibaldi & Meier, 2018), were not significantly induced by TNF or reduced in RelA-knockout cells (Fig XREF_FIG)."

reach
"The expression of CYLD can be induced by TNF treatment or viral infection (Friedman et al., 2008) ."

reach
"The expression of CYLD and NF-kappaB mRNAs in HSG cells was increased by TNF-alpha."
TNF phosphorylates CYLD.
| 3 1
TNF phosphorylates CYLD. 4 / 4
| 3 1

reach
"Although TNF was previously shown to trigger CYLD phosphorylation in Jurkat, HeLa, or HEK 293 cells, leading to the appearance of a slower migrating form of CYLD, stimulation of our Jurkat T cells with TNF did not lead to a band shift or detection of a band with the phospho (Ser418)-specific antibody, suggesting either no phosphorylation or phosphorylation at other sites."

sparser
"While the phosphorylation of A20, CYLD and p38 induced by TNFα was largely unaffected by ABIN-1 deficiency ( xref ), using an anti-phospho-S381 A20 antibody xref , the recruitment of phospho-A20 to TNF-RSC was significantly reduced inAbin-1 −/− MEFs compared to that of WT ( xref )."

reach
"The phosphorylated residue Ser568 is a novel tumor necrosis factor (TNF)-regulated phosphorylation site in CYLD and works in concert with Ser418 to enable CYLD-mediated deubiquitination and immune receptor signaling."

reach
"We have previously shown that induction of CYLD phosphorylation by TNF-alpha or mitogens is mediated by the IKK complex [XREF_BIBR]."
TNF binds CYLD.
2 | 2
2 | 2

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

No evidence text available

No evidence text available

reach
"Interestingly, after caspase mediated cleavage during apoptosis, the N-terminal fragment of HOIP also binds to the DUBs OTULIN and CYLD, which are down-regulators of LUBAC mediated ubiquitination, providing a further regulatory feedback loop."
TNF inhibits CYLD.
| 3
TNF inhibits CYLD. 3 / 3
| 3

reach
"Another protein, CYLD which deubiqitinates TRAF6, and is negatively regulated by specific TNF receptors, might play a role of a silencer of EDAR signaling, since mutations in CYLD predispose not only to skin tumors (cylidromatosis), but also to the development of tumors of eccrine sweat glands and hair follicles."

reach
"This model is consistent with the recent discovery that caspase 8 mediated cleavage of CYLD limits TNF induced programmed necrosis [XREF_BIBR], since caspase 8 is present in the necrosome, but not the TNFR-1 complex."

reach
"Inhibiting CASPASE-8 leads to CYLD dependent necroptosis caused by the TNF produced in response to TLR4 ligation."
CYLD affects IKK_complex
| 37 5
CYLD inhibits IKK_complex.
| 28 2
| 28 2

reach
"CYLD and A20 function as deubiquitination enzymes to inhibit IKK by targeting RIP1 upstream of IKK, while CUEDC2 acts as an adaptor protein to keep IKK in an inactivated status by recruiting a phospha[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"These observations suggest that suppression of CYLD enhances the activity of the IKK kinase and the nuclear localization of NF-kappaB transcription factors."

reach
"Notch is capable of enhancing NF-kappaB activity by a Hes1 dependent mechanism (Hes1 mediated suppression of Cyld, a deubiquitinase that negatively regulates the IKK complex) 53 and Hes1 independent mechanisms (NICD induced expression of NF-kappaB, NICD enhanced IKKalpha activity, or NICD mediated NF-kappaB nuclear retention) XREF_BIBR - XREF_BIBR."

sparser
"These include the deubiquitination enzymes CYLD and A20 that inhibit IKK, and the ubiquitin binding proteins NEMO and TAB2 which are the regulatory subunits of IKK and TAK1 kinase complexes, respectively."

reach
"Conversely, loss of the K63 specific deubiquitinase CYLD causes spontaneous activation of IKK and JNK as well as their upstream kinase Tak1."

reach
"However, despite its essential role in spontaneous activation of TAK1 in T cells, the loss of CYLD in Jurkat T cells did not appreciably prolong the IKK activation induced by TNFalpha."

reach
"In doing so, CYLD inhibits IKK activation by agents such as TNFalpha, IL-1beta and phorbol ester (PMA)."

reach
"In T cell acute lymphoblastic leukemia (T-ALL), CYLD expression is repressed by the Notch and Hes1 pathway to promote persistent IKK activation and cell survival [XREF_BIBR]."

reach
"Despite its essential role in suppressing the constitutive activity of IKKbeta in T cells, the loss of CYLD in Jurkat T cells did not appreciably prolong the IKK activation induced by TNF-alpha or mitogens."

reach
"Overexpression of CYLD inhibits IKK activation, whereas reducing CYLD expression has the opposite effect XREF_BIBR, XREF_BIBR, XREF_BIBR."
CYLD binds IKK_complex.
| 3 3
| 3 3

sparser
"It will be interesting to examine whether the binding of CYLD to the IKK regulators is dependent on NEMO."

reach
"We show that CYLD binds to the NEMO (also known as IKKgamma) component of the IkappaB kinase (IKK) complex, and appears to regulate its activity through de-ubiquitination of TRAF2, as TRAF2 ubiquitination can be modulated by CYLD."

sparser
"Biochemical and genetic evidence suggests that IKK is a kinase that mediates CYLD phosphorylation. xref As CYLD physically interacts with the IKK regulatory subunit, NEMO, it is likely that CYLD is recruited to the IKK holoenzyme by NEMO."

reach
"It will be interesting to examine whether the binding of CYLD to the IKK regulators is dependent on NEMO."

sparser
"Thus, future work should examine how the interaction of CYLD and IKK fits into overall landscape of IKK-mediated neuronal function and pathology."

reach
"Thus, future work should examine how the interaction of CYLD and IKK fits into overall landscape of IKK mediated neuronal function and pathology."
CYLD deubiquitinates IKK_complex.
| 4
CYLD deubiquitinates IKK_complex. 4 / 4
| 4

reach
"CYLD also deubiquitinates IkappaB kinase gamma (IKKgamma, also known as NEMO), the regulatory subunit of IKK thus inhibiting the activation of IKK."

reach
"CYLD also inhibits the ubiquitylation of TBK1 and IKKɛ, which contributes to the negative regulation of IFN responses ."

reach
"When transfected into mammalian cells, CYLD deubiquitinates NEMO as well as several IKK upstream regulators, including TRAF2, TRAF6, TRAF7, RIP1, and Tak1."

reach
"CYLD also inhibits the ubiquitylation of TBK1 and IKKε, which contributes to the negative regulation of IFN responses 171 ."
CYLD activates IKK_complex.
| 2
| 2

reach
"CYLD deficiency causes spontaneous IKK and NF-kappaB activation, associated with aberrant T cell activation and development of intestinal inflammation."

reach
"We reasoned that since TAX is known to activate IKK and can associate with CYLD , the TAX protein may be sufficient to induce CYLD phosphorylation."
RIPK1 affects CYLD
4 | 16 21
4 | 16 19

sparser
"Close proximity of binding sites of both CYLD and RIP on optineurin provides support for the adaptor function of optineurin in facilitating interaction of RIP and CYLD."

reach
"The interaction of Flag-CYLD and Myc-RIP1 was taken as positive control."

sparser
"These results show that optineurin is essential for interaction of CYLD with ubiquitinated RIP."

sparser
"Moreover, siCLIPR-59 treatment disrupted the formation of protein complex of CYLD with RIP1 ( xref )."

reach
"In contrast, under TNFalpha treatment, binding between CYLD and RIP1 or TRAF2 was reduced, if the cells also expressed PrP (XREF_FIG B)."

reach
"The interaction of CYLD and RIP1 (Receptor Interaction protein 1) was taken as positive control."

sparser
"In contrast, in siCLIPR-59-treated cells, the association of CYLD with RIP1 was reduced ( xref )."

sparser
"Optineurin is essential for interaction of CYLD with ubiquitinated RIP."

reach
"Mediating the interaction between CYLD and polyUb RIP, optineurin may act as an adaptor protein bringing CYLD and the CYLD substrate RIP together to facilitate deubiquitination of ubiquitinated RIP by CYLD."

sparser
"The results presented in this manuscript suggest that optineurin mediates interaction of deubiquitinase CYLD with polyubiquitinated RIP and this interaction is essential for deubiquitination of RIP by CYLD."
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
OTULIN affects CYLD
| 6 35
| 6 14

reach
"The interaction of CYLD and OTULIN with HOIP synergistically suppresses LUBAC mediated linear polyubiquitination and NF-kappaB activation."

reach
"Additionally, we used a HOIP-PUB domain point mutant (N102A), which abolishes the interaction of both OTULIN and CYLD with HOIP."

sparser
"Furthermore, we identified the endogenous association of CYLD and OTULIN with LUBAC and the CBM complex by the immunoprecipitation with anti-MALT1 antibody ( xref )."

reach
"Suppression of LUBAC mediated linear ubiquitination by a specific interaction between LUBAC and the deubiquitinases CYLD and OTULIN."

sparser
"Intriguingly, HOIP’s relatively small PUB domain mediates the interaction with both CYLD and OTULIN and even short deletions in this domain abolished interaction with both factors ( xref B–S3D)."

sparser
"The above question was answered by the discovery that OTULIN and CYLD interact with LUBAC [ xref – xref ] ( xref ) and further consolidated the role of OTULIN as a bona fide regulator of Met1 signalling."

sparser
"Given that, LUBAC may form a putative complex which includes both OTULIN and CYLD bound to two HOIP molecules [ xref , xref ]."

reach
"Mutually Exclusive Binding of CYLD and OTULIN to HOIP Causes CYLD Selective Recruitment to SCs."

sparser
"In addition, a mutant version of HOIP that can neither bind to OTULIN nor CYLD is also less capable of inducing canonical Wnt signaling than wildtype HOIP xref ."

sparser
"Furthermore, LUBAC constitutively interacts with the deubiquitinating enzymes (DUBs) OTULIN and CYLD, which cleave linear ubiquitin chains generated by LUBAC."
| 15

sparser
"Concomitant Loss of OTULIN and CYLD Interaction with HOIP Increases M1 Ubiquitination at the TNF-RSC and Enhances TNF-Induced Gene Activation."

sparser
"HOIP interacts with both CYLD and OTULIN even in unstimulated cells."

sparser
"Mutually Exclusive Binding of CYLD and OTULIN to HOIP Causes CYLD-Selective Recruitment to SCs."

sparser
"The HOIP missense mutation affects the conserved PUB domain of HOIP ( xref ), which has recently been shown to be important for the interaction of HOIP with OTULIN and CYLD, two deubiquitinases ( xref ; xref ; xref )."

sparser
"Additionally, we used a HOIP-PUB domain point mutant (N102A), which abolishes the interaction of both OTULIN and CYLD with HOIP ( xref , xref )."

sparser
"In line with recent reports ( xref , xref , xref , xref , xref ), our data showed that prior to stimulation, both CYLD and OTULIN interacted with HOIP ( xref B–S1D)."

sparser
"In contrast to these findings, Draber et al. demonstrated that, although both OTULIN and CYLD interact with HOIP under basal conditions, OTULIN is absent from RSCs [ xref ] (Fig.  xref ) and that knock-out of OTULIN resulted in an increase of Met1-linked poly-Ub chains in the cytosol but not at TNFR1 or NOD2 RSCs [ xref ]."

sparser
"The explanation was provided by our discovery that HOIP cannot simultaneously bind OTULIN and CYLD as both require HOIP-Asn102 for binding."

sparser
"An interaction between HOIP and OTULIN or CYLD at first inspection would seem contradictory, as a futile energy-consuming cycle would exist."

sparser
"This suggested that steric hindrance may prevent simultaneous interaction of HOIP with CYLD and OTULIN."
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
TRAF2 affects CYLD
7 1 | 13 18
7 1 | 13 15

No evidence text available

reach
"TNFalpha treatment increases the binding between PrP and the deubiquitinase tumor suppressor cylindromatosis (CYLD), in these treated cells, binding of CYLD to RIP1 and TRAF2 is reduced."

sparser
"Thus, the loss of HSC dormancy that occurs in these mice is most likely solely caused by an impaired CYLDTRAF2 interaction."

reach
"Recently, it was reported that CYLD directly interacts with NEMO and IKKgamma and TRAF2 in the NF-kappaB signaling pathway."

No evidence text available

No evidence text available

sparser
"This phenotype is dependent on the interactions between CYLD and its substrate TRAF2 (tumor necrosis factor–associated factor 2)."

reach
"CYLD interacts directly with TRAF2, an adaptor molecule involved in signaling by members of the family of TNF and nerve growth factor receptors."

No evidence text available

reach
"It was also shown that CYLD, a de-ubiquitinase known to remove K63 linked polyubiquitin chains from other proteins, binds TRAF2 [68]."
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
NFkappaB affects CYLD
| 31 7
NFkappaB activates CYLD.
| 18 1
| 18 1

reach
"9 These data suggest that CYLD controls inflammation through TRAF signaling and NF-kappaB p65 and p50 activation or cellular proliferation through Bcl-3 activation and NF-kappaB p50 and p52 binding.Re[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"On the other hand, activated NF-kappaB stimulates transcriptional upregulation of CYLD to antagonize TRAF6 by promoting its K63 linked deubiquitination, presenting a negative feedback loop of NF-kappaB activation [XREF_BIBR]."

reach
"Of the 128 screened siRNA pools, 15 matched these criteria including those targeting the known negative regulators of NF-kappaB signalling CYLD and A20."

reach
"NF-kappaB is essential for induction of CYLD, the negative regulator of NF-kappaB : evidence for a novel inducible autoregulatory feedback pathway."

sparser
"This results in inhibition of NF-κB activation and loss of CYLD is shown to inhibit apoptosis (Trompouki et al., xref ; Figure xref )."

reach
"In contrast, when the NF-kappaB pathway is overactive, as in mice expressing the constitutively activated IkappaB kinase in hematopoietic cells or mice deficient in the negative regulator of NF-kappaB signalling CYLD, NKT cellsdevelop but these cells fail to mature and to populate the periphery 61."

reach
"Either pharmacological deactivation of NF-kappaB or genetic upregulation of CYLD compromises the apoptosis resistant phenotypes of miR-19a."

reach
"However, subsequent studies have indicated that although CYLD targets NF-kappaB signaling factors, its function may depend on the cell type and stimulating receptor [XREF_BIBR]."

reach
"Moreover, as CYLD can be transcriptionally induced by the NF-kappaB pathway in a negative feedback pathway [XREF_BIBR], we may have uncovered a mechanism that leads to persistent NF-kappaB activation in gastric cancer."

reach
"The NF-kappaB activation in CYLD deficient thymocytes is independent of CARMA1, because the NF-kappaB activation was also detected in CYLD and CARMA1 double knock-out thymocytes."
NFkappaB binds CYLD.
| 4 5
| 4 5

reach
"To find the association between CYLD and NF-kappaB, we examined the correlation between CYLD and activated NF-kappaB expression."

reach
"The Pearson 's correlation test was used to determine the association between activated NF-kappaB and CYLD, with the level of significance set at 0.05."

sparser
"We show that CYLD deficiency causes constitutive NF-kappaB activation in thymocytes, which is associated with enhanced frequency of Treg cells."

reach
"As previously mentioned CYLD can bind to NEMO and NF-kappaB that have been identified as its substrates."

sparser
"We have shown that NF-κB is constitutively active in our mGluR1-expressing melanoma cells, suggesting the potential involvement of mGluR1 in the CYLDNF-κB axis [ xref ]."

reach
"At this point, CYLD binds to NF-kappaB essential modulator (NEMO)/IKK-gamma and appears to regulate its activity through deubiquitination of TNF receptor associated factor 2 (TRAF 2) [XREF_BIBR]."

sparser
"NF-κB activation was mechanistically associated with miR-301b-mediated downregulation of CYLD."

sparser
"NF-κB activation was mechanistically associated with siRNA-mediated downregulation of CYLD."

sparser
"CYLD mutations are associated with constitutive activation of NF-κB in multiple myeloma cells and B cells from mice deficient for wild-type CYLD exhibited constitutive activation of NF-κB [ xref , xref , xref ]."
NFkappaB inhibits CYLD.
| 3 1
| 3 1

reach
"If NFkappaB upregulates miR-19, relative to CYLD, this pathway ultimately allows for the sustained activation of NFkappaB in T-ALL through the miR-19 mediated inhibition of CYLD [XREF_BIBR]."

reach
"Similar to A20, the UCH-type deubiquitylating enzyme CYLD limits NF-kappaB activation by deubiquitylation."

reach
"This is also illustrated by the more than 100-fold increase of CFU in both NF-kappaB inhibited WT and Cyld -/- BMDM as compared to a < 10-fold increase in macrophages with ERK1/2 inhibition."

sparser
"These findings suggested that, by upregulating the expression of miR-130b and consequently inhibiting CYLD, NF-κB sustained its persistent activation and stimulated the progression of bladder cancer."
NFkappaB increases the amount of CYLD.
| 3
NFkappaB increases the amount of CYLD. 3 / 3
| 3

reach
"Whether CYLD expression can be induced by NF-kappaB specifically following DNA damage as a means of feedback inhibition remains to be determined."

reach
"To determine the role of CYLD in NF-kappaB signaling of cholesteatoma, CYLD and NF-kappaB expression levels in middle ear cholesteatoma epithelium were examined by immunohistochemical analysis to determine protein level and localization and compared to those of normal retroauricular (RA) skin."

reach
"For instance, the transcription of CYLD is induced by activation of the NF-kappaB and MKK3/6-p 38 pathways Post-translational covalent modifications."
NFkappaB decreases the amount of CYLD.
| 3
NFkappaB decreases the amount of CYLD. 3 / 3
| 3

reach
"However, a recent report showed that the loss of CYLD in keratinocytes of mice did not affect transcription induced by the classical p65-p50 NF-kappaB dimers but had clear effects on Bcl-3-linked p50- or p52 dependent gene regulation [XREF_BIBR]."

reach
"Thus, the present study revealed that, in bladder cancer, NF-kappaB can maintain its activity by establishing a feedback loop, in which NF-kappaB induced the expression of miR-130b, which consequently inhibited the expression of CYLD, which in turn was an endogenous inhibitor of NF-kappaB activation."

reach
"Interestingly, the reduced NF-kappaB activation in CYLD expressing macrophages limited the protective effect of IFN-gamma by reducing NF-kappaB-dependent signal transducers and activators of transcription-1 (STAT1) activation."
CYLD affects TBK1
3 1 | 1 31 4
CYLD binds TBK1.
3 | 8 2
3 | 5 1

reach
"We further demonstrated that Optn mediated recruitment of the deubiquitinase CYLD to TBK1 is responsible for this inhibitory effect."

reach
"As expected, formation of the TBK1 and CYLD complex was also reduced during the G2/M phase, while CYLD-Optn interaction remained unaffected as shown by co-immunoprecipitation and in situ PLA experiments performed in RO treated cells (Fig XREF_FIG, XREF_FIG and XREF_FIG, middle and lower panels, respectively)."

No evidence text available

reach
"CYLD also binds to TBK1 and CYLD -/- DCs show constitutive activation of TBK1."

sparser
"Disruption of the interaction between TBK1 and CYLD should lead to higher ubiquitination levels of this kinase and consequently to its hyperactivation."

reach
"Disruption of the interaction between TBK1 and CYLD should lead to higher ubiquitination levels of this kinase and consequently to its hyperactivation."

reach
"Interestingly, the number of PLA specific dots observed using anti-TBK1 and anti-ubiquitin antibodies was increased in RO treated cells compared to untreated cells (XREF_FIG), strongly suggesting that disruption of the TBK1 and CYLD interaction during the G2/M transition led to increased ubiquitination of TBK1 and therefore to its activation [XREF_BIBR]."

No evidence text available

No evidence text available
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
CYLD activates TBK1.
| 8 2
CYLD activates TBK1. 10 / 10
| 8 2

sparser
"CYLD deficiency causes constitutive activation of TBK1 and IKKε in DCs, and the CYLD-deficient DCs and MEFs are hyper-responsive to VSV in IFNβ induction xref ."

reach
"As expected, expression of CYLD resulted in reduction of the ubiquitination levels of overexpressed TBK1, further indicating that CYLD activity targeted TBK1 (XREF_FIG)."

reach
"MIB1/2, Nrdp1, CYLD, A20-TAX1BP1-ABIN1 complex and RNF11-TAX1BP1 complex modulate K63-linked ubquitination of TBK1."

sparser
"Because CYLD deficiency causes constitutive activation of IKKε and TBK1, this DUB has been suggested to play an essential role in preventing the aberrant activation of these kinases during the induction of type1 interferon that occurs during viral infection ( xref )."

reach
"Together, these results suggest that CYLD targets TBK1 or its downstream molecules to negatively regulate antiviral response."

reach
"Although this phenotype may involve ubiquitin dependent activation of RIG-I, CYLD also directly targets TBK1 and IKKepsilon to inhibit their ubiquitination 79."

reach
"Genetic deficiency in the DUB CYLD causes constitutive activation of TBK1 and IKKepsilon in DCs, rendering the cells hyperresponsive to VSV induced type I IFN expression XREF_BIBR, XREF_BIBR."

reach
"CYLD deficiency causes constitutive activation of TBK1 and IKKepsilon in DCs, and the CYLD deficient DCs and MEFs are hyper-responsive to VSV in IFNbeta induction 80."

reach
"CYLD deficiency causes constitutive activation of IKKepsilon and TBK1, which is associated with hyper-induction of IFNs in virus infected cells."

reach
"Because CYLD deficiency causes constitutive activation of IKKepsilon and TBK1, this DUB has been suggested to play an essential role in preventing the aberrant activation of these kinases during the induction of type1 interferon that occurs during viral infection."
CYLD inhibits TBK1.
| 1 7
CYLD inhibits TBK1. 8 / 8
| 1 7

reach
"Our previous studies as well as others have demonstrated that A20, TAX1BP1, ABIN1 and CYLD inhibit TBK1 and IKKi by antagonizing their Lys63 linked polyubiquitation XREF_BIBR, XREF_BIBR, XREF_BIBR."

reach
"CYLD also negatively regulates the IKK related kinases, IKKepsilon and TBK1, by the same mechanisms."

reach
"Since we have previously shown that Optn accumulates in the nucleus during the G2/M transition [XREF_BIBR], we speculated that this Optn relocation could prevent Optn and CYLD mediated inhibition of TBK1 activity."

reach
"The effect of CYLD was not specific to RIG-I, as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKɛ."

reach
"The effect of CYLD was not specific to RIG-I, as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKepsilon."

reach
"TBK1 signaling was active in these tumors as measured by elevated pCYLD and pTBK1 levels, and, in consonance with our findings in vitro, CYT387 treatment blocked CYLD phosphorylation and paradoxically increased pTBK1 (XREF_FIG)."

eidos
"Thus , CYLD ( cylindromatosis deubiquitinase ) and ubiquitin-specific protease 2b ( USP2b ) have been shown to limit TBK1 activation by removing K63-linked ubiquitin chains [ 33,34 ] ."

reach
"The effect of CYLD was not specific to RIG-I, as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKe."
CYLD deubiquitinates TBK1.
1 | 4
CYLD leads to the deubiquitination of TBK1. 5 / 5
1 | 4

reach
"CYLD also inhibits the ubiquitylation of TBK1 and IKKɛ, which contributes to the negative regulation of IFN responses ."

"CYLD removes polyubiquitin chains from RIG-I as well as from TANK binding kinase 1 (TBK1), the kinase that phosphorylates IRF3, coincident with an inhibition of the IRF3 signalling pathway."

reach
"In addition, CYLD also inhibits the ubiquitination of TBK1 and IKKepsilon, which also contributes to the negative regulation of IFN responses by CYLD 79."

reach
"CYLD also inhibits the ubiquitylation of TBK1 and IKKε, which contributes to the negative regulation of IFN responses 171 ."

reach
"XREF_BIBR, XREF_BIBR We and others have recently shown that RIG-I ubiquitination and TBK1 and IKKepsilon activation are negatively regulated by CYLD, XREF_BIBR, XREF_BIBR a deubiquitinase known to digest K63 linked ubiquitin chains."
CYLD ubiquitinates TBK1.
| 4
CYLD ubiquitinates TBK1. 4 / 4
| 4

reach
"NEDD4 and CYLD were validated to catalyze ploy-ubiquitination of TBK1 and negatively regulate type I IFN signaling (32, 33) , while CYLD was observed to remove Lys 63-linked polyubiquitin from TBK1 (33) ."

reach
"CYLD was initially thought to inhibit IFN signaling by deubiquitinating the PRR, RIG1, and downstream kinases TBK-1 and IKKepsilon 44, but surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated 45."

reach
"We further show that CYLD targets a cytoplasmic RNA sensor, RIG-I, and inhibits the ubiquitination of this IKKepsilon and TBK1 stimulator."

reach
"It was initially believed that CYLD inhibited IFN signaling by deubiquitinating the PRR, RIG-1, and downstream kinases TANK binding kinase 1 (TBK-1) and inhibitor of NF-kappaB kinase Epsilon (IKKEpsilon) 44; but, surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated.45 On the basis of these reports, TRAF3 and CYLD may serve similar functions after viral infection, namely, to inhibit NF-kappaB and activate IFN."
OPTN affects CYLD
5 | 17 17
OPTN binds CYLD.
5 | 10 17
5 | 7 16

sparser
"The interaction of CYLD with optineurin is essential for negative regulation of TNFα-induced NF-κB activation."

sparser
"Following virus infection, activation of the RIG/MAVS pathway leads to TBK1 activation (presumably through phosphorylation by an upstream unknown kinase and ubiquitination by the E3 ligases MIB1/2 or Ndrp1) and to the disruption of its interaction with Optn and CYLD."

reach
"Subsequent work has shown that OPTN interacts with the deubiquitinase CYLD, a negative regulator of NF-kappaB that deubiquitinates RIP."

sparser
"Here we have analysed the role of optineurin-CYLD interaction in the regulation of TNFα-induced NF-κB activation."

sparser
"Interestingly, Optn interacts with the tumor suppressor gene CYLD, a deubiquitinase (DUB) that catalyzes the cleavage of linear and K63-linked polyubiquitin chains and with A20, a DUB for K63-linked polyubiquitinated signaling mediators such as TRAF6 and RIP1 [ xref – xref ]."

reach
"Since optineurin interacts with CYLD, the role of optineurin in the regulation of NF-kappaB signalling is likely to be complex."

sparser
"In addition, OPTN interacts with CYLD, a deubiquitylase (DUB) for linear and K63 ubiquitin chains, which is able to negatively regulate NF-κB signalling via the deubiquitylation of a range of NF-κB signalling proteins including NEMO and RIPK1 ( xref ; xref )."

sparser
"Since optineurin interacts with CYLD, the role of optineurin in the regulation of NF-κB signalling is likely to be complex."

sparser
"Interaction of OPTN with CYLD is proposed to be involved in this regulation ( xref )."

No evidence text available
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
OPTN activates CYLD.
| 5
OPTN activates CYLD. 5 / 5
| 5

reach
"The main feature of this model is that optineurin mediates binding of CYLD to ubiquitinated RIP."

reach
"The results presented in this manuscript suggest that optineurin mediates interaction of deubiquitinase CYLD with polyubiquitinated RIP and this interaction is essential for deubiquitination of RIP by CYLD."

reach
"We further showed that Optn targets the deubiquitinase CYLD to TBK1 in order to downregulate the antiviral innate immune pathway."

reach
"We therefore concluded that Optn targets the deubiquitinase activity of CYLD to TBK1 to prevent its activity and to dampen the antiviral response."

reach
"Furthermore, optineurin inhibits the antiviral innate immune response by targetting CYLD to TBK1 to suppress its kinase activity, subsequently inhibiting interferon production."
OPTN inhibits CYLD.
| 2
OPTN inhibits CYLD. 2 / 2
| 2

reach
"Of note, optineurin, a gene in one of the other Paget 's susceptibility loci can also attenuate TNF-alpha signaling by recruiting CYLD to RIP1."

reach
"In conclusion, our observations strongly suggest that optineurin mediates targeting of CYLD to its substrate (i.e ubiquitinated RIP) which facilitates its deubiquitination."
ITCH affects CYLD
3 | 14 21
3 | 14 15

reach
"Here, we demonstrate that Itch interacts with Cyld and cooperatively regulates Tak1 and inflammation."

reach
"At present the molecular mechanisms that regulate Itch and Cyld complex formation remain unclear."

sparser
"Itch interacts with Cyld via the WW-PPXY motifs."

sparser
"Here, we demonstrate that Itch interacts with Cyld and cooperatively regulates Tak1 and inflammation."

reach
"Taken together these data collectively indicate that Itch forms a complex with Cyld via its interaction through ' PPXY ' motif."

sparser
"To further confirm the role of Itch and Cyld interaction for terminating Tak1 activation in macrophages, we reconstituted Cyld −/− BMDMs with Cyld(WT) or Cyld(Y485A) mutant that fails to interact with Itch."

sparser
"Taken together these data collectively indicate that Itch forms a complex with Cyld via its interaction through ‘PPXY’ motif."

reach
"Ahmed et al. demonstrated that Itch forms a complex with the deubiquitinase Cyld downstream of TNFalpha signaling in bone marrow derived macrophages (BMDMs), and that this complex, much like the A20 complex, replaces a K63 linked ubiquitin chain with a degradative K48 linked chain."

sparser
"To test whether Itch-Cyld interaction occurs via the ‘PPXY’ motif, we generated Y to A mutant Cyld (Cyld(Y485A)) by site-directed mutagenesis."

No evidence text available
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
CYLD affects cell death
| 3 31
CYLD activates cell death.
| 3 23
| 3 23

reach
"Genetic manipulation of Cyld in combination with pharmacological modulation of autophagic functional status revealed that CYLD suppressed autolysosomal degradation and promoted cell death in cardiomyocytes."

eidos
"CYLD can limit TNF-induced prosurvival signaling and promote cell death [ 76 ] [ 77 ] [ 78 ] ."

eidos
"CYLD can limit TNF-induced prosurvival signaling and promote cell death [ 76-78 ] ."

reach
"In control non targeting siRNA transfected cells, the treatment with TNFalpha induced at least 60-70% cell death, which is blocked by knockdown of cyld and tnfr1 but not by that of rip1 (XREF_FIG)."

reach
"We have detected that overexpression of CYLD contributed to cell death of the lung cancer cells."

reach
"Increasing CYLD promotes apoptosis and increasing PNUTL enhances cell death via TGF."

reach
"A genome-wide siRNA screen linked CYLD to receptor interacting protein-1 (RIP1) kinase mediated necroptosis; however, the exact mechanisms of CYLD mediated cell death remain unknown."

reach
"However, more importantly, five recently published reports have highlighted that SPATA2 is crucial for recruiting CYLD to the TNFR1 signaling complex thus promoting its activation leading to TNF-induced cell death."

reach
"All of the results demonstrated that overexpression of CYLD promoted cell death and CYLD played an antitumor activity in the human lung cancer cells."

reach
"These findings unravel the mechanisms of CYLD mediated cell death signaling in damaged neurons in vitro and suggest a cell death mediating role of CYLD in vivo."
CYLD inhibits cell death.
| 8
| 8

reach
"Consistent with the data above, silencing CYLD largely abolished caspase 8 activation and necroptotic cell death induced by 5z-7 plus TNFalpha (XREF_FIG)."

reach
"Ablation of the RIP1 deubiquitinase CYLD largely blocked apoptotic and necroptotic cell death induced by TAK1 inhibition."

reach
"SMAC mimetics can similarly disrupt CYLD phosphorylation and lead to ATLL cell death through reduction of RIPK1 ubiquitination, which is CYLD dependent."

reach
"Our studies reveal that under physiological conditions, TNF- and RIPK1-dependent cell death is suppressed by the linear ubiquitin-dependent inhibition of CYLD."

reach
"In addition to CYLD, these kinases can also directly phosphorylate RIPK1 to inhibit cell death."

reach
"For example, in cultured endothelial cells, Cyld was upregulated; autophagosomes accumulated; and knockdown of Cyld or Atg7 similarly rescued cell death in a setting of autophagic flux by palmitic acid overloading [55]."

reach
"Genetic manipulation of Cyld in combination with pharmacological modulation of autophagic functional status revealed that CYLD suppressed autolysosomal degradation and promoted cell death in cardiomyocytes."

reach
"However, prolonged ATRA treatment reduced CYLD SUMOylation and promoted cell death instead."
CYLD affects ITCH
3 | 14 21
3 | 14 15

reach
"Here, we demonstrate that Itch interacts with Cyld and cooperatively regulates Tak1 and inflammation."

reach
"At present the molecular mechanisms that regulate Itch and Cyld complex formation remain unclear."

sparser
"Itch interacts with Cyld via the WW-PPXY motifs."

sparser
"Here, we demonstrate that Itch interacts with Cyld and cooperatively regulates Tak1 and inflammation."

reach
"Taken together these data collectively indicate that Itch forms a complex with Cyld via its interaction through ' PPXY ' motif."

sparser
"To further confirm the role of Itch and Cyld interaction for terminating Tak1 activation in macrophages, we reconstituted Cyld −/− BMDMs with Cyld(WT) or Cyld(Y485A) mutant that fails to interact with Itch."

sparser
"Taken together these data collectively indicate that Itch forms a complex with Cyld via its interaction through ‘PPXY’ motif."

reach
"Ahmed et al. demonstrated that Itch forms a complex with the deubiquitinase Cyld downstream of TNFalpha signaling in bone marrow derived macrophages (BMDMs), and that this complex, much like the A20 complex, replaces a K63 linked ubiquitin chain with a degradative K48 linked chain."

sparser
"To test whether Itch-Cyld interaction occurs via the ‘PPXY’ motif, we generated Y to A mutant Cyld (Cyld(Y485A)) by site-directed mutagenesis."

No evidence text available
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
MIB2 affects CYLD
3 1 | 20 10
MIB2 binds CYLD.
3 | 12 8
3 | 12 6

reach
"Here, we report a novel interaction between CYLD and MIB2 and explore the effect of these proteins on Notch signalling."

No evidence text available

reach
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

reach
"Characterisation of the CYLD and MIB2 interaction."

sparser
"Here, we report a novel interaction between CYLD and MIB2 and explore the effect of these proteins on Notch signalling."

No evidence text available

sparser
"The interaction of CYLD-MIB2 was seen both in unstimulated and TNF-alpha stimulated cells, and subsequent experiments were performed without TNF-alpha stimulation ( xref )."

reach
"CYLD interacts with MIB2."

reach
"Therefore, the CYLD and MIB2 interaction was investigated in more detail."

sparser
"CYLD interacts with MIB2."
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
MIB2 ubiquitinates CYLD.
1 | 4 2
MIB2 ubiquitinates CYLD. 7 / 7
1 | 4 2

reach
"First, co-transfection of haemagglutinin epitope tagged-MIB2 (HA-MIB2) [XREF_BIBR], CYLD (untagged) and His 6 -ubiquitin expression constructs clearly drove the ubiquitylation of CYLD compared to cells transfected with CYLD and His 6 -ubiquitin, compare lanes 1 and 2), suggesting that MIB2 may ubiquitylate CYLD."

reach
"As we demonstrated that MIB2 can ubiquitylate itself as well as CYLD, we postulated that CYLD, as an ubiquitin hydrolase, might deubiquitylate MIB2, hence providing a potential mechanism of mutual regulation."

reach
"Taken together, these observations suggested that MIB2 ubiquitylates CYLD leading to CYLD destabilisation and degradation, and that CYLD might be involved in regulation of JAG2, and ultimately Notch signalling, via its interaction with MIB2."

sparser
"First, co-transfection of haemagglutinin epitope tagged-MIB2 (HA-MIB2) [ xref ], CYLD (untagged) and His 6 -ubiquitin expression constructs clearly drove the ubiquitylation of CYLD compared to cells transfected with CYLD and His 6 -ubiquitin (Figure xref panel (i), compare lanes 1 and 2), suggesting that MIB2 may ubiquitylate CYLD."

reach
"Taken together these results suggested that CYLD interacts with and is ubiquitylated by MIB2."

sparser
"Taken together, these observations suggested that MIB2 ubiquitylates CYLD leading to CYLD destabilisation and degradation, and that CYLD might be involved in regulation of JAG2, and ultimately Notch signalling, via its interaction with MIB2."
MIB2 inhibits CYLD.
| 4
MIB2 inhibits CYLD. 4 / 6
| 4

reach
"The E3 ubiquitin ligase MIB2 enhances inflammation by degrading the deubiquitinating enzyme CYLD."

reach
"Mib2 can enhance NF-kappaB signaling in inflammatory response by promoting ubiquitin dependent CYLD degradation in the Notch pathway."

reach
"Together, these results suggest that MIB2 enhances NF-kappaB signaling in inflammation by promoting the ubiquitin dependent degradation of CYLD."

reach
"Here, using the cell-free based AlphaScreen and pulldown assays to detect protein protein interactions, along with immunofluorescence assays and murine Mib2-knockout cells and animals, we demonstrate that MIB2 promotes proteasomal degradation of CYLD and enhances NF-kappaB signaling."
CYLD affects HDAC6
3 | 15 12
CYLD binds HDAC6.
3 | 6 8
3 | 6 8

reach
"The interaction between CYLD and HDAC6 was retained in the presence of nocodazole (XREF_FIG), indicating that the interaction between CYLD and HDAC6 does not require intact MTs."

No evidence text available

sparser
"The interaction between CYLD and HDAC6 was retained in the presence of nocodazole ( xref ), indicating that the interaction between CYLD and HDAC6 does not require intact MTs."

sparser
"Furthermore, GST pull-down assays using the N-terminal region of CYLD (GST–CYLD 1–212 ) and the purified form of His-tagged, full-length HDAC6 confirmed an interaction between CYLD and HDAC6 ( xref )."

reach
"CYLD binding to HDAC6 increases alpha-tubulin acetylation."

No evidence text available

reach
"Finally, CYLD also interacts with HDAC6 in the midbody where it regulates the rate of cytokinesis in a deubiquitinase independent manner."

reach
"Furthermore, GST pull-down assays using the N-terminal region of CYLD (GST-CYLD 1-212) and the purified form of His tagged, full-length HDAC6 confirmed an interaction between CYLD and HDAC6 (XREF_FIG)."

reach
"CYLD interacts with p62 directly and CYLD can directly inactivate HDAC6, thereby controlling autophagy [XREF_BIBR]."

sparser
"CYLD binding to HDAC6 increases α -tubulin acetylation."
CYLD inhibits HDAC6.
| 9 4
CYLD inhibits HDAC6. 10 / 14
| 9 4

reach
"CYLD mediated HDAC6 inhibition was observed to enhance its association with the MTs, reduce the rate of cytokinesis, and delay cell cycle (XREF_FIG)."

reach
"CYLD also inhibits HDAC6, leading to increased acetylated tubulin and less cellular motility, as we saw before [XREF_BIBR]."

sparser
"CYLD interacts with p62 directly and CYLD can directly inactivate HDAC6, thereby controlling autophagy [ xref ]."

reach
"In addition, CYLD inactivates HDAC6, which modulates cilia length [XREF_BIBR]."

reach
"We further found by immunofluorescence microscopy a colocalization of CYLD and HDAC6 at the centrosome and basal body and, interestingly, loss of Cyld promoted the localization of HDAC6 at the centrosome and basal body."

reach
"CYLD negatively regulates cell-cycle progression by inactivating HDAC6 and increasing the levels of acetylated tubulin."

reach
"Taken together, these findings suggest that CYLD, TSA, and tubacin act within the same pathway to inhibit HDAC6, which results in elevated levels of acetylated alpha-tubulin."

reach
"CYLD inhibits HDAC6 activity by binding to its catalytic domains."

reach
"CYLD negatively regulates the cell cycle by inactivating HDAC6, a histone deactylase, and increases the concentration of acetylated tubulin."

sparser
"CYLD also inhibits HDAC6, leading to increased acetylated tubulin and less cellular motility, as we saw before [ xref ]."
SQSTM1 affects CYLD
2 | 12 21
2 | 12 13

reach
"CYLD, a de-ubiquitinating enzyme, physically interacts with p62, the CYLD and TRAF6 complex negatively regulates TRAF6 ubiquitination and regulates the sustained inhibitory actions of NF-kB and NFATc1 during RANKL induced osteoclastogenesis."

reach
"XREF_BIBR, XREF_BIBR Interestingly, there is also evidence that p62 interacts with CylD, which suggests a potential dual role of p62 in regulating not only the ubiquitination and subsequent activation of NF-kappaB signaling intermediaries but also its inactivation by deubiquitination through CylD."

sparser
"CYLD, a de-ubiquitinating enzyme, physically interacts with p62, the CYLD/TRAF6 complex negatively regulates TRAF6 ubiquitination and regulates the sustained inhibitory actions of NF-kB and NFATc1 during RANKL-induced osteoclastogenesis ( xref ). xref demonstrated that Sesn2 interacts with Keap1, p62, and ubiquitin ligase and that the antioxidant activity of Sesn2 is mediated by activation of Nrf2 and p62-dependent autophagic degradation of Keap1 when ROS is increased as a result of an increase in mTORC1 activity and ER stress due to environmental stresses."

No evidence text available

sparser
"As diagrammed in xref , whereas the p62-TRAF6 interaction was found immediately after IFN-γ/TLR stimulation, this interaction was largely replaced by the p62-CYLD interaction in a later stage, indicating that TRAF6 ubiquitination, triggered upon stimulation, was reversed at a later time, coinciding with the recruitment of CYLD."

reach
"Two recent studies have shown that the adaptor protein p62 (also named sequestosome 1) binds to CYLD and recruits it to TRAF6."

sparser
"To gain functional insight into the late interaction of p62 with CYLD, we examined ubiquitination of total p62- associated proteins following stimulation."

sparser
"Adaptor protein p62 binds to CYLD and recruits it to TRAF6 [ xref ]."

reach
"Moreover, p62, which interacted with TRAF6 in an early stage, interacted with CYLD, the deubiquitinating enzyme to the p62 complex, in a later stage."

sparser
"CYLD binds the scaffolding protein and autophagy receptor p62 [ xref ], which is also abundant in the PSD."
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
CYLD affects TP53
4 1 | 1 22 3
CYLD binds TP53.
4 | 6 3
4 | 6 3

reach
"Mechanistically, we show that CYLD interacts with and deubiquitinates p53 in response to DNA damage."

No evidence text available

sparser
"Furthermore, GST pull-down assays showed that recombinant His-CYLD bound recombinant GST-p53 but not GST, suggesting that CYLD directly interacts with p53 ( xref )."

No evidence text available

No evidence text available

reach
"Together, these results showed that CYLD interacts with p53 and this interaction is enhanced by genotoxic stress."

sparser
"Together, these results showed that CYLD interacts with p53 and this interaction is enhanced by genotoxic stress."

reach
"Together, these results suggested that CYLD directly interacts with and deubiquitinates p53 facilitating its optimal stabilization in response to DNA damage."

No evidence text available

reach
"CYLD interacts with p53 in response to DNA damage."
CYLD deubiquitinates TP53.
1 | 8
CYLD deubiquitinates TP53. 9 / 9
1 | 8

"Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress.| Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD."

reach
"As shown in XREF_FIG and XREF_SUPPLEMENTARY, in contrast to WT CYLD, the catalytically inactive CYLDR936X (R/X) and CYLDH871N (H/N) mutants did not diminish p53 ubiquitination although they bound p53, demonstrating that CYLD DUB activity is required to reduce p53 ubiquitination."

reach
"To address this question, we first assessed the capacity of CYLD to reduce p53 ubiquitination in cells overexpressing HA tagged Lys-to-Arg ubiquitin mutants that can only form K48- or K63 linked chains."

reach
"Furthermore, recombinant His CYLD reduced ubiquitination of Flag-p53 immunoprecipitated from CpT treated HEK293T cells, showing that CYLD can directly deubiquitinate p53 in a cell-free in vitro assay (XREF_SUPPLEMENTARY)."

reach
"CYLD deubiquitinates p53 facilitating its stabilization."

reach
"Together, these results suggested that CYLD directly interacts with and deubiquitinates p53 facilitating its optimal stabilization in response to DNA damage."

reach
"Mechanistically, we show that CYLD interacts with and deubiquitinates p53 in response to DNA damage."

reach
"This experiment showed that CYLD diminishes p53 ubiquitination in cells expressing HA-mutant ubiquitin forming K63 only chains, but also in cells expressing HA-mutant ubiquitin forming K48 only chains (XREF_FIG)."

reach
"Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress."
CYLD activates TP53.
| 1 5
CYLD activates TP53. 6 / 7
| 1 5

reach
"In addition, overexpression of HA-CYLD diminished the ubiquitination and increased the stabilization of endogenous p53 in CpT treated HCT116 cells (XREF_FIG)."

reach
"Moreover, CYLD was predicted to regulate p53 in an unbiased bioinformatics approach aiming to build a functional human protein interaction network by combining protein interaction, gene expression and gene ontology annotations with genome-wide cancer data sets XREF_BIBR, further supporting that regulation of p53 signalling by CYLD is functionally relevant for human cancer."

reach
"Recently, CYLD was shown to promote DNA damage induced p53 stabilization and activation in epithelial cells and inhibit chemical carcinogen induced intestinal and skin tumorigenesis [XREF_BIBR]."

reach
"Additionally, CYLD upregulated p53 by about 2-fold, which was diminished by c-Jun and MKK7 (XREF_FIG)."

reach
"We found that HA-CYLD expressed in HEK-293T cells co-immunoprecipitated with endogenous p53 or overexpressed GFP-p53 in reciprocal IPs and that this interaction was enhanced after DNA damage (XREF_FIG)."

eidos
"Mechanistic dissection showed that CYLD stabilized p53 and facilitated its nuclear translocation , thereby enhancing p53 activity by removing K63-linked and K48-linked ubiquitin chains of p53 , which can bind to the PFKFB3 promoter and inhibit its transcription ."
CYLD inhibits TP53.
| 3
CYLD inhibits TP53. 3 / 4
| 3

reach
"Therefore, lack of CYLD catalytic activity inhibited the p53 dependent death of IECs in response to DNA damage in vivo and in vitro."

reach
"We did not directly address the specific role of the proteasome in mediating CYLD induced degradation of p53, as any experiment involving proteasome inhibition would result in p53 stabilization and thus would be inconclusive in proving the specific role of CYLD."

reach
"The role of CYLD in regulating p53 is evolutionarily conserved as shown by our findings that CYLD deficiency impairs p53 dependent DNA damage induced germ cell apoptosis in C. elegans."
CYLD affects SQSTM1
2 | 12 21
2 | 12 13

reach
"CYLD, a de-ubiquitinating enzyme, physically interacts with p62, the CYLD and TRAF6 complex negatively regulates TRAF6 ubiquitination and regulates the sustained inhibitory actions of NF-kB and NFATc1 during RANKL induced osteoclastogenesis."

reach
"XREF_BIBR, XREF_BIBR Interestingly, there is also evidence that p62 interacts with CylD, which suggests a potential dual role of p62 in regulating not only the ubiquitination and subsequent activation of NF-kappaB signaling intermediaries but also its inactivation by deubiquitination through CylD."

sparser
"CYLD, a de-ubiquitinating enzyme, physically interacts with p62, the CYLD/TRAF6 complex negatively regulates TRAF6 ubiquitination and regulates the sustained inhibitory actions of NF-kB and NFATc1 during RANKL-induced osteoclastogenesis ( xref ). xref demonstrated that Sesn2 interacts with Keap1, p62, and ubiquitin ligase and that the antioxidant activity of Sesn2 is mediated by activation of Nrf2 and p62-dependent autophagic degradation of Keap1 when ROS is increased as a result of an increase in mTORC1 activity and ER stress due to environmental stresses."

No evidence text available

sparser
"As diagrammed in xref , whereas the p62-TRAF6 interaction was found immediately after IFN-γ/TLR stimulation, this interaction was largely replaced by the p62-CYLD interaction in a later stage, indicating that TRAF6 ubiquitination, triggered upon stimulation, was reversed at a later time, coinciding with the recruitment of CYLD."

reach
"Two recent studies have shown that the adaptor protein p62 (also named sequestosome 1) binds to CYLD and recruits it to TRAF6."

sparser
"To gain functional insight into the late interaction of p62 with CYLD, we examined ubiquitination of total p62- associated proteins following stimulation."

sparser
"Adaptor protein p62 binds to CYLD and recruits it to TRAF6 [ xref ]."

reach
"Moreover, p62, which interacted with TRAF6 in an early stage, interacted with CYLD, the deubiquitinating enzyme to the p62 complex, in a later stage."

sparser
"CYLD binds the scaffolding protein and autophagy receptor p62 [ xref ], which is also abundant in the PSD."
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
CASP8 affects CYLD
| 21 5
CASP8 inhibits CYLD.
| 10 3
CASP8 inhibits CYLD. 10 / 17
| 10 3

reach
"We identified cFLIP upregulation that may promote caspase 8 mediated degradation of CYLD, and other necrosome components, as a possible mechanism abrogating Mtb 's capacity to coopt necroptotic signaling."

reach
"Neither RIPK1 nor RIPK3 was required for the processing of CYLD to CYLDp25 in MEFs (XREF_SUPPLEMENTARY), indicating that CASPASE 8 inactivation of CYLD occurs upstream of these necrosome components."

reach
"Neither RIPK1 nor RIPK3 were required for CYLD cleavage, and CYLD inactivation by casp8 is proposed to occur upstream of RIPK activity."

sparser
"Neither RIPK1 nor RIPK3 were required for CYLD cleavage, and CYLD inactivation by casp8 is proposed to occur upstream of RIPK activity."

reach
"In contrast, loss of CASPASE 8 prevented CYLD degradation resulting in necrotic death."

reach
"Caspase 8 then cleaves and inactivates RIPK1, RIPK3 and CYLD and stimulates apoptosis."

reach
"Caspase-8 inhibits the initiation of necroptosis by cleaving and inactivating RIP1, RIP3 [XREF_BIBR] and deubiquitinase CYLD, which was shown to be required for necroptosis induction [XREF_BIBR]."

reach
"It has recently been shown that during embryogenesis and T-cell proliferation active pro apoptotic caspase-8 blocks necroptosis by processing CYLD XREF_BIBR, XREF_BIBR, which is consistent with our findings of cross regulation of death pathways by caspase-1 activity."

reach
"Co-transfection of HEK 293 cells revealed that over-expression of wild-type CASPASE 8, but not the catalytically inactive mutant CASPASE 8-C360S, causes degradation of CYLD protein (XREF_FIG)."

reach
"Active caspase-8 has been reported to inhibit necroptosis by cleaving RIPK1, RIPK3, and CYLD XREF_BIBR - XREF_BIBR."
CASP8 activates CYLD.
| 9
CASP8 activates CYLD. 9 / 9
| 9

reach
"Thus, caspase-8 can target CYLD (the cylindromatosis tumor suppressor protein) XREF_BIBR, XREF_BIBR, a deubiquinating enzyme participant of necroptosis, and infection of HeLa cells with L - MV results in some activation of this caspase XREF_BIBR."

reach
"Necroptotic signaling is also suppressed by caspase 8 mediated cleavage of RIPK1 and/or CYLD."

reach
"This model is consistent with the recent discovery that caspase 8 mediated cleavage of CYLD limits TNF induced programmed necrosis [XREF_BIBR], since caspase 8 is present in the necrosome, but not the TNFR-1 complex."

reach
"In normal circumstances, caspase-8 molecule activates apoptosis by blocking the necroptosis and by cleaving RIPK1 and CYLD [XREF_BIBR - XREF_BIBR]."

reach
"Caspase-8 also targets the deubquitinase CYLD preventing RIPK1 initiation of necroptosis [XREF_BIBR, XREF_BIBR]."

reach
"Following TNF stimulation, aberrant CYLD necroptotic activity is held in check by caspase-8 mediated CYLD processing and inactivation 74."

reach
"An alternative explanation for the embellished necroptotic sensitivity observed in casp8 deficient cells has been raised by Ting and colleagues, observing that casp8 mediated cleavage of the E3 ubiquitin ligase CYLD enhances RIP1 and RIP3 dependent necroptosis [XREF_BIBR]."

reach
"XREF_BIBR, XREF_BIBR Second, caspase 8 mediated cleavage of CYLD generates a survival signal, whereas the mutation of caspase 8 mediated cleavage site on CYLD switches cell survival to necrotic cell death in response to TNFalpha."

reach
"Caspase-8 and FADD in tandem inhibit necroptosis by inhibiting the activity of RIPK1 and RIPK3 and CYLD and promote the advent of apoptosis via the cleavage of PARP-1 [XREF_BIBR, XREF_BIBR]."
CASP8 decreases the amount of CYLD.
| 2
CASP8 decreases the amount of CYLD. 2 / 6
| 2

reach
"Levels of CYLD may be indirectly increased by allosteric inhibition of caspase 8 (which cleaves CYLD) by zVAD-FMK [XREF_BIBR]."

reach
"Blockade of Caspase 8 activity with the pharmacological inhibitor IETD prevents the loss of full-length CYLD and this correlates with the entry of the NEMO deficient cells into cell death by programmed necrosis."
CASP8 binds CYLD.
| 2
| 2

sparser
"Interaction between transfected CYLD and CASPASE 8 by co-immunoprecipitation was observed only when the activity of CASPASE 8 was blocked by the pan-caspase inhibitor zVAD-fmk, or by mutation of the CASPASE 8 active site, suggesting that CYLD is a substrate for proteolytic cleavage by CASPASE 8 ( xref )."

sparser
"Thus, the CASPASE-8:CYLD interaction is an early switch that determines survival versus necroptotic death in the TNFR1 pathway."
TBK1 affects CYLD
3 | 20 9 1
TBK1 phosphorylates CYLD.
| 12 7 1
TBK1 phosphorylates CYLD. 10 / 12
| 7 5

reach
"We next investigated if CYLD can be phosphorylated by IKKepsilon or TBK1 in the context of TCR signaling."

reach
"Treatment with CYT387 abrogated TBK1 and IKKepsilon induced CYLD phosphorylation in 293T cells, similar to MRT67307 and in contrast to Ruxolitinib (XREF_FIG)."

sparser
"We next investigated if CYLD can be phosphorylated by IKKε or TBK1 in the context of TCR signaling."

reach
"The TCR- and PMA/I induced Ser418 phosphorylation of CYLD could be completely prevented by dual inhibition of IKKepsilon and TBK1, using MRT67307, while the IKKbeta inhibitor TPCA1 had no effect."

sparser
"However, the precise mechanism that controls the balance between TRIM25/RNF135-mediated ubiquitination and CYLDmediated deubiquitination of RIG-I and the phosphorylation of CYLD by TBK1 in its inhibitory function remains to be elucidated."

reach
"Interestingly, TBK1 or IKKε specifically causes CYLD to shift to higher molecular bands, suggesting phosphorylation of CYLD by these kinases."

reach
"To examine whether TBK1 and IKKi dual inhibitors suppress CYLD phosphorylation, SCC-9 cells were treated with different TBK1 and IKKi dual inhibitors for 1 hr, and cells were collected for western blot."

reach
"However, the precise mechanism that controls the balance between TRIM25/RNF135-mediated ubiquitination and CYLDmediated deubiquitination of RIG-I and the phosphorylation of CYLD by TBK1 in its inhibitory function remains to be elucidated.In addition to the mechanisms mentioned above, several proteins have been described as regulators in TLR-and RLR-mediated signaling."

reach
"CYLD phosphorylation can be pharmacologically reversed by IKK inhibitors, specifically by TBK1/IKKepsilon and IKKbeta inhibitors (MRT67307 and TPCA)."

sparser
"Intrigued by the faster inactivation of CYLD in P1 and P2 ( xref ), we probed the possibility that TBK1 and IKKε phosphorylate CYLD ( xref ; xref ), and assessed the contribution of that interaction to RCD."
TBK1 phosphorylates CYLD on S418. 8 / 8
| 5 2 1

rlimsp
"Interestingly, immunoprecipitation with the phospho(Ser418)-CYLD antibody, followed by immunoblotting with anti-CYLD, revealed that CYLD is phosphorylated by IKKε/TBK1 at Ser418 upon T cell stimulation, but that its direct detection with the phospho(Ser418)-CYLD-specific antibody in a western blot is masked by another inducible protein of the same size that is recognized by the same antibody."

reach
"The TCR- and PMA/I induced Ser418 phosphorylation of CYLD could be completely prevented by dual inhibition of IKKepsilon and TBK1, using MRT67307, while the IKKbeta inhibitor TPCA1 had no effect."

reach
"Our initial data indicated that CYLD is directly phosphorylated by the noncanonical IkappaB kinases (IKKs) IKKepsilon and TANK Binding Kinase 1 (TBK1) at Ser418 upon TCR stimulation."

reach
"IKKepsilon and TBK1 are activated upon T cell activation and can directly phosphorylate CYLD at Ser418."

sparser
"IKKε and TBK1 are activated upon T cell activation and can directly phosphorylate CYLD at Ser418."

reach
"Interestingly, immunoprecipitation with the phospho (Ser418)-CYLD antibody, followed by immunoblotting with anti-CYLD, revealed that CYLD is phosphorylated by IKKepsilon and TBK1 at Ser418 upon T cell stimulation, but that its direct detection with the phospho (Ser418)-CYLD-specific antibody in a western blot is masked by another inducible protein of the same size that is recognized by the same antibody."

reach
"Further, in an in vitro kinase assay we could show that recombinant IKKepsilon and TBK1 can directly phosphorylate CYLD at Ser418."

sparser
"Further, in an in vitro kinase assay we could show that recombinant IKKε and TBK1 can directly phosphorylate CYLD at Ser418 (Figure xref )."
TBK1 binds CYLD.
3 | 8 2
3 | 5 1

reach
"We further demonstrated that Optn mediated recruitment of the deubiquitinase CYLD to TBK1 is responsible for this inhibitory effect."

reach
"As expected, formation of the TBK1 and CYLD complex was also reduced during the G2/M phase, while CYLD-Optn interaction remained unaffected as shown by co-immunoprecipitation and in situ PLA experiments performed in RO treated cells (Fig XREF_FIG, XREF_FIG and XREF_FIG, middle and lower panels, respectively)."

No evidence text available

reach
"CYLD also binds to TBK1 and CYLD -/- DCs show constitutive activation of TBK1."

sparser
"Disruption of the interaction between TBK1 and CYLD should lead to higher ubiquitination levels of this kinase and consequently to its hyperactivation."

reach
"Disruption of the interaction between TBK1 and CYLD should lead to higher ubiquitination levels of this kinase and consequently to its hyperactivation."

reach
"Interestingly, the number of PLA specific dots observed using anti-TBK1 and anti-ubiquitin antibodies was increased in RO treated cells compared to untreated cells (XREF_FIG), strongly suggesting that disruption of the TBK1 and CYLD interaction during the G2/M transition led to increased ubiquitination of TBK1 and therefore to its activation [XREF_BIBR]."

No evidence text available

No evidence text available
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
CYLD affects ERK
| 21 7
CYLD inhibits ERK.
| 16 2
CYLD inhibits ERK. 10 / 23
| 16 2

sparser
"These studies provide insights into the molecular mechanisms underlying the tight regulation of inflammation via inhibition of ERK by CYLD and identified vinpocetine as a potential therapeutic agent for suppressing the inflammatory response in the pathogenesis of OM via upregulating negative regulator CYLD expression."

reach
"As shown in XREF_FIG, CYLD WT inhibited ERK phosphorylation, while CYLD knockdown, via siCYLD, markedly enhanced ERK activation by NTHi (XREF_FIG)."

reach
"In addition, it is also possible that CYLD may inhibit ERK activation and inflammation via up-regulation of MAPK phosphatase-1 (MKP-1)."

reach
"However, it remains unknown if CYLD also suppresses ERK activation induced by bacterial pathogens."

reach
"These studies provide insights into the molecular mechanisms underlying the tight regulation of inflammation via inhibition of ERK by CYLD and identified vinpocetine as a potential therapeutic agent for suppressing the inflammatory response in the pathogenesis of OM via upregulating negative regulator CYLD expression."

reach
"Future studies will focus on using DUB activity deficient CYLD mutant constructs to determine whether DUB activity is essential for the CYLD mediated suppression of ERK signaling pathway induced by bacterial pathogens."

sparser
"Vinpocetine inhibited S. pneumoniae -induced inflammatory response via inhibition of mitogen-activated protein kinase (MAPK) extracellular signal-regulated kinase (ERK) by CYLD."

reach
"Taken together, the CYLD suppression of ERK dependent IL-8 via MKP-1 may bring novel insights into the tight regulation of inflammatory responses and also lead to innovative therapeutic strategies for controlling these responses by targeting key negative regulators of inflammation."

reach
"We thus asked whether CYLD inhibited ERK activation."

reach
"CYLD also enhances oxidative stress by inhibiting the activation of the extracellular signal regulated kinase (ERK), p38/AP -1 and c-Myc pathways, ensuring Nrf2 downregulation."
CYLD activates ERK.
| 5 1
CYLD activates ERK. 6 / 6
| 5 1

reach
"57 They reported that in human lung A549 cells and lungs of Cyld -/- mice, CYLD targets the activation of ERK."

reach
"However, because Cyld deficiency did not cause the activation of ERK, the target of CYLD might be an intermediate signaling factor specifically mediating the activation of JNK and IKKbeta."

reach
"The finding that CYLD may target the ERK pathway in negatively controlling IL-8 expression is particularly significant."

reach
"However, it remained largely unknown whether or how CYLD modulated ERK signaling, when induced by bacterial pathogens."

reach
"Here, we examine both human lung epithelial A549 cells and lung of Cyld -/- mice to show that CYLD specifically targets the activation of ERK."

sparser
"Autophagy is an intrinsic defense mechanism against Lm and, therefore, we further investigated whether CYLD-dependent RIPK2 and ERK1/2 activation influences the formation of autophagosomes."
CYLD binds ERK.
| 4
| 4

sparser
"Endogenous CYLD and ERK1/2 also interacted with each other in A375 cells ( xref )."

sparser
"Thus, the CYLD-ERK interaction, like the TRIM15-ERK interaction, may be mediated by the D domain-docking site and the CD domain on the respective proteins."

sparser
"As the interaction of ERK1/2 with CYLD declined following IGF1 stimulation, the interaction of ERK1/2 with MEK increased ( xref )."

sparser
"CYLD interacts with ERK1/2 via conserved domains."
CYLD affects TNF
2 | 20
CYLD activates TNF.
| 9
CYLD activates TNF. 9 / 13
| 9

reach
"CYLD Limits Gene Activation and Enhances Cell Death in Response to TNF."

reach
"CYLD Promotes TNF-"

reach
"Moreover, overexpression of CYLD increased TNF-alpha induced cell apoptosis in A549 cells."

reach
"CYLD deficient cells are protected from RIPK1 mediated necroptosis in response to TNF plus caspase inhibition with or without Smac mimetic."

reach
"Consistent with a role in programmed necrosis, CYLD promotes the assembly of the RIP1-FADD-caspase 8 complex in response to TNF, IAP antagonist, and zVAD-fmk treatment [XREF_BIBR]."

reach
"Hence, the deubiquitinase function of CYLD is required to promote TNF induced programmed necrosis."

reach
"CYLD induction mediated, at least in part, the TZD mediated downregulation of tumor necrosis factor alpha (TNFalpha)-induced interleukin 8 (IL-8)."

reach
"In addition, CD11c-Cre Cyld (ex7/8 fl/fl) DCs produced more TNF, IL-10, and IL-12 upon infection, which led to enhanced stimulation of IFN-gamma-producing NK cells."

reach
"RNAi mediated silencing of CYLD attenuates ROS production and TNF induced programmed necrosis [XREF_BIBR]."
CYLD inhibits TNF.
| 4
CYLD inhibits TNF. 4 / 10
| 4

reach
"OPTN is required for CYLD dependent deubiquitination of RIP and also for CYLD dependent inhibition of TNFalpha induced by NF-kappaB activity."

reach
"The tumor suppressor cylindromatosis (CYLD) inhibits the NF-kappaB pathway by deubiquinating the IKKgamma subunit, as well as TNF receptor associated factor (TRAF) 2, TRAF6, and B-Cell CLL and Lymphoma 3 (BCL3) that are required for maintaining NF-kB activity."

reach
"CYLD can limit TNF induced prosurvival signaling and promote cell death [XREF_BIBR - XREF_BIBR]."

reach
"Concomitant Loss of OTULIN and CYLD Interaction with HOIP Increases M1Ubiquitination at the TNF-RSC and Enhances TNF Induced Gene Activation."
CYLD increases the amount of TNF.
| 5
CYLD increases the amount of TNF. 5 / 5
| 5

reach
"Adenoviral knockdown of Cyld inhibited basal and the tumor necrosis factor alpha (TNFalpha)-induced mRNA expression of pro inflammatory cytokines including monocyte chemotactic protein-1 (Mcp-1), intercellular adhesion molecule (Icam-1) and interleukin-6 (Il-6) in rat adult aortic SMCs (RASMCs)."

reach
"Knockdown of CYLD rescued the expression of TNF-alpha and IL-1beta at both the mRNA and protein levels in RBP-J cKO BMDMs (XREF_FIG)."

reach
"Adenoviral knockdown of Cyld inhibited basal and the tumor necrosis factor alpha (TNFalpha)-induced mRNA expression of pro inflammatory cytokines including monocyte chemotactic protein-1 (Mcp-1), intercellular adhesion molecule (Icam-1) and interleukin-6 (Il-6) in rat adult aortic VSMCs (RASMCs)."

reach
"Adenoviral knockdown of Cyld inhibited basal and the tumor necrosis factor alpha (TNFalpha)-induced mRNA expression of pro inflammatory cytokines including monocyte chemotactic protein-1 (Mcp-1), intercellular adhesion molecule (Icam-1) and interleukin-6 (Il-6) in rat adult aortic SMCs (RASMCs)."

reach
"Adenoviral knockdown of Cyld inhibited basal and the tumor necrosis factor alpha (TNFalpha)-induced mRNA expression of pro inflammatory cytokines including monocyte chemotactic protein-1 (Mcp-1), intercellular adhesion molecule (Icam-1) and interleukin-6 (Il-6) in rat adult aortic VSMCs (RASMCs)."
CYLD binds TNF.
2 | 2
2 | 2

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

No evidence text available

No evidence text available

reach
"Interestingly, after caspase mediated cleavage during apoptosis, the N-terminal fragment of HOIP also binds to the DUBs OTULIN and CYLD, which are down-regulators of LUBAC mediated ubiquitination, providing a further regulatory feedback loop."
CYLD affects OPTN
5 | 10 17
5 | 7 16

sparser
"The interaction of CYLD with optineurin is essential for negative regulation of TNFα-induced NF-κB activation."

sparser
"Following virus infection, activation of the RIG/MAVS pathway leads to TBK1 activation (presumably through phosphorylation by an upstream unknown kinase and ubiquitination by the E3 ligases MIB1/2 or Ndrp1) and to the disruption of its interaction with Optn and CYLD."

reach
"Subsequent work has shown that OPTN interacts with the deubiquitinase CYLD, a negative regulator of NF-kappaB that deubiquitinates RIP."

sparser
"Here we have analysed the role of optineurin-CYLD interaction in the regulation of TNFα-induced NF-κB activation."

sparser
"Interestingly, Optn interacts with the tumor suppressor gene CYLD, a deubiquitinase (DUB) that catalyzes the cleavage of linear and K63-linked polyubiquitin chains and with A20, a DUB for K63-linked polyubiquitinated signaling mediators such as TRAF6 and RIP1 [ xref – xref ]."

reach
"Since optineurin interacts with CYLD, the role of optineurin in the regulation of NF-kappaB signalling is likely to be complex."

sparser
"In addition, OPTN interacts with CYLD, a deubiquitylase (DUB) for linear and K63 ubiquitin chains, which is able to negatively regulate NF-κB signalling via the deubiquitylation of a range of NF-κB signalling proteins including NEMO and RIPK1 ( xref ; xref )."

sparser
"Since optineurin interacts with CYLD, the role of optineurin in the regulation of NF-κB signalling is likely to be complex."

sparser
"Interaction of OPTN with CYLD is proposed to be involved in this regulation ( xref )."

No evidence text available
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
CYLD affects CYLD
| 1 23
CYLD inhibits CYLD.
| 8
CYLD inhibits CYLD. 8 / 9
| 8

reach
"Additionally, phosphorylation of CYLD was found to downregulate CYLD activity : transient phosphorylation by IKK in a serine cluster just upstream of the TRAF2 binding site, attenuates DUB function XREF_BIBR."

reach
"The CYLD staining and protein expression were lower in the OX-LDL+ Sal A group than OX-LDL group after culturing for 48 hours (P < 0.01, Figures XREF_FIG - XREF_FIG and XREF_FIG), revealing that OX-LDL increases CYLD level and Sal A antagonizes OX-LDL by downregulating CYLD."

reach
"Together, these observations demonstrate that IKKepsilon mediated phosphorylation of CYLD at Ser418 inhibits CYLD deubiquitinase activity."

reach
"Phosphorylation of CYLD at Ser418 decreases CYLD activity."

reach
"However, constitutive phosphorylation of CYLD by IKK inactivates CYLD in HTLV-1-induced leukemia to promote heightened NF-kappaB activation."

reach
"These results demonstrate that phosphorylation of CYLD at Ser418 suppresses CYLD activity, resulting in increased NF-kappaB transcriptional activation."

reach
"As IKK mediated phosphorylation of CYLD has been reported to negatively regulate CYLD enzymatic activity [XREF_BIBR], we further explored whether IKK is also involved in regulating the degradation of CYLD by SCF beta-TRCP."

reach
"Interestingly, recent findings also suggest that OTULIN deficiency results in spontaneous inhibitory phosphorylation of CYLD, thereby limiting CYLD activity, which can be rescued by LUBAC inhibition [XREF_BIBR]."
CYLD increases the amount of CYLD.
| 5
CYLD increases the amount of CYLD. 5 / 9
| 5

reach
"The relative expression levels of CYLD following CYLD overexpression in A549 cells and H460 cells were significantly higher (3.37 +/- 0.16 and 2.67 +/- 0.17 times), compared with that in pcDNA3.1 plasmid transfected A549 and H460 cells."

reach
"BCL3 was identified as a CYLD specific substrate in BCC and treatment of BCC cell lines with cyclopamine rescued the expression of CYLD."

reach
"That is, inhibition of endogenous CYLD expression by CYLD siRNA in C33A cells (XREF_FIG) abrogated the hypoxia induced NF-kappaB activation associated with ectopic E6 expression (XREF_FIG)."

reach
"To investigate whether the constitutive expression of CYLD in RA-FLSs could be decreased by lentiviral CYLD shRNA (sh-CYLD), we transfected RA-FLSs with sh-CYLD or lentiviral vector (sh-GFP)."

reach
"The p38 and CYLD pathway is involved in neuronal necroptosis induced by OGD injury and the p38 and CYLD pathway can be activated to increase CYLD protein expression."
CYLD decreases the amount of CYLD.
| 7
CYLD decreases the amount of CYLD. 7 / 9
| 7

reach
"An adeno associated virus (AAV) vector encoding CYLD was used to suppress CYLD expression by being intratracheally instilled in rats 7 days before MCT-AV treatment."

reach
"Adenoviral over-expression of CYLD shRNA (20 MOI) completely inhibited CYLD protein expression."

reach
"In vitro cell proliferation was measured and the result shows that CYLD knockout causes cell proliferation enhancement and CYLD overexpression causes cell proliferation suppression (XREF_FIG C, D)."

reach
"Furthermore, protein expression of SOX2 and EGFR was reduced while there was a greater increase in CYLD expression following treatment with sh-SOX2, while additional miR-222-5p agomir only decreased CYLD protein expression without affecting SOX2 and EGFR expression (Figure 7E, 7F)."

reach
"Adenoviral over-expression of CYLD shRNA dose-dependently inhibited CYLD mRNA expression with an efficacy of> 90% knockdown of endogenous CYLD at dose of 10 multiplicity of infection (MOI) in HK-2 cel[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Western blotting and a dual-luciferase reporter assay were used to verify that miR-1288 targets CYLD by interacting with the 3 ' UTR of CYLD to reduce CYLD expression."

reach
"To further confirm CYLD as a target for human melanoma, specific si-RNAs of CYLD were used to inhibit CYLD expression in both melanoma cells A375 and WM35, respectively."
CYLD activates CYLD.
| 1 3
CYLD activates CYLD. 4 / 5
| 1 3

reach
"Our previous research has demonstrated that adult T-cell leukemia/lymphoma (ATLL) had high level of CYLD phosphorylation, down-regulating CYLD phosphorylation could increase CYLD deubiquitinase activity and then promoted apoptosis in ATLL [XREF_BIBR]."

reach
"IKKɛ also phosphorylates and inactivates the tumor suppressor CYLD, preventing CYLD from deubiquitinating specific substrates in the NF-κB signaling pathway."

eidos
"Knockdown of CYLD leads to diminished CYLD and p18 fluorescence and consequent reduction in co-localization ( Fig. 5d ) ."

reach
"IKKe also phosphorylates and inactivates the tumor suppressor CYLD, preventing CYLD from deubiquitinating specific substrates in the NF-kB signaling pathway."
BCL3 affects CYLD
1 | 9 21
1 | 9 21

sparser
"In contrast, wild-type keratinocytes have reduced proliferation rates compared to the knockout cells due to the interaction of BCL3 with CYLD in the cytoplasm, where removal of K63 ubiquitin chains by CYLD occurs [ xref ]."

reach
"The increased tumour incidence was attributed to the loss of an inhibitory interaction between CYLD and the proto-oncogene Bcl-3."

reach
"The colocalization of Cyld and Bcl-3 in the perinuclear region of TPA- or UV-B-treated keratinocytes suggested that Cyld may associate with Bcl-3 and regulate its activity."

sparser
"In addition to cell motility, HDAC6 regulates the cell cycle through deacetylating α-tubulin and promoting the interaction of CYLD and BCL3 [ xref , xref ] (Fig.  xref )."

sparser
"CYLD physically interacts with Bcl3 through a specific region that is different from the domain that mediates binding to TRAF2 and NEMO. xref CYLD inhibits K63-linked ubiquitination and nuclear translocation of Bcl3, thus suggesting a role for ubiquitination in the regulation of Bcl3 nuclear expression ( xref )."

sparser
"HDAC6 inactivation promotes an increase in the cellular levels of acetylated tubulin surrounding the perinuclear region and facilitates the association of CYLD with its downstream substrate, B-cell CL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available

sparser
"In our experiments, the inhibitory effect of CYLD on the nuclear accumulation of phosphorylated STAT3 resembles CYLD-Bcl3 interaction, since CYLD also deubiquitinates Bcl-3 in perinuclear regions and prevents its translocation to the nucleus, a process which significantly contributes to the development of keratinocyte hyperproliferation and development of benign tumors of the skin appendage called cylindromatosis xref ."

reach
"To examine whether the interaction between Cyld and Bcl-3 is achieved through a direct or an indirect interaction, we performed yeast two-hybrid assays."

sparser
"In Cyld+/+ keratinocytes, TPA or UV light triggers the translocation of Cyld from the cytoplasm to the perinuclear region, where Cyld binds and deubiquitinates Bcl-3, thereby preventing nuclear accumulation of Bcl-3 and p50/Bcl-3- or p52/Bcl-3-dependent proliferation."
E6 affects CYLD
| 19 12
E6 binds CYLD.
| 3 12
| 3 12

reach
"Thus, we postulated that hypoxia would lead to an enhanced protein protein interaction between E6 and CYLD, thereby allowing for more efficient E6 mediated ubiquitination."

sparser
"Hypoxia-induced degradation of CYLD is associated with E6-mediated CYLD ubiquitination."

sparser
"Thus, we postulated that hypoxia would lead to an enhanced protein-protein interaction between E6 and CYLD, thereby allowing for more efficient E6-mediated ubiquitination."

sparser
"To further define the relationship between E6 and CYLD, we tested whether E6 expression is associated with CYLD polyubiquitination."

sparser
"We performed co-immunoprecipitation studies in HeLa and SiHa cells to compare the intensity of the putative E6-CYLD protein-protein interaction in normoxia versus hypoxia."

sparser
"It is also plausible that post-translational hydroxylation may take place on a protein involved in formation of a protein complex that includes E6 and CYLD, whereby hydroxylation impairs complex formation and, by extension, the ability of E6 to target CYLD for ubiquitination."

sparser
"Indeed, these immunoprecipitation studies demonstrated that E6 and CYLD weakly interact in SiHa and HeLa cells under normoxia ( xref , lanes 2 and 6)."

sparser
"It should be noted that E6-mediated degradation of CYLD was specific to cells exposed to prolonged hypoxia, where the physical interaction of E6 and CYLD might be stabilized through posttranslational modifications ( xref )."

reach
"Whether E6 's from low-risk HPV types interact with either CYLD or NFX1-91 is currently unknown."

sparser
"E6 interacts with Cylindromatosis (CYLD) deubiquitinase to inactivate the tumor suppressor CYLD and to activate the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathway in hypoxic conditions. xref E6 interacts with p300/cAMP response element binding protein (CREB) xref , xref and interferon regulatory factor 3 (IRF-3) xref to regulate gene expression and with c-Myc to induce upregulation of human telomerase reverse transcriptase to promote cell immortalization. xref , xref , xref HPV16 E6 in the cytoplasm is also important for the oncogenic activity through its regulation of signal transduction by interactions with cytoplasmic E6BP (Erc55), xref E6TP1, xref , xref tumor-necrosis factor (TNF) receptor 1 xref and protein tyrosine phosphatase H1. xref In addition to its oncogenic activities, HPV16 E6 also protects HPV16-infected keratinocytes from the innate immune system by suppressing pro-IL-1β expression. xref "
E6 activates CYLD.
| 9
E6 activates CYLD. 9 / 9
| 9

reach
"For example, the E6 protein of human papillomavirus (HPV) targets CYLD for ubiquitination and proteasomal degradation, leading to persistent NF-kappaB activation by hypoxia in HPV infected cancer cells 130."

reach
"Interestingly, there is a precedent for E6 influencing signaling pathways involving K63 branching : HPV E6 targets the lysine 63 specific Deubiquitinase CYLD (a negative regulator of the NF-kB pathway), thereby causing prolongation of hypoxia induced NF-kB activation."

reach
"Therefore, E6 targeting of CYLD appears to be an essential step in HPV mediated tumorigenesis."

reach
"One study demonstrated that Cyld is targeted for degradation by HPV (human papillomavirus) E6 virus, to prolong NF-kappaB activation following hypoxia [XREF_BIBR]."

reach
"Based on these results, we concluded that E6 targets CYLD for proteasome mediated degradation."

reach
"Under hypoxic conditions, the HPV encoded E6 protein inactivates the CYLD tumor suppressor, a negative regulator of the NF-kappaB pathway and thereby allows for unrestricted activation of NF-kappaB."

reach
"Under hypoxic conditions, high-risk E6 also inactivates the CYLD tumor suppressor through interactions with CYLD deubiquitinase to allow unrestricted activation of NF-kappaB XREF_BIBR."

reach
"9 In cancers related to human papillomavirus (HPV), such as cervical cancer, CYLD is targeted by HPV E6 protein for degradation."

reach
"For these studies, we studied the state of CYLD ubiquitination in SiHa and HeLa cells that were treated with E6 specific siRNA or control siRNA."
E6 inhibits CYLD.
| 4
E6 inhibits CYLD. 4 / 4
| 4

reach
"In preclinical models, under hypoxic conditions, the HPV encoded E6 protein promotes inactivation and degradation of the CYLD tumor suppressor, resulting in prolonged activation of NF-kappaB pathway [XREF_BIBR]."

reach
"It is also plausible that post-translational hydroxylation may take place on a protein involved in formation of a protein complex that includes E6 and CYLD, whereby hydroxylation impairs complex formation and, by extension, the ability of E6 to target CYLD for ubiquitination."

reach
"Importantly, degradation of CYLD by E6 was prevented by treatment of cells with the proteasome inhibitor, MG132 (XREF_FIG)."

reach
"As HPV16 E6 inactivates CYLD XREF_BIBR and because defective CYLD causes enhanced nuclear import of BCL-3, we reasoned that HPV16 E6 may induce KIAA1199 expression through BCL-3 in transformed keratinocytes."
E6 decreases the amount of CYLD.
| 3
E6 decreases the amount of CYLD. 3 / 3
| 3

reach
"Transient transfection studies involving E6 and Flag tagged CYLD constructs in HEK293 cells demonstrated that CYLD expression was reduced by E6 in a dose dependent manner (XREF_FIG)."

reach
"E6 reduces CYLD expression through a proteasome dependent mechanism."

reach
"Thus, in ambient oxygen tension, E6 gene silencing in HPV positive cells led to NF-kappaB and IKKbeta activation and increased CYLD expression, whereas ectopic expression of E6 in HPV negative cells resulted in NF-kappaB activation and CYLD degradation."
TDGF1 affects CYLD
| 29
| 29

sparser
"Intriguingly, CR-CYLD overexpression switched the CR-ATG7 overexpression-dependent cardiac protection into myocardial damage and dysfunction associated with increased accumulation of autophagic vacuoles containing undegraded contents in the heart."

sparser
"CR-CYLD overexpression exacerbates PO-induced cardiomyopathy."

sparser
"We questioned whether CR-ATG7 overexpression-induced cardiac protective autophagy could reverse CR-CYLD overexpression-mediated cardiac autophagy inhibition and dysfunction."

sparser
"We found that TAC-induced onset and progression of cardiac dysfunction towards heart failure were dramatically worsened by CR-CYLD overexpression independent of gender differences ( xref and xref – xref ), demonstrating a mediator role of CYLD in PO-induced cardiomyopathy and heart failure."

sparser
"Unexpectedly, the adverse cardiac hypertrophy and dysfunction due to CR-CYLD overexpression were not attenuated by additional CR-ATG7 overexpression; instead, they became even worse due to increased ATG7 expression ( xref and xref , and xref – xref )."

sparser
"CYLD may also control the substrate access to mTORC1 without affecting mTORC1 activation because CR-CYLD overexpression had minimal impact on TAC-induced phosphorylation of Unc 51-like autophagy activating kinase 1 (ULK1) at Serine (S) 757 ( xref ), which is phosphorylated by mTORC1 thus suppressing autophagy induction [ xref ]."

sparser
"Importantly, we noticed that CR-CYLD overexpression-induced suppression of K63-linked ubiquitination is more dramatic in insoluble proteins in the heart ( xref ), that are presumably cleared by autophagic degradation aforementioned."

sparser
"In addition, CR-CYLD overexpression led to increased accumulation of autophagic vacuoles with undegraded contents without affecting the total number of autophagic vacuoles ( xref ), suggesting that CYLD could suppress autophagic degradation without affecting autophagosome or autolysosome formation."

sparser
"Cardiomyocyte-restricted (CR) overexpression of CYLD (CR-CYLD) did not cause gross health issues and hardly affected cardiac function up to age of one year in both female and male mice at physiological conditions."

sparser
"Indeed, CR-CYLD overexpression increased the steady protein level of LC3-II, an autophagosome marker in PO hearts and enhanced PO-induced accumulation of p62, an autophagy adaptor protein while dramatically suppressing autophagic flux, a more accurate measure of autophagy function [ xref ] in PO hearts ( xref and xref ), indicating a negative impact of CYLD on cardiac autophagy."
DDX58 affects CYLD
1 1 | 9 15
DDX58 binds CYLD.
1 1 | 7 15
1 1 | 5 15

sparser
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination ( xref )."

sparser
"SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-ICYLD interaction and potentiates the K63-linked deubiquitination of RIG-I. Collectively, our findings uncover a mechanism by which SDC4 antagonizes the activation of RIG-I in a CYLD-mediated deubiquitination-dependent process, thereby balancing antiviral signalling to avoid deleterious effects on host cells."

sparser
"Here the authors show that Syndecan-4 via its cytosolic domain negatively regulates antiviral immunity by enhancing RIG-I interaction with a deubiquitinating enzyme CYLD, thus inhibiting the activating K63-linked RIG-I ubiquitination."

sparser
"Interestingly, SDC4ΔC was also unable to bind CYLD ( xref ), which indicates that the CP region of SDC4 is necessary for its interaction with either RIG-I or CYLD."

reach
"CYLD binds to RIG-I and inhibits the ubiquitination and signaling function of RIG-I XREF_BIBR, XREF_BIBR."

sparser
"As shown in xref , similar to the sub-cellular pattern of RIG-I, SDC4 and CYLD were also accumulated in a perinuclear pattern on SeV infection, raising a possibility that SDC4 has a potential role in affecting the RIG-ICYLD interaction and their perinuclear localization as well."

reach
"Newly synthesized SDC4 then recruits CYLD and RIG-I to form a large complex in the membrane compartment in a perinuclear pattern, which assists the interaction between CYLD and RIG-I, as well as the deubiquitination of the K63 linked ubiquitin of RIG-I."

sparser
"We provide extensive biochemical evidence to demonstrate that SDC4, via its carboxyl-terminal intracellular domain, interacts with RIG-I and CYLD, thereby facilitating the interaction between RIG-I and CYLD."

sparser
"USP4 and ovarian tumor-domain-containing ubiquitin aldehyde-binding protein 1 (OTUB1) stabilize RIG-I proteins by eliminating the K48-linked ubiquitin chains conjugated to RIG-I. xref , xref Conversely, CYLD , a tumor suppressor gene expressed in cylindromatosis, negatively regulates RIG-I activation by deubiquitinating the K63-linked ubiquitin chains on RIG-I. xref Moreover, syndecan-4 (SDC4), which is a TM protein, complexes with both RIG-I and CYLD to promote the CYLD-mediated deubiquitination of RIG-I, leading to subsequent signaling inhibition. xref Furthermore, USP3, xref USP21, xref USP14, xref and USP27X xref also deubiquitinate the K63-linked ubiquitin of RIG-I to inhibit RIG-I function."

sparser
"CYLD binds to RIG-I and inhibits the ubiquitination and signaling function of RIG-I xref , xref ."
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
DDX58 activates CYLD.
| 2
DDX58 activates CYLD. 2 / 3
| 2

reach
"The data indicate that CYLD targets RIG-I as well as TBK1 for deubiquitination that leads to inactivation of the signaling."

reach
"Based on the in vitro assessments, this miRNA directly targets cylindromatosis (CYLD) (a negative regulator of antiviral responses through removing lysine (K)-63-linked polyubiquitin of RIG-I), increases RIG-I ubiquitination and thereupon production of IFNs-I [109].7 hsa-miRNAs and SARS-CoV-2-induced interfering factors."
| PMC
CYLD affects TDGF1
| 29
| 29

sparser
"Intriguingly, CR-CYLD overexpression switched the CR-ATG7 overexpression-dependent cardiac protection into myocardial damage and dysfunction associated with increased accumulation of autophagic vacuoles containing undegraded contents in the heart."

sparser
"CR-CYLD overexpression exacerbates PO-induced cardiomyopathy."

sparser
"We questioned whether CR-ATG7 overexpression-induced cardiac protective autophagy could reverse CR-CYLD overexpression-mediated cardiac autophagy inhibition and dysfunction."

sparser
"We found that TAC-induced onset and progression of cardiac dysfunction towards heart failure were dramatically worsened by CR-CYLD overexpression independent of gender differences ( xref and xref – xref ), demonstrating a mediator role of CYLD in PO-induced cardiomyopathy and heart failure."

sparser
"Unexpectedly, the adverse cardiac hypertrophy and dysfunction due to CR-CYLD overexpression were not attenuated by additional CR-ATG7 overexpression; instead, they became even worse due to increased ATG7 expression ( xref and xref , and xref – xref )."

sparser
"CYLD may also control the substrate access to mTORC1 without affecting mTORC1 activation because CR-CYLD overexpression had minimal impact on TAC-induced phosphorylation of Unc 51-like autophagy activating kinase 1 (ULK1) at Serine (S) 757 ( xref ), which is phosphorylated by mTORC1 thus suppressing autophagy induction [ xref ]."

sparser
"Importantly, we noticed that CR-CYLD overexpression-induced suppression of K63-linked ubiquitination is more dramatic in insoluble proteins in the heart ( xref ), that are presumably cleared by autophagic degradation aforementioned."

sparser
"In addition, CR-CYLD overexpression led to increased accumulation of autophagic vacuoles with undegraded contents without affecting the total number of autophagic vacuoles ( xref ), suggesting that CYLD could suppress autophagic degradation without affecting autophagosome or autolysosome formation."

sparser
"Cardiomyocyte-restricted (CR) overexpression of CYLD (CR-CYLD) did not cause gross health issues and hardly affected cardiac function up to age of one year in both female and male mice at physiological conditions."

sparser
"Indeed, CR-CYLD overexpression increased the steady protein level of LC3-II, an autophagosome marker in PO hearts and enhanced PO-induced accumulation of p62, an autophagy adaptor protein while dramatically suppressing autophagic flux, a more accurate measure of autophagy function [ xref ] in PO hearts ( xref and xref ), indicating a negative impact of CYLD on cardiac autophagy."
AKT affects CYLD
| 18 5
AKT binds CYLD.
| 16 4
| 16 4

reach
"In this study we provided experimental evidences for direct interaction between Akt and CYLD, and also showed that CYLD does directly deubiquitinate Akt under both endogenous and exogenous conditions."

reach
"We next determined whether Akt associates with CYLD."

sparser
"As shown in xref , endogenous CYLD indeed directly interacts with endogenous Akt and S. pneumoniae treatment increased their direct interaction."

reach
"Moreover, we found that endogenous Akt interacted with CYLD under serum starved conditions in a reciprocal immunoprecipitation assay (XREF_FIG)."

reach
"The finding that CYLD interacts with Akt and suppresses ubiquitination of Akt prompted us to determine whether CYLD prevents phosphorylation of Akt in response to growth factor stimulation."

reach
"CYLD interacts with and keeps Akt in a hypoubiquitinated and inactive stage by directly removing Akt ubiquitination under serum starvation conditions."

reach
"As shown in XREF_FIG, endogenous CYLD indeed directly interacts with endogenous Akt and S. pneumoniae treatment increased their direct interaction."

reach
"We next determined whether endogenous CYLD directly interacts with endogenous Akt and if such a direct interaction is further increased on S. pneumoniae treatment by performing Duolink in vivo protein protein interaction detection assay XREF_BIBR XREF_BIBR and co-immunoprecipitation assay."

reach
"These results suggest that CYLD interacts with Akt under serum starvation conditions and dissociates from Akt upon growth factor stimulation, which may allow E3 ligases to bind to and ubiquitinate Akt."

reach
"Because IGF-1 disrupts the interaction between Akt and CYLD, we also determined whether phosphorylation of Akt attenuated (or disrupted) its interaction with CYLD."
AKT activates CYLD.
| 2 1
AKT activates CYLD. 3 / 3
| 2 1

reach
"Because Akt is known as the major upstream regulator of GSK3beta XREF_BIBR XREF_BIBR, we investigated whether Akt mediates CYLD induced degradation of Smad3."

reach
"Additionally, YTHDC2 inactivated the protein kinase B (Akt) pathway by increasing CYLD in PTC cells."

sparser
"CYLD deficiency-mediated Akt activation is instrumental for the apoptosis-resistant phenotypes of miR-130b."
8 3 | 8 4
CYLD translocates.
| 8 4
CYLD translocates. 5 / 5
| 5

reach
"Translocation of activated CYLD to the perinuclear region of the cell is achieved by an inhibitory interaction of CYLD with histone deacetylase-6 (HDAC6) leading to an increase in the levels of acetylated alpha-tubulin around the nucleus."

reach
"It is not clear, however, how CYLD translocates to the perinuclear region to capture Bcl-3 and whether this is the only mechanism by which CYLD regulates tumour cell proliferation."

reach
"In the absence of TSA, CYLD localized throughout the cytoplasm (XREF_FIG), while in the presence of TSA or in HDAC6 depleted cells, the levels of acetylated tubulin increased and CYLD translocated to the perinuclear region where it strongly colocalized with acetylated MTs (XREF_FIG and XREF_SUPPLEMENTARY)."

reach
"CYLD inducibly translocates to a perinuclear region where it binds to the IkappaB family member Bcl-3 and removes K63 linked polyubiquitin chains, thus preventing nuclear translocation of Bcl-3-p50 and Bcl-3-p52 complexes [XREF_BIBR]."

reach
"When HDAC6 is silenced or knocked down, acetylated alpha-tubulin is increased, acetylated MTs are accumulated, and CYLD is translocated to the perinuclear region, leading to a reduced interaction between CYLD and BCL3 [XREF_BIBR, XREF_BIBR, XREF_BIBR]."
CYLD translocates from the cytoplasm. 5 / 5
| 1 4

sparser
"This study showed that in response to TPA or UV light, CYLD translocates from the cytoplasm to the perinuclear region, where it binds to and deubiquitinates Bcl-3, thereby preventing nuclear accumulation of Bcl-3 and p50-Bcl-3- or p52-Bcl-3-dependent proliferation."

reach
"This study showed that in response to TPA or UV light, CYLD translocates from the cytoplasm to the perinuclear region, where it binds to and deubiquitinates Bcl-3, thereby preventing nuclear accumulation of Bcl-3 and p50-Bcl-3- or p52-Bcl-3-dependent proliferation."

sparser
"In Cyld+/+ keratinocytes, TPA or UV light triggers the translocation of Cyld from the cytoplasm to the perinuclear region, where Cyld binds and deubiquitinates Bcl-3, thereby preventing nuclear accumulation of Bcl-3 and p50/Bcl-3- or p52/Bcl-3-dependent proliferation."

sparser
"More recently, it has been shown that 12- O -tetradecanoylphorbol-13-acetate or UVB light triggers the translocation of CYLD from the cytoplasm to the perinuclear region, where it interacts and deubiq[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Growth-promoting signals such as TPA or UV light trigger the translocation of Cyld and Bcl-3 from the cytoplasm to the perinuclear region."
CYLD translocates to the centrosome. 2 / 2
| 2

reach
"Mechanistically, Spata2 recruits the deubiquitinase CYLD to the centrosome for deubiquitination of polo like kinase 4 (PLK4), the master regulator of centrosome duplication."

reach
"Firstly, the DUB CYLD is recruited to centrosomes and the basal body of cilia via its interaction with CAP350 (centrosome associated protein of 350kDa), where it has to be present and catalytically active to promote docking of basal bodies at the plasma membrane and hence ciliogenesis [XREF_BIBR]."
CYLD binds.
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
CYLD is inactive.
6 |
CYLD phosphorylated on S432 is inactive. 2 / 2
2 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CYLD phosphorylated on S439 is inactive. 2 / 2
2 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CYLD phosphorylated on S418 is inactive. 2 / 2
2 |

"Thus, serine 418 is phosphorylated in vivo. Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"Thus, serine 418 is phosphorylated in vivo.Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CYLD is active.
2 |
CYLD phosphorylated on S422 is active. 2 / 2
2 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CYLD affects Tax
| 19 8
CYLD binds Tax.
| 8 8
| 8 8

reach
"Interestingly, the Tax and CYLD interaction appeared to be enhanced by the IKK regulatory subunit, IKKgamma, which is known to interact with both Tax [XREF_BIBR - XREF_BIBR] and CYLD [XREF_BIBR, XREF_BIBR]."

reach
"We first examined the potential physical interaction between Tax and CYLD."

sparser
"Acting in opposition to Tax ubiquitination, the deubiquitinase CYLD interacts with Tax and removes ubiquitin moieties thereby reducing the association of Tax with IKK."

reach
"We show here that the deubiquitinase CYLD physically interacts with Tax and negatively regulates the ubiquitination of this viral protein."

sparser
"We show here that the deubiquitinase CYLD physically interacts with Tax and negatively regulates the ubiquitination of this viral protein."

sparser
"In the present study, we have shown that Tax forms a complex with CYLD, in which CYLD strongly inhibits the ubiquitination and signaling function of Tax."

reach
"A recent study showed that CYLD, a DUB and tumor suppressor involved in NF-kappaB signaling pathways, interacts with Tax and removes ubiquitin chains that results in impaired Tax interaction with NEMO [XREF_BIBR]."

sparser
"Interestingly, the Tax/CYLD interaction appeared to be enhanced by the IKK regulatory subunit, IKKγ, which is known to interact with both Tax [ xref - xref ] and CYLD [ xref , xref ]."

sparser
"We found that Tax interacts with CYLD, a deubiquitinase that negatively regulates NF-κB activity, by inactivating it ( xref )."

reach
"Furthermore, Tax also interacted with CYLD in transiently transfected cells."
CYLD deubiquitinates Tax.
| 7
CYLD deubiquitinates Tax. 4 / 4
| 4

reach
"Since CYLD deubiquitinates Tax, we examined the effect of CYLD on these Tax specific signaling events."

reach
"Since CYLD is a K63 specific DUB, we examined whether the ubiquitination of Tax is negatively regulated by CYLD."

reach
"CYLD inhibits Tax ubiquitination."

reach
"As expected, the wildtype CYLD, but not its catalytically inactive mutant, efficiently inhibited Tax ubiquitination."
Mutated CYLD deubiquitinates Tax. 3 / 3
| 3

reach
"Consistently, a phospho-mimetic CYLD mutant fails to inhibit Tax ubiquitination."

reach
"Importantly, a phospho-mimetic CYLD mutant harboring serine to glutamic acid substitutions at the phosphorylation sites completely failed to deubiquitinate Tax, whereas a mutant harboring serine to analine mutations at the phsphorylation sites of CYLD (CYLD7SA) remained active in Tax deubiquitination."

reach
"A phospho-mimetic CYLD mutant failed to inhibit Tax ubiquitination."
CYLD inhibits Tax.
| 4
CYLD inhibits Tax. 4 / 4
| 4

reach
"CYLD inhibits Tax stimulated activation of IKK but not that of Tak1."

reach
"These findings suggest that CYLD negatively regulates the signaling function of Tax through inhibition of Tax ubiquitination."

reach
"Importantly, expression of wildtype CYLD, but not its catalytically inactive mutant, strongly inhibited Tax stimulated activation of IKK, supporting a role for Tax ubiquitination in the activation of IKK signaling."

reach
"CYLD inhibits Tax stimulated IKK activation via deubiquitinating Tax, although the CYLD mediated Tax deubiquitination does not affect Tax activation of Tak1."
| 2 23 1
| 2 16 1

eidos
"Furthermore , we found that CYLD deficiency promoted cervical cancer cell proliferation , colony formation , cell migration and invasion , and inhibited apoptosis instead , whereas it is just opposite with CYLD over-expression ."

reach
"Histologically, CYLD clearly prevented massive immune cell infiltration surrounding necrotic regions, and pseudopalisades appeared in bevacizumab treated control tumors."

reach
"For example, inhibition of CYLD expression enhanced human malignant melanoma growth and invasion [XREF_BIBR]."

reach
"XREF_BIBR Additionally, Sanches et al XREF_BIBR showed that CYLD suppresses cell migration and invasion in cervical cancer, and Suenaga et al XREF_BIBR reported that CYLD downregulates induction of cisplatin resistance in oral squamous cell carcinoma."

reach
"Together, these findings suggest that CYLD restricts infiltration of inflammatory cells and invasion enhanced by increased hypoxia after anti-VEGF therapy in GBM."

reach
"Loss of CYLD stimulates cellular proliferation, migration, and invasion by triggering BCL-3 nucleus translocation and activation of cyclin D1 and N-cadherin [XREF_BIBR]."
| PMC

eidos
"Loss of CYLD stimulates cellular proliferation , migration , and invasion by triggering BCL-3 nucleus translocation and activation of cyclin D1 and N-cadherin [ 99 ] ."
| PMC

reach
"Studies found that miR-362-5p reduces the expression of tumor suppressor protein CYLD, which leads to activate the NF-kB pathway to promote the proliferation, migration, and invasion of hepatocellular carcinoma cells and human breast cancer cells (Ni et al., 2015; Ni et al., 2016)."

reach
"Furthermore, CYLD overexpression inhibited SMAD7 mediated cell invasion, while CYLD depletion increased SMAD7 mediated cell invasion in OSCC cells."

reach
"These clinical findings support a link between the known tumor promoter Snail1 and its transcriptional target CYLD, indicating an important role for Snail1 to suppress CYLD during progression of melanoma and for CYLD to suppress melanoma cell proliferation and invasion."

reach
"These findings suggest that CYLD inhibits NPC development and provides strong evidence supporting a role for CYLD inhibiting fibroblast and endothelial stromal cell infiltration into NPC via suppressing the NF-kB pathway."

reach
"SPATA2 and CYLD inhibit T cell infiltration into colorectal cancer via regulation of IFN-γ/STAT1 axis."

reach
"Additionally, CYLD was able to inhibit fibroblast and endothelial stromal cell infiltration into the NPC tumor microenvironment."

reach
"CYLD Suppresses Fibroblast and Endothelial Cell Infiltration in NPC TME."

reach
"Single Cell Analysis Shows CYLD Suppresses Specific Stromal Cell Infiltration in the TME."
| 7

reach
"The TGF-beta gene also activates miR-182, which can affect the CYLD gene, which can further contribute to the activation of NF-kappaB, which was demonstrated in the case of glioblastoma, and subsequently lead to angiogenesis and tumor invasion [XREF_BIBR]."
| PMC

reach
"These findings suggest that downregulation of CYLD promotes invasion with mesenchymal transition via ALK5 stabilization in OSCC cells."

reach
"Poor CYLD expression enhanced OSCC tumor invasion, suggesting low patient survival rates."

reach
"Furthermore, CYLD overexpression inhibited SMAD7 mediated cell invasion, while CYLD depletion increased SMAD7 mediated cell invasion in OSCC cells."

reach
"Studies found that miR-362-5p reduces the expression of tumor suppressor protein CYLD, which leads to activate the NF-kB pathway to promote the proliferation, migration, and invasion of hepatocellular carcinoma cells and human breast cancer cells (Ni et al., 2015; Ni et al., 2016)."

reach
"Our study is the first to demonstrate CYLD modulates fibroblast and endothelial cell infiltration in the NPC tumor microenvironment in addition to inhibiting tumorigenicity and metastasis."

reach
"In conclusion, the findings that CYLD regulates three cancer hallmarks and mediates stromal cell infiltration in TME in NPC indicate it plays a major tumor-suppressive role in NPC tumorigenesis and metastasis by negatively regulating the NF-kB signaling pathway."
CYLD affects JNK
| 26 1
CYLD inhibits JNK.
| 20
CYLD inhibits JNK. 10 / 20
| 20

reach
"On the contrary, CYLD WT overexpression leads to a diminished JNK activation both in non stimulated and in TNF-alpha-stimulated A-CYLD WT cells (XREF_FIG)."

reach
"CYLD also negatively regulates the c-Jun N-terminal kinase (JNK) signaling pathway and mitogen activated protein kinase (MAPK) pathway, which are known to participate in a wide range of cellular processes, including proliferation, differentiation, and apoptosis of cholesteatoma [XREF_BIBR, XREF_BIBR]."

reach
"Here we show that liver specific disruption of CYLD triggers hepatocyte cell death in the periportal area via spontaneous and chronic activation of TGF-beta activated kinase 1 (TAK1) and c-Jun N-terminal kinase (JNK)."

reach
"These results establish a pivotal role for CYLD in controlling Tak1 function and explain how CYLD negatively regulates IKKbeta and JNK."

reach
"CYLD deletion causes accumulation of constitutively active TAK1, and its downstream kinases JNK and IKK, which results in T cells that become hyper-responsive to TCR stimulation."

reach
"CYLD, a de-ubiquitinating enzyme, suppresses both the NF-kappaB pathway [XREF_BIBR, XREF_BIBR] and the c-Jun N-terminal kinase pathway [XREF_BIBR - XREF_BIBR]."

reach
"While CYLD negatively regulates JNK activation by diverse stimuli, it exerts an inhibitory effect on NF-kappaB pathway by anti-CD40, LPS, and IL-1beta."

reach
"Expression of a non cleavable form of CYLD inhibited activation of the JNK pathway and expression of AP-1 target genes in a T-cell line, although CYLD silencing only minimally increased JNK activation [XREF_BIBR], possibly because of redundancy with other deubiquitinating enzymes."

reach
"CYLD, a tumor suppressor and a target gene of NF-κB, negatively regulates NF-κB and JNK activation by removing K63-linked polyubiquitin chains from TRAF2 and TRAF6 as well as several other signaling proteins [214,215]."

reach
"The loss of CYLD in both primary T cells and the Jurkat T cell line causes the constitutive activation of Tak1 as well as its downstream targets JNK and IKK."
CYLD activates JNK.
| 6 1
CYLD activates JNK. 7 / 7
| 6 1

reach
"2 The inhibition of CYLD function in keratinocytes enhances the activation of the JNK pathway."

sparser
"In agreement with the reported negative regulation of JNK and c-Myc activation by CYLD [ xref ], WB analysis of these molecules showed increased Akt, JNK and c-Myc activation (measured as levels of P-Akt, P-JNK and P-c-Myc respectively) in the skin of transgenic mice lacking the DUB function ( xref )."

reach
"In agreement with the reported negative regulation of JNK and c-Myc activation by CYLD [XREF_BIBR], WB analysis of these molecules showed increased Akt, JNK and c-Myc activation (measured as levels of P-Akt, P-JNK and P-c-Myc respectively) in the skin of transgenic mice lacking the DUB function (XREF_FIG)."

reach
"Moreover, we found that CYLD m not only increased JNK activity but also increased K63 ubiqutination on both c-Jun and c-Fos, and ultimately potentiated AP1 transcriptional activity."

reach
"Curiously, in CD3+ CD28 stimulated Jurkat T cells, MALT1 cleaves CYLD increasing activation of JNK, but not NF-kappaB [XREF_BIBR]."

reach
"In support of this view, MALT1 proteolysis of the inhibitory deubiquitinases A20 and CYLD potentiates NF-kappaB and JNK, respectively [XREF_BIBR, XREF_BIBR], while cleavage of the RNase Regnase-1 prolongs mRNA stability of T cell effector genes [XREF_BIBR]."

reach
"CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK and AP1 Signaling at Multiple Levels."
CYLD affects activation
| 26
CYLD inhibits activation. 10 / 26
| 26

sparser
"CYLD inhibits TRAIL-mediated NF-kappaB activation and enhances the sensitivity of HCC cells to TRAIL-triggered apoptosis."

sparser
"It has also been reported that optineurin is required for CYLD-dependent inhibition of NF-κB activation in immune cells ( xref )."

sparser
"As CYLD could not inhibit NF-κB activation in H486R expressing cells, we next examined whether CYLD can deubiquitinate RIP in presence of H486R mutant."

sparser
"Consequently, CYLD inhibits the activation of the transcription factor NF-κB, which plays an important role for immune responses."

sparser
"Recently, it has been reported that CYLD inhibits the activation of NF-κB by IL-1β in 293T cells ( xref )."

sparser
"Lastly, we show that the K63 deubiquitinylating enzyme CYLD can reverse RIP2-mediated NEMO ubiquitinylation and that CYLD can strongly inhibit RIP2-induced NF-kB activation."

sparser
"Consistent with the requirement of ubiquitination in RIG-I function, CYLD potently inhibits RIG-I-mediated activation of the IFN-beta promoter."

sparser
"CYLD inhibits Tax-stimulated IKK activation via deubiquitinating Tax, although the CYLD-mediated Tax deubiquitination does not affect Tax activation of Tak1."

sparser
"Here we provide clear evidence that CYLD inhibits NTHi-induced activation of ERK ( xref ), and we also demonstrate that CYLD controls IL-8 expression via specifically targeting ERK phosphorylation by activating the ERK pathway with a constitutively active form of MEK ( xref )."

sparser
"The familial CYLD (cylindromatosis tumor-suppressor gene), which is a DUB, inhibits the activation of nuclear factor κB in a manner that depends on the deubiquitinating activity of CYLD."
CYLD affects Ubiquitin
| 13 8
CYLD inhibits Ubiquitin.
| 9
| 9

reach
"This suppression of CYLD promoted ubiquitin conjugation of NF-kappaB signaling pathway components and induction of an aggressive phenotype of glioma cells both in vitro and in vivo."

reach
"CYLD was shown to negatively regulate NF-kappaB and MAPK activation by removing ubiquitin chains from key signalling molecules including NEMO, TRAF2, TRAF6 and RIPK1."

reach
"Deubiquitinating enzyme CYLD negatively regulates the ubiquitin dependent kinase Tak1 and prevents abnormal T cell responses."

reach
"We further show that CYLD negatively regulates a ubiquitin dependent NF-kappaB activator, RIP1."

reach
"Consistent with the notion that NF-kappaB signalling could be turned off through negative feedback mechanism involving CYLD mediated ubiquitin (Ub) deconjugation [XREF_BIBR], the CYLD depletion compromised and CYLD overexpression potentiated cell apoptosis are separately overrided by NF-kappaB inhibitor BAY 11-7085 and IkappaBalpha siRNA."

reach
"Mechanistically, CYLD removes lysine-63-linked ubiquitin chains from TRAF2, TRAF6, and NEMO, whereas lysine-48-linked ubiquitin chains are not degraded by CYLD."

reach
"Thus, it is possible that CYLD functions in diverse pathways and loss of CYLD activity contributes to tumorigenesis via multiple mechanisms.Lys63-linked ubiquitin chains, synthesized in response to cy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CYLD and TNFAIP3 and A20 negatively regulate the NFkappaB pathway by removing ubiquitin chains from multiple signaling molecules including TRAFs and RIP."

reach
"XREF_BIBR Suppression of CYLD by miR-182 promoted ubiquitin conjugation of NFkappaB signaling components and led to sustained NFkappaB activation."
CYLD binds Ubiquitin.
| 8

sparser
"CYLD binds linear ubiquitin."

sparser
"Since the N terminus and Lys63 side chain of ubiquitin are in close proximity, the most distal ubiquitin moiety, attached to the N terminus of the adjacent ubiquitin moiety bound to the distal ubiquit[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"In both catalytic states, the distal Ub is bound to CYLD in a similar manner, and the scissile bond is located close to the catalytic residue, whereas the proximal Ub is bound in a manner specific to Met1- or Lys63-linked chains."

sparser
"However, modeling indicates that, similar to HAUSP and USP14, the Lys48 side chain of the distal ubiquitin would be occluded and that a Lys48-linked chain could not be extended from a ubiquitin molecu[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"The detection of CYLD bound to M1-Ub reveals another, LUBAC-independent, layer of crosstalk between the two deubiquitinases."

sparser
"These data reveal a direct, LUBAC-independent but OTULIN-dependent binding of M1-Ub to CYLD."

sparser
"We identified no Gly-Gly ubiquitination signature sites on CYLD by proteomic approaches, suggesting that the posttranslational modification is not ubiquitination itself and that the binding of CYLD to M1-Ub is non-covalent."

sparser
"We confirmed the specific binding of CYLD to M1-Ub in an OTULIN gene-dosage dependent manner ( xref , xref )."
CYLD activates Ubiquitin.
| 4
| 4

reach
"Thus, it is possible that CYLD functions in diverse pathways and loss of CYLD activity contributes to tumorigenesis via multiple mechanisms.Lys63-linked ubiquitin chains, synthesized in response to cy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"MiR-182 can suppress cylindromatosis (CYLD), a deubiquitinase that mediates ubiquitin deconjugation and acts as an inhibitor of nuclear factor kappaB (NF-kappaB) activation, leading to overactivation of NF-kappaB signaling."

reach
"Thus, CYLD mediated removal of ubiquitin chains, including of linear chains, from components of the TNF-RSC results in diminished TNF induced gene activation and, at the same time, enhanced cell death."

reach
"Both CYLD and TRAF2 phosphorylation thus increase ubiquitin-dependent NF-κB signaling."
CYLD affects SMAD3
| 20
CYLD inhibits SMAD3.
| 15
CYLD inhibits SMAD3. 10 / 21
| 15

reach
"Because Akt is known as the major upstream regulator of GSK3beta XREF_BIBR XREF_BIBR, we investigated whether Akt mediates CYLD induced degradation of Smad3."

reach
"These data suggest that CYLD decreases Smad3 stability in a DUB activity dependent manner."

reach
"This interesting result thus led us to determine whether Akt is critically involved in mediating CYLD induced degradation of Smad3 by first examining the effect of Akt knockdown on Smad3 protein stability."

reach
"CYLD decreases Smad3 stability by inhibiting Akt."

reach
"On the basis that carboxy terminus of CHIP has been shown to mediate Smad3 degradation XREF_BIBR XREF_BIBR, we first determined whether CHIP mediates CYLD induced Smad3 degradation by using siCHIP."

reach
"Moreover, CYLD decreases Smad3 stability by deubiquitinating K63 polyubiquitinated Akt."

reach
"Together, these data suggest that CYLD decreases Smad3 stability and TGF-beta-signalling by inhibiting Akt."

reach
"Moreover, CYLD decreases Smad3 protein stability by directly deubiquitinating K63 polyubiquitinated Akt, which, in turn, leads to activation of GSK3beta (XREF_FIG)."

reach
"Because CYLD is a known deubiquitinating enzyme (DUB) XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR, we investigated whether CYLD induced Smad3 degradation depends on its deubiquitinating activity."

reach
"Because E3 ubiquitin ligase has a critical role in mediating Smad3 degradation XREF_BIBR and CYLD is known as a deubiquitinase XREF_BIBR XREF_BIBR XREF_BIBR, we hypothesized that CYLD may decrease Smad3 stability via regulating an E3 ubiquitin ligase."
CYLD activates SMAD3.
| 5
CYLD activates SMAD3. 5 / 5
| 5

reach
"Lim and co-workers showed that CYLD suppresses TGF-beta signalling and prevents lung fibrosis by (indirectly) reducing the stability of Smad3, in an AKT, GSK3beta and E3 ligase carboxy terminus of Hsc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CYLD inhibited transforming growth factor-beta-signalling and prevented lung fibrosis by decreasing the stability of Smad3 in an E3 ligase carboxy terminus of Hsc70 interacting protein dependent manner."

reach
"Finally, the deubiquitylase CYLD inhibits TGF-beta signaling by decreasing the stability of Smad3."

reach
"To further determine whether CYLD inhibits TGF-beta-signalling by likely targeting Smad3, we next evaluated the effect of CYLD knockdown in Smad3 deficient MEF cells."

reach
"This study proposes that CYLD inhibits TGFbeta signalling by decreasing the stability of SMAD3 via the AKT-GSK3-CHIP pathway."
CYLD affects MIB2
3 1 | 14 8
CYLD binds MIB2.
3 | 12 8
3 | 12 6

reach
"Here, we report a novel interaction between CYLD and MIB2 and explore the effect of these proteins on Notch signalling."

No evidence text available

reach
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

reach
"Characterisation of the CYLD and MIB2 interaction."

sparser
"Here, we report a novel interaction between CYLD and MIB2 and explore the effect of these proteins on Notch signalling."

No evidence text available

sparser
"The interaction of CYLD-MIB2 was seen both in unstimulated and TNF-alpha stimulated cells, and subsequent experiments were performed without TNF-alpha stimulation ( xref )."

reach
"CYLD interacts with MIB2."

reach
"Therefore, the CYLD and MIB2 interaction was investigated in more detail."

sparser
"CYLD interacts with MIB2."
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
CYLD deubiquitinates MIB2.
1 | 2
CYLD deubiquitinates MIB2. 3 / 3
1 | 2

reach
"As we demonstrated that MIB2 can ubiquitylate itself as well as CYLD, we postulated that CYLD, as an ubiquitin hydrolase, might deubiquitylate MIB2, hence providing a potential mechanism of mutual regulation."

"?To dissect CYLD function we used a proteomics approach to identify CYLD interacting proteins and identified MIB2, an ubiquitin ligase enzyme involved in Notch signalling, as a protein which interacts with CYLD. Coexpression of CYLD and MIB2 resulted in stabilisation of MIB2 protein levels and was associated with reduced levels of JAG2, a ligand implicated in Notch signalling.?"

reach
"Moreover, MIB2, an E3 ligase for the Notch ligand JAG2, is deubiquitinated and stabilized by CYLD."
HDAC6 affects CYLD
3 | 9 8
HDAC6 binds CYLD.
3 | 6 8
3 | 6 8

reach
"The interaction between CYLD and HDAC6 was retained in the presence of nocodazole (XREF_FIG), indicating that the interaction between CYLD and HDAC6 does not require intact MTs."

No evidence text available

sparser
"The interaction between CYLD and HDAC6 was retained in the presence of nocodazole ( xref ), indicating that the interaction between CYLD and HDAC6 does not require intact MTs."

sparser
"Furthermore, GST pull-down assays using the N-terminal region of CYLD (GST–CYLD 1–212 ) and the purified form of His-tagged, full-length HDAC6 confirmed an interaction between CYLD and HDAC6 ( xref )."

reach
"CYLD binding to HDAC6 increases alpha-tubulin acetylation."

No evidence text available

reach
"Finally, CYLD also interacts with HDAC6 in the midbody where it regulates the rate of cytokinesis in a deubiquitinase independent manner."

reach
"Furthermore, GST pull-down assays using the N-terminal region of CYLD (GST-CYLD 1-212) and the purified form of His tagged, full-length HDAC6 confirmed an interaction between CYLD and HDAC6 (XREF_FIG)."

reach
"CYLD interacts with p62 directly and CYLD can directly inactivate HDAC6, thereby controlling autophagy [XREF_BIBR]."

sparser
"CYLD binding to HDAC6 increases α -tubulin acetylation."
HDAC6 activates CYLD.
| 3
HDAC6 activates CYLD. 3 / 3
| 3

reach
"This is supported by the finding that depletion of HDAC6 was not sufficient to induce the interaction of CYLD with Bcl-3, but TPA mediated activation of CYLD is additionally required."

reach
"In addition, modulation of HDAC6 activity or localization has been shown to mediate the actions of CYLD, Dio3, Plk1, and ribosylation factor like proteins in ciliogenesis XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR."

reach
"However, TSA treatment or HDAC6 depletion alone did not induce interaction of CYLD with Bcl-3 (XREF_FIG)."
CYLD affects STAT1
18 | 3 3
CYLD phosphorylates STAT1.
18 |
CYLD phosphorylates STAT1 on Y701. 9 / 9
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CYLD phosphorylates STAT1 on S727. 9 / 9
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CYLD binds STAT1.
| 1 3
| 1 3

sparser
"To study how CYLD reduces STAT1 activation and nuclear accumulation in IFN-γ-stimulated Lm-infected BMDM, we analyzed whether CYLD might directly bind to STAT1."

sparser
"In accordance with the CYLD-independent activation of STAT1 by IFN-γ, we could not detect a direct interaction of CYLD with STAT1."

reach
"To study how CYLD reduces STAT1 activation and nuclear accumulation in IFN-gamma-stimulated Lm infected BMDM, we analyzed whether CYLD might directly bind to STAT1."

sparser
"However, immunoprecipitation experiments showed that CYLD and STAT1 did not interact with each other (data not shown)."
CYLD activates STAT1.
| 2
CYLD activates STAT1. 2 / 2
| 2

reach
"This indirect regulation of STAT1 signaling by CYLD resembles the function of the deubiquitinating enzyme A20, which also inhibits STAT1 activation indirectly by suppressing NF-kappaB activation."

reach
"In accordance with the CYLD independent activation of STAT1 by IFN-gamma, we could not detect a direct interaction of CYLD with STAT1."
CYLD affects CDKN2C
| 2 10 12
CYLD binds CDKN2C.
| 5 12
| 5 12

sparser
"To investigate the effect of the CYLD-p18 axis in EBV lytic replication, CYLD was transfected into HK1-EBV and HONE1-EBV cells."

sparser
"We also found that EBV deregulates the CYLD-p18 axis, which contributes to viral DNA replication and tumor growth."

sparser
"In this paper, we identified CYLD as a deubiquitinase of CKI p18, offering mechanistic insights into the contribution of CYLD-p18 axis to the cell cycle progression."

reach
"Positive fluorescent signals were observed, which indicates CYLD interacts directly with p18."

sparser
"CYLD interacts with p18."

reach
"CYLD interacts with p18."

sparser
"Here we found that EBV drives a replication passive environment by deregulating the CYLD-p18 axis."

reach
"To better understand how CYLD regulates p18, we examined whether CYLD interacts with p18."

sparser
"Therefore, we concluded that EBV deregulates the host CYLD-p18 axis to push host cells to provide suitable replication-passive cellular environments for EBV DNA replication."

reach
"The co-IP analysis revealed that the N-terminal region, especially amino acids 1-304 of CYLD, was critical for the interaction between CYLD and p18."
CYLD activates CDKN2C.
| 2 2
CYLD activates CDKN2C. 4 / 4
| 2 2

eidos
"Results ( Fig. 3a , b ) indicated that neither overexpression or knockdown of CYLD changed the expression of cyclin D or CDK4 or 6 , but influenced the protein level of p18 and pRb , and increasing CYLD expression caused an elevation in p18 levels in a dose-dependent manner in all cell lines ( Fig. 3c ) ."

reach
"Loss of CYLD causes the degradation of p18 and induces the G1/S transition."

eidos
"Loss of CYLD causes the degradation of p18 and induces the G1 / S transition ."

reach
"In contrast, knockdown of CYLD substantially decreased the half-life of p18."
CYLD deubiquitinates CDKN2C.
| 3
CYLD deubiquitinates CDKN2C. 3 / 3
| 3

reach
"Knockdown of CYLD significantly increased the polyubiquitylation of p18, whereas, overexpression of CYLD reduced the levels of polyubiquitylation of p18."

reach
"As expected, CYLD decreased p18 polyubiquitylation in vitro."

reach
"These data indicate that CYLD directly deubiquitylates p18."
CYLD affects SMAD7
1 | 12 9
CYLD binds SMAD7.
| 7 9
| 7 9

sparser
"Their data showed that expression of spliceosome of CYLD (sCYLD) and Smad7 in the colonic mucosa lamina propria T cells of CD patients was increased and correlated with disease severity."

reach
"These results establish a physiological interaction between Smad7 and CYLD."

sparser
"CYLD binds to Smad7."

reach
"We next examined whether CYLD and Smad7 can form a complex under endogenous conditions."

sparser
"We next examined whether CYLD and Smad7 can form a complex under endogenous conditions."

sparser
"These results establish a physiological interaction between Smad7 and CYLD."

reach
"Following TGF-beta stimulation in WT primary CD4 + cells, interaction between Smad7 and CYLD was readily detected by co-immunoprecipitation using anti-Smad7 antibody and immunoblotting with anti-CYLD antibody."

reach
"To further investigate the interaction between CYLD and Smad7, we analyzed the ubiquitination of endogenous Smad7 in TGF-beta-stimulated T cells."

reach
"Finally, we found that Smad7 is Lys-63-polyubiquitinated in both T cells and HeLa cells following TGF-beta stimulation and that CYLD binds to Smad7 in T cells under endogenous conditions to modulate the polyubiquitination of Smad7."

reach
"CYLD binds to Smad7."
CYLD deubiquitinates SMAD7.
1 | 2
CYLD deubiquitinates SMAD7. 3 / 3
1 | 2

"This showed that CYLD can bind to SMAD7 and deubiquitinate SMAD7 at Lysine 360 and 374 residues, which are required for the activation of TAK1 and p38 signaling"

reach
"CYLD deubiquitinates Smad7 and inhibits TGF-β signaling (58)."

reach
"CYLD deubiquitinates Smad7 and thereby inhibits the activation of TAK1 and p38, thus inhibiting the TGFbeta induced development of regulatory T cells."
CYLD activates SMAD7.
| 3
CYLD activates SMAD7. 3 / 3
| 3

reach
"The study performed in CYLD-knockout mice reported that CYLD targets SMAD7 protein for deubiquitylation and inhibits TGF-beta signalling in the development of regulatory T cells."

reach
"We then traced this finding to the fact that the absence of CYLD leads to excess ubiquitination and increased activity of Smad7, a TGF-beta-induced signaling molecule that controls TAK1 kinase activity."

reach
"The Deubiquitinase CYLD Targets Smad7 Protein to Regulate Transforming Growth Factor beta (TGF-beta) Signaling and the Development of Regulatory T Cells *."
MALT1 affects CYLD
| 13 3
MALT1 inhibits CYLD.
| 6 3
MALT1 inhibits CYLD. 9 / 10
| 6 3

reach
"T-cell receptor induced JNK activation requires proteolytic inactivation of CYLD by MALT1."

reach
"CYLD but Not RelB Nor Regnase-1 Is Reduced by MALT1 Activity in Macrophages."

reach
"In summary, our study demonstrates for the first time that (i) MALT1 modulates TLR7 agonist- and IAV induced MMP-9 response in alveolar macrophages; (ii) MALT1 mediates CYLD reduction in macrophages upon TLR7 stimulation; (iii) MMP-9 production in alveolar macrophages is through NF-kappaB but not AP-1; and that (iv) MALT1 deficiency results in reduced IAV induced disease severity."

reach
"Human paracaspase MALT1 is central to plasticity of lymphocytes as MALT1 proteolytic inactivation of CYLD ensures sustained activation of NFkappaB as well as RIG1 for providing innate immune response [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Here, we show that T-cell receptors (TCR) activation, as well as overexpression of the oncogenic API2-MALT1 fusion protein, results in proteolytic inactivation of CYLD by MALT1, which is specifically required for c-jun N-terminal kinase (JNK) activation and the inducible expression of a subset of genes."

reach
"Here, we show that T-cell receptors (TCR) activation, as well as overexpression of the oncogenic API2-MALT1 fusion protein, results in proteolytic inactivation of CYLD by MALT1, which is specifically required for c-jun N-terminal kinase (JNK) activation and the inducible expression of a subset of genes."

sparser
"Human paracaspase MALT1 is central to plasticity of lymphocytes as MALT1 proteolytic inactivation of CYLD ensures sustained activation of NFκB as well as RIG1 for providing innate immune response ( Be[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Inhibition of MALT1 activity by z-VRPR-fmk reversed CYLD degradation slightly but the difference did not reach statistical significance."

sparser
"MALT1 proteolytically cleaves and inactivates A20 as well as CYLD, two negative regulators of NF-κB signaling ( xref , xref )."
MALT1 activates CYLD.
| 6
MALT1 activates CYLD. 6 / 7
| 6

reach
"JNK activation has been connected to MALT1 catalysed CYLD cleavage XREF_BIBR."

reach
"In addition, MALT1 promotes lymphocyte activation by cleaving A20 and CYLD, deubiquitinating enzymes that have inhibitory roles in the NF-kappaB and JNK pathway, respectively XREF_BIBR, XREF_BIBR, and by cleavage of BCL10, which promotes lymphocyte adhesion XREF_BIBR."

reach
"To further confirm that MALT1 protease mediated the cleavage of MCPIP1 in macrophages, we used siRNA to knockdown MALT1 expression in macrophages, confirming that MALT1 promoted MCPIP1, but not A20, CYLD, BCL10 or RelB, degradation."

reach
"Taken together, our findings identify an important role for MALT1-mediated CYLD cleavage in BCR signaling, NF-κB activation and cell proliferation, which provides novel insights into the underlying molecular mechanisms and clinical potential of inhibitors of MALT1 and ubiquitination enzymes as promising therapeutics for DLBCL, MCL and potentially other B-cell malignancies."

reach
"At the same time, MALT1 could function as a protease activity upon TCR and CD28 co-stimulation to inactivate negative regulators of NF-kappaB signaling such as the A20 (also known as TNFAIP3), CYLD (cylindromatosis), RNase Regnase-1 as well as RelB and HOIL1 [XREF_BIBR - XREF_BIBR]."

reach
"The requirement for MALT1 mediated CYLD cleavage for intact JNK signaling downstream of the TCR has been previously described XREF_BIBR."
MALT1 decreases the amount of CYLD.
| 1
MALT1 decreases the amount of CYLD. 1 / 4
| 1

reach
"Our results indicate that MALT1 activation by either imiquimod or IAV reduces the levels of CYLD and that imiquimod induced reduction is MALT1 activity dependent."
IKBKB affects CYLD
4 11 | 4 2
IKBKB phosphorylates CYLD.
4 4 | 4 2
IKBKB phosphorylates CYLD on S418. 5 / 5
1 1 | 2 1

sparser
"While it has been reported that IKKα and IKKβ can phosphorylate Ser418 of CYLD ( xref ), we demonstrated that CYLD is phosphorylated much more efficiently by IKKε than by either of the canonical IKKs."

reach
"While it has been reported that IKKalpha and IKKbeta can phosphorylate Ser418 of CYLD, we demonstrated that CYLD is phosphorylated much more efficiently by IKKepsilon than by either of the canonical IKKs."

No evidence text available

"Thus, serine 418 is phosphorylated in vivo.Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

reach
"Previous work demonstrated that TNF-alpha induces IKKalpha- and IKKbeta mediated serine phosphorylation of CYLD (Ser 418) [49]."
IKBKB phosphorylates CYLD. 3 / 3
| 2 1

reach
"Previous work demonstrated that TNF-alpha induces IKKalpha- and IKKbeta mediated serine phosphorylation of CYLD (Ser 418) [49]."

sparser
"Seminal work by Sun and colleagues showed that CYLD was phosphorylated by IKKβ and this inhibited its catalytic activity xref ."

reach
"Interestingly, IKKalpha (I kappa B kinase alpha) and IKKbeta (I kappa B kinase beta) are also able to phosphorylate CYLD invitro, although invivo they require additional assistance of IKKgamma."
IKBKB phosphorylates CYLD on S444. 2 / 2
1 1 |

No evidence text available

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
IKBKB phosphorylates CYLD on S441. 2 / 2
1 1 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

No evidence text available
IKBKB phosphorylates CYLD on S422. 2 / 2
1 1 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

No evidence text available
IKBKB inhibits CYLD.
4 |
IKBKB inhibits CYLD. 4 / 4
4 |

"Thus, serine 418 is phosphorylated in vivo.Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
IKBKB activates CYLD.
3 |
IKBKB activates CYLD. 3 / 3
3 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CYLD affects RIPK2
1 | 1 13 6
CYLD inhibits RIPK2.
| 1 5 1
CYLD inhibits RIPK2. 7 / 7
| 1 5 1

reach
"CYLD has been reported to inhibit RIPK2 induced signaling when overexpressed, but the function of endogenous CYLD in NOD2 signaling remains unexplored and its role as a DUB is unknown."

eidos
"Thus , inhibition of RIPK2 by CYLD leads to impaired pathogen control due to a reduction in antimicrobial responses including pro-inflammatory cytokine production , ROS and nitric oxide ( NO ) production ."
| PMC

reach
"Thus, the underlying infection determines the impact of RIPK2 and CYLD on the outcome of the disease and our identification of a direct inhibition of RIPK2 by CYLD provides a mechanistical explanation of the antagonistic effects of these two signaling molecules."

reach
"Thus, inhibition of RIPK2 by CYLD leads to impaired pathogen control due to a reduction in antimicrobial responses including pro inflammatory cytokine production, ROS and nitric oxide (NO) production."
| PMC

reach
"CYLD Impairs RIPK2 Mediated Activation and Antibacterial Function of BMDM."

reach
"Thus, inhibition of RIPK2 by CYLD leads to impaired pathogen control due to a reduction in antimicrobial responses including pro inflammatory cytokine production, ROS and nitric oxide (NO) production.Another recent study used kinase inhibitors to demonstrate functional specificity of the kinase domain of RIPK2 in controlling bacterial pathogens."
| PMC

sparser
"Thus, the underlying infection determines the impact of RIPK2 and CYLD on the outcome of the disease and our identification of a direct inhibition of RIPK2 by CYLD provides a mechanistical explanation of the antagonistic effects of these two signaling molecules."
CYLD binds RIPK2.
| 4 3
| 4 3

sparser
"Catalytically inactive CYLD interacted with RIPK2 but failed to reduce K63 ubiquitination of RIPK2 (Figure xref B)."

sparser
"WB analysis of immunoprecipitates detected CYLD and RIPK2 only in WT BMDM but not in Cyld −/− BMDM indicating that CYLD interacts with RIPK2 (Figure xref A)."

reach
"The crucial importance of the CYLD and RIPK2 interaction for the reduction of protective anti-Lm immune responses is shown by the complete abolishment of the protective effect of Cyld deficiency by RIPK2 inhibition."

reach
"During in vitro infection of mouse bone marrow derived macrophages (BMDMs) with L. monocytogenes, CYLD binds and deubiquitylates RIPK2, resulting in decreased activation of NF-kappaB and ERK1/2 signaling."
| PMC

sparser
"Here, we demonstrate that CYLD also directly binds to RIPK2 and cleaves K63-polyubiquitin chains from RIPK2 in Lm-infected macrophages resulting in a reduced activation of NF-κB, p38 MAPK, and ERK1/2 and, consequently, in an impaired control of Lm in macrophages."

reach
"Here, we demonstrate that CYLD also directly binds to RIPK2 and cleaves K63-polyubiquitin chains from RIPK2 in Lm infected macrophages resulting in a reduced activation of NF-kappaB, p38 MAPK, and ERK1/2 and, consequently, in an impaired control of Lm in macrophages."

reach
"WB analysis of immunoprecipitates detected CYLD and RIPK2 only in WT BMDM but not in Cyld -/- BMDM indicating that CYLD interacts with RIPK2."
CYLD ubiquitinates RIPK2.
| 3 2
CYLD ubiquitinates RIPK2. 5 / 5
| 3 2

reach
"Although depletion of CYLD resulted in extended Ub modifications on RIPK2 (and RIPK1 after TNF treatment), the full extent of regulation of RIPK2 ubiquitination by CYLD (and OTULIN) was uncovered only when we functionally inhibited IAP proteins."

sparser
"Although depletion of CYLD resulted in extended Ub modifications on RIPK2 (and RIPK1 after TNF treatment), the full extent of regulation of RIPK2 ubiquitination by CYLD (and OTULIN) was uncovered only when we functionally inhibited IAP proteins."

sparser
"This suggests that the regulation of RIPK2 ubiquitination by CYLD (and LUBAC and OTULIN) could influence the response to infection by intracellular bacteria."

reach
"Remarkably, depletion of CYLD under these conditions restored RIPK2 ubiquitination to comparable levels as in NOD2 stimulated cells not treated with CpA (XREF_FIG A, compare lane 8 with lanes 3 and 7)."

reach
"This suggests that the regulation of RIPK2 ubiquitination by CYLD (and LUBAC and OTULIN) could influence the response to infection by intracellular bacteria."
CYLD deubiquitinates RIPK2.
1 | 1
CYLD deubiquitinates RIPK2. 2 / 2
1 | 1

reach
"The authors showed that CYLD deubiquitinated RIPK2 in macrophages infected with L. monocytogenes, leading to impaired activation of NF-kappaB, reduced production of proinflammatory cytokines and reactive oxygen and nitrogen species, which ultimately resulted in impaired infection control."

"CYLD-mediated K63 deubiquitination of RIPK2 resulted in an impaired activation of both NF-kappaB and ERK1/2 pathways, reduced production of proinflammatory cytokines interleukin-6 (IL-6), IL-12, anti-listerial reactive oxygen species (ROS) and nitric oxide (NO), and, finally, impaired pathogen control."
| 20
| 14

reach
"We found that inhibition of cyld expression in Jurkat cells also attenuated necroptosis (XREF_FIG)."

reach
"10 Active Caspase-8 not only initiates the apoptotic program but also cleaves and inactivates essential necroptosis mediators such as RIPK1, RIPK3 and CYLD."

reach
"Knockdown of the RNA sensing molecule RIG-I or the RIP1 deubiquitin protein, CYLD, but not STING, rescued cells from SeV induced necroptosis."

reach
"Specifically, CYLD removed lysine 63 and linear ubiquitin chains from RIP1 and promoted necroptosis in TNF receptor signaling, which was involved in the regulation of different cellular processes including inflammation, fibrosis, and cancer."

reach
"However, loss of CYLD in vivo was shown to delay, but not prevent necroptosis during skin inflammation [XREF_BIBR]."

reach
"Therefore, our data provides qualified support for the notion that Mtb infected macrophages, in vitro and in vivo, may be primed to undergo necroptotic death, with the exception of our finding that CYLD protein levels were strongly suppressed which, according to recent reports, impedes the induction of necroptosis."

reach
"The cell death is suppressed by knockdown of CYLD or RIP1 or RIP3 or MLKL, suggesting that this necrosis is necroptosis and mediated by CYLD-RIP1-RIP3-MLKL signaling pathway."

reach
"CYLD is required for TLR3 or TLR4 receptor induced necroptosis."

reach
"The deubiquitinase CYLD has been identified to be involved in TLR induced necroptosis in macrophages from wild derived MOLF mice."

reach
"CYLD deficient cells are protected from RIPK1 mediated necroptosis in response to TNF plus caspase inhibition with or without Smac mimetic."
| 6

reach
"Furthermore, KIAA1191 high expression suppressed the proliferation and migration of MM cells; upregulated the expression of RIP1, RIP3, and CYLD, and restored the TNF-α/z-VAD-induced necroptosis."

reach
"Caspase-8 also targets the deubquitinase CYLD preventing RIPK1 initiation of necroptosis [XREF_BIBR, XREF_BIBR]."

reach
"Recently, CYLD was shown to negatively regulate necroptosis induced by oxygen-glucose-deprivation (OGD) in primary cortical neurons."

reach
"The inhibition of cIAP and activation of CYLD could also promote necroptosis XREF_BIBR, XREF_BIBR."

reach
"In apoptotic signaling, caspase-8 may cleave de-ubiquitinase CYLD, RIP1 and RIP3, blocking initiation of necroptosis."

reach
"Thus, in the case of KP35 infection, induction of necroptosis is not due to increased CYLD, but rather the previously observed inhibition of necroptosis by CYLD was not detected."
TRAIP affects CYLD
2 1 | 3 10
2 1 | 3 7

No evidence text available

sparser
"An identical staining pattern was observed in cos-7 cells expressing either CYLD or TRIP, suggesting that CYLDTRIP interaction does not change their subcellular localizations."

sparser
"Furthermore, only the central domain (aa 106–593) but neither N-(aa 1–132) nor C-(aa 558–956) terminal domains of CYLD interacted with full-length TRIP."

sparser
"To define more precisely the region of TRIP binding to CYLD, we constructed pGADT7 expression vectors for TRIP-N (aa 1–289) and TRIP-C (aa 290–469)."

No evidence text available

sparser
"The implication of the interacting pair CYLDTRIP in NF-κB signaling adds more players to the already highly complex regulation of NF-κB activity influencing proliferation and differentiation of epidermis and skin appendages."

sparser
"Another report demonstrated that the C-terminal domain of TRIP interacts with the tumor suppressor CYLD, but there was no evidence that full-length TRIP could bind CYLD [6] ."

No evidence text available

reach
"To define more precisely the region of TRIP binding to CYLD, we constructed pGADT7 expression vectors for TRIP-N (aa 1-289) and TRIP-C (aa 290-469)."

sparser
"This study confirmed the interaction of CYLD with the C-terminal domain of TRIP by far Western analysis and co-immunoprecipitations in mammalian cells."
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
MAP3K7 affects CYLD
2 | 12 4
MAP3K7 binds CYLD.
2 | 6 4
2 | 6 4

reach
"Finally, we showed that CYLD interacts with and deubiquitinates TAK1 to negatively regulate the activation of the downstream MKK3/6-p 38alpha/beta pathway."

sparser
"Mechanistically, CYLD interacts directly with the kinase TAK1 and removes its K63-linked polyubiquitin chain, which blocks downstream activation of the JNK-p38 cascades."

reach
"Koga et al. had reported that CYLD interacted with and deubiquitinates TAK1 by negatively regulating the activation of the downstream MKK3/6-p 38alpha/beta pathway to resist the infection of gram positive bacterium Streptococcus pneumonia [XREF_BIBR]."

sparser
"In our opinion, a good explanation for this additive effect on prognosis is that this combined score better reflects the overall activity of the Cyld-Tak1 axis and that higher activity is correlated with worse prognosis."

reach
"CYLD interacts with and negatively regulates TAK1, reducing TAK1 mediated stimulation of IKK and hence activation of NFkappaB."

sparser
"Multivariate analysis, including the combined Tak1-Cyld classes, illustrated that high nuclear Tak1 and low nuclear Cyld expression clearly represents a strong and statistically independent prognostic factor."

reach
"This hypothesis is supported by a previous study in T cells showing that CYLD physically interacts with TAK1 and inhibits its ubiquitination and catalytic activity following T cell receptor stimulation."

No evidence text available

reach
"We show in this study that CYLD physically interacts with Tak1 and inhibits its ubiquitination and catalytic activity."

reach
"Interestingly, endogenous CYLD and Tak1 indeed formed a complex in T cells, which was readily detected by co-immunoprecipitation (IP) assays using the anti-CYLD antibody (XREF_FIG)."
MAP3K7 activates CYLD.
| 6
MAP3K7 activates CYLD. 6 / 6
| 6

reach
"These data collectively suggest that sustained Tak1 activation in Itch -/- and Cyld -/- BMDMs results in chronic production of proinflammatory cytokines."

reach
"Tak1 activation in Itch -/- and Cyld -/- BMDMs."

reach
"27 Of note, deregulated Tak1 ubiquitination also contributes to the hyperactivation of NF-kappaB and JNK in CYLD deficient T cells, 26 suggesting that Tak1 is a common target of CYLD in the innate and adaptive immune responses."

reach
"Furthermore, consistent with the constitutive Tak1 activation in Cyld -/- T cells, transfected CYLD potently suppressed the catalytic activity of Tak1 (XREF_FIG)."

reach
"In mature T cells, CYLD targets TAK1 for inactivation to downregulate IKK and NF-kappaB activation [XREF_BIBR]."

reach
"To determine whether Tak1 is a functional target of CYLD, we analyzed the effect of CYLD on Tak1 ubiquitination."
CYLD affects TRAIP
2 1 | 3 10
2 1 | 3 7

No evidence text available

sparser
"An identical staining pattern was observed in cos-7 cells expressing either CYLD or TRIP, suggesting that CYLDTRIP interaction does not change their subcellular localizations."

sparser
"Furthermore, only the central domain (aa 106–593) but neither N-(aa 1–132) nor C-(aa 558–956) terminal domains of CYLD interacted with full-length TRIP."

sparser
"To define more precisely the region of TRIP binding to CYLD, we constructed pGADT7 expression vectors for TRIP-N (aa 1–289) and TRIP-C (aa 290–469)."

No evidence text available

sparser
"The implication of the interacting pair CYLDTRIP in NF-κB signaling adds more players to the already highly complex regulation of NF-κB activity influencing proliferation and differentiation of epidermis and skin appendages."

sparser
"Another report demonstrated that the C-terminal domain of TRIP interacts with the tumor suppressor CYLD, but there was no evidence that full-length TRIP could bind CYLD [6] ."

No evidence text available

reach
"To define more precisely the region of TRIP binding to CYLD, we constructed pGADT7 expression vectors for TRIP-N (aa 1-289) and TRIP-C (aa 290-469)."

sparser
"This study confirmed the interaction of CYLD with the C-terminal domain of TRIP by far Western analysis and co-immunoprecipitations in mammalian cells."
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
CYLD affects STING1
| 7 12
CYLD binds STING1.
| 4 12
| 4 12

sparser
"CYLD associates with STING in a ubiquitination-dependent manner."

reach
"In contrast, the E3 ligase Trim32 or Trim 56 failed to promote the association between STING and CYLD (Fig 4A and 4B)."

sparser
"We found that ubiquitinated STING, but not unmodified STING, interacted with CYLD in vitro , suggesting that CYLD associates with STING in a ubiquitination-dependent manner."

reach
"Then, the endogenous association between STING and CYLD was further investigated."

sparser
"As shown in xref , unlike RNF5, TRIM29 could not promote CYLD-STING association."

sparser
"Fifth, CYLD associated with STING via the K48-linked polyubiquitin chains on STING, and this association appeared to be enhanced upon HSV-1 infection."

sparser
"HA-tagged STING did not interact with Myc-tagged CYLD."

sparser
"Furthermore, as it was reported that RNF5 ubiquitinated STING at K150 [ xref ], we examined whether lysine 150 of STING could influence the association of STING with CYLD."

reach
"Interestingly, the association between CYLD and STING was detected only when the E3 ligase RNF5 was coexpressed."

sparser
"Notably, the endogenous interaction between STING and CYLD was substantially enhanced upon HSV-1 infection ( xref )."
CYLD deubiquitinates STING1.
| 3
CYLD deubiquitinates STING1. 3 / 3
| 3

reach
"Notably, the CYLD USP domain also deubiquitinated STING in vitro (S6D Fig), which is consistent with our observation in S4E Fig. To substantiate this finding, we transfected Flag-STING along with HA-tagged WT ubiquitin or ubiquitin mutants in the presence or absence of CYLD, followed by immunoblotting."

reach
"Therefore, STING translocated from the ER to the Golgi upon HSV-1 stimulation, and CYLD partially accumulated with STING to promote STING deubiquitination."

reach
"We also confirmed that human CYLD and murine CYLD deubiquitinated STING in vitro, but the catalytically dead mutants (human CYLD C601S and murine CYLD C597S) could not perform the same function (S6D and S6E Fig)."
TNFAIP3 affects CYLD
| 1 17
| 7

sparser
"Nonetheless, depletion of TRIP6 can significantly enhance the association of A20 or CYLD with TRAF6 in ovarian cancer cells and promote the binding of A20 to TRAF6 in glioblastoma cells, suggesting that targeting TRIP6 may prove to be an effective strategy to restore the function of A20 and CYLD in restricting the NF-κB activity in these cancer cells."

sparser
"To address this issue, we expressed FLAG-TRAF6 in HEK293T cells and treated cells with LPA for various times to determine how TRAF6 associates with deubiquitinase A20 or CYLD."

sparser
"Nonetheless, depletion of TRIP6 by either shRNA ( xref ) or Cas9/sgRNA ( xref ) not only enhanced the association of TRAF6 with A20, but also with CYLD in untreated and treated cells, suggesting a significant role for TRIP6 in antagonizing the binding of TRAF6 to both A20 and CYLD in ovarian cancer cells."

sparser
"On the other hand, in ovarian cancer cells and glioblastoma cells that show persistent NF-κB activity and high levels of TRIP6, both A20 and CYLD bind to TRAF6 very weakly."

sparser
"In this regard, here we provide evidence that the adaptor protein TRIP6 (thyroid hormone receptor-interacting protein 6), a specific interacting protein of the LPA2 receptor but not other LPA receptors, recruits TRAF6 to the LPA2 receptor and enhances the E3 ligase activity of TRAF6 by antagonizing the association of A20 and CYLD to TRAF6."

sparser
"Overexpression of TRIP6 interferes with the recruitment of A20 to TRAF6, whereas depletion of TRIP6 enhances the association of TRAF6 with A20 and CYLD, and eliminates LPA-promoted K63-linked polyubiquitination of TRAF6."

sparser
"In contrast, depletion of TRIP6 by TRIP6-specific shRNA or Cas9/sgRNA greatly enhances the association of TRAF6 with A20 and CYLD, and attenuates lysophosphatidic acid-induced muclear factor-κB and JNK/p38 activation in ovarian cancer cells."
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
| 3

sparser
"Adding just another level of complexity to an already crowded CD137 signalosome, we have recently observed the functional association of K63-DUBs A20 and CYLD to the CD137 signalosome."

sparser
"IP assay results indicated that the methylated TRAF2 weakened the interaction with A20 or CYLD."
| PMC

sparser
"Furthermore, A20 and CYLD are recognized for their tumor suppressing functions because deficiency or mutation of A20 or CYLD is associated with lymphoma and familiar cylindromatosis, respectively [ xref – xref ]."
| 1 1

sparser
"Several DUBs, including A20, CYLD and USP7, have been reported to downregulate NF- κ B. Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 ( xref , xref )."

reach
"Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 (XREF_FIG, XREF_SUPPLEMENTARY)."
CYLD affects CXCL8
| 17 1
CYLD decreases the amount of CXCL8.
| 10
CYLD decreases the amount of CXCL8. 10 / 10
| 10

reach
"Addition of CYLD siRNA to A20 siRNA further increased the IL-8 mRNA expression suggesting additive effects of CYLD and A20."

reach
"Addition of CYLD siRNA to A20 siRNA further increased the IL-8 mRNA expression in tolerant cells suggesting additive effects of CYLD and A20."

reach
"CYLD negatively regulates nontypeable Haemophilus influenzae induced IL-8 expression via phosphatase MKP-1-dependent inhibition of ERK."

reach
"Having demonstrated that CYLD suppresses NTHi induced IL-8 expression, we next aimed to investigate the mechanism through which this regulation occurs."

reach
"Together, these data suggest that CYLD negatively regulates IL-8 expression by specifically targeting the ERK signaling pathway."

reach
"We next sought to determine whether CYLD inhibits upregulation of IL-8 expression induced by direct activation of ERK using a constitutively active form of MEK (MEK-CA)."

reach
"In this study, we demonstrated that CYLD strongly suppressed NTHi induced IL-8 expression in human lung epithelial cells."

reach
"Importantly, we determined that CYLD negatively regulates ERK dependent IL-8 expression specifically by inducing MKP-1 expression."

reach
"Here, we show that CYLD suppresses NTHi induced IL-8 expression by specifically targeting the activation of ERK."

reach
"We further demonstrated that CYLD decreased IL-8 levels via inactivation of the ERK signaling pathway."
CYLD inhibits CXCL8.
| 7 1
CYLD inhibits CXCL8. 8 / 8
| 7 1

sparser
"Additionally, similar result was also observed in human cervical epithelial HeLa cells ( xref ), which further suggests the generalizability of inhibition of IL-8 by CYLD."

reach
"To further elucidate the role of CYLD in IL-8 levels, we used the specific MEK inhibitor, PD98059, to examine the involvement of the ERK pathway in CYLD mediated suppression of IL-8."

reach
"Additionally, similar result was also observed in human cervical epithelial HeLa cells (XREF_SUPPLEMENTARY), which further suggests the generalizability of inhibition of IL-8 by CYLD."

reach
"As shown in XREF_FIG, IL-8 induction is markedly inhibited by CYLD WT."

reach
"MKP-1 and CYLD can synergistically inhibit production of neutrophil chemoattractant IL-8 from airway epithelial cells."

reach
"Moreover, CYLD also negatively regulated IL-8 induction by nontypeable Haemophilus influenzae (NTHi), another major OM bacterial pathogen, via MKP-1-mediated ERK inactivation (66)."

reach
"In fact, CYLD overexpression significantly inhibited hypoxia triggered induction of IL-6 and IL-8."

reach
"Taken together, the CYLD suppression of ERK dependent IL-8 via MKP-1 may bring novel insights into the tight regulation of inflammatory responses and also lead to innovative therapeutic strategies for controlling these responses by targeting key negative regulators of inflammation."
SNAI1 affects CYLD
| 11
SNAI1 decreases the amount of CYLD.
| 6
SNAI1 decreases the amount of CYLD. 6 / 8
| 6

reach
"Down-regulation of CYLD expression by Snail promotes tumor progression in malignant melanoma."

reach
"Reduced CYLD expression in basal cell carcinoma was mediated by GLI1 dependent activation of the transcriptional repressor Snail."

reach
"However, CYLD mRNA transcription is directly inhibited by Snail [XREF_BIBR] and the Notch target Hes1 [XREF_BIBR], both of which are up-regulated and activated under hypoxic conditions [XREF_BIBR, XREF_BIBR]."

reach
"Snail can inhibit CYLD expression in melanoma [XREF_BIBR]."

reach
"CYLD expression is downregulated by the transcriptional repressor Snail in both basal cell carcinoma and melanoma."

reach
"Snail also promotes proliferation in a melanoma model by repressing expression of CYLD, a tumor suppressor gene that functions as a deubiquitination enzyme."
SNAI1 inhibits CYLD.
| 3
SNAI1 inhibits CYLD. 3 / 7
| 3

reach
"10 In basal cell carcinoma, the mechanism for increased SNAI1 mediated repression of CYLD is with the Sonic hedgehog transcription factor GLI1."

reach
"In skin cancers such as basal cell carcinoma and melanoma, CYLD was repressed at the transcriptional level by the activation of Snail [XREF_BIBR, XREF_BIBR]."

reach
"Adding to this, it has been shown that CYLD is downregulated by Snail in malignant melanomas [XREF_BIBR]."
SNAI1 activates CYLD.
| 2
SNAI1 activates CYLD. 2 / 2
| 2

reach
"Now, Massoumi et al. show that Snail also promotes tumor cell division by shutting off the tumor suppressor CYLD."
| PMC

reach
"By curbing CYLD, Snail thus promotes both tumor growth and spread."
| PMC
SMAD7 affects CYLD
| 7 9
| 7 9

sparser
"Their data showed that expression of spliceosome of CYLD (sCYLD) and Smad7 in the colonic mucosa lamina propria T cells of CD patients was increased and correlated with disease severity."

reach
"These results establish a physiological interaction between Smad7 and CYLD."

sparser
"CYLD binds to Smad7."

reach
"We next examined whether CYLD and Smad7 can form a complex under endogenous conditions."

sparser
"We next examined whether CYLD and Smad7 can form a complex under endogenous conditions."

sparser
"These results establish a physiological interaction between Smad7 and CYLD."

reach
"Following TGF-beta stimulation in WT primary CD4 + cells, interaction between Smad7 and CYLD was readily detected by co-immunoprecipitation using anti-Smad7 antibody and immunoblotting with anti-CYLD antibody."

reach
"To further investigate the interaction between CYLD and Smad7, we analyzed the ubiquitination of endogenous Smad7 in TGF-beta-stimulated T cells."

reach
"Finally, we found that Smad7 is Lys-63-polyubiquitinated in both T cells and HeLa cells following TGF-beta stimulation and that CYLD binds to Smad7 in T cells under endogenous conditions to modulate the polyubiquitination of Smad7."

reach
"CYLD binds to Smad7."
SDC4 affects CYLD
1 | 9 3
SDC4 binds CYLD.
1 | 7 3
1 | 7 3

sparser
"As shown in the co-IP assays ( xref ), CYLD, but not TRIM25, was present in the SDC4 immunoprecipitate, suggesting a strong association of SDC4 with the deubiquitinating enzyme CYLD, rather than the ubiquitin E3 ligase TRIM25."

reach
"Interestingly, the association between CYLD and SDC4 was significantly enhanced after the cells were infected with Sendai virus (XREF_SUPPLEMENTARY)."

reach
"Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region."

sparser
"Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region."

No evidence text available

reach
"We provide extensive biochemical evidence to demonstrate that SDC4, via its carboxyl-terminal intracellular domain, interacts with RIG-I and CYLD, thereby facilitating the interaction between RIG-I and CYLD."

reach
"Of note, our finding that SDC4 strongly interacts with CYLD is very intriguing."

reach
"As shown in XREF_SUPPLEMENTARY, both the wild-type and catalytically inactive mutant proteins were present in the SDC4 immunoprecipitate, suggesting that the association between SDC4 and CYLD is independent of the enzymatic activity of CYLD."

reach
"SDC4 interacts with and recruits CYLD to the RIG-I complex."

sparser
"Of note, our finding that SDC4 strongly interacts with CYLD is very intriguing."
SDC4 activates CYLD.
| 2
SDC4 activates CYLD. 2 / 3
| 2

reach
"Third, knockdown of SDC4 apparently abolished the perinuclear localization of RIG-I and CYLD (XREF_SUPPLEMENTARY)."

reach
"First, our co-IP experiments showed that SDC4 overexpression indeed enhanced the interaction between CYLD and RIG-I, whereas SDC4 knockdown reduced the association of CYLD with RIG-I (XREF_FIG)."
RNF31 affects OTULIN
| 17
| 15

sparser
"Concomitant Loss of OTULIN and CYLD Interaction with HOIP Increases M1 Ubiquitination at the TNF-RSC and Enhances TNF-Induced Gene Activation."

sparser
"HOIP interacts with both CYLD and OTULIN even in unstimulated cells."

sparser
"Mutually Exclusive Binding of CYLD and OTULIN to HOIP Causes CYLD-Selective Recruitment to SCs."

sparser
"The HOIP missense mutation affects the conserved PUB domain of HOIP ( xref ), which has recently been shown to be important for the interaction of HOIP with OTULIN and CYLD, two deubiquitinases ( xref ; xref ; xref )."

sparser
"Additionally, we used a HOIP-PUB domain point mutant (N102A), which abolishes the interaction of both OTULIN and CYLD with HOIP ( xref , xref )."

sparser
"In line with recent reports ( xref , xref , xref , xref , xref ), our data showed that prior to stimulation, both CYLD and OTULIN interacted with HOIP ( xref B–S1D)."

sparser
"In contrast to these findings, Draber et al. demonstrated that, although both OTULIN and CYLD interact with HOIP under basal conditions, OTULIN is absent from RSCs [ xref ] (Fig.  xref ) and that knock-out of OTULIN resulted in an increase of Met1-linked poly-Ub chains in the cytosol but not at TNFR1 or NOD2 RSCs [ xref ]."

sparser
"The explanation was provided by our discovery that HOIP cannot simultaneously bind OTULIN and CYLD as both require HOIP-Asn102 for binding."

sparser
"An interaction between HOIP and OTULIN or CYLD at first inspection would seem contradictory, as a futile energy-consuming cycle would exist."

sparser
"This suggested that steric hindrance may prevent simultaneous interaction of HOIP with CYLD and OTULIN."
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 16

reach
"Overexpression of CYLD Enhances TNF-alpha-Induced Cell Necrosis of Lung Cancer Cells."

reach
"In addition, Patrick et al. found that CYLD’s deubiquitase catalytic activity was necessary for the necrosis of colonic epithelial cells and the occurrence of colitis in FADD mice (135)."

reach
"Inhibition of CYLD expression inhibits TNF-alpha-induced Jurkat cell program necrosis, indicating that CYLD is a critical regulator of procedural necrosis."

reach
"When Caspase 8 activity was inhibited, L929 cells died by necrosis, which was blocked by knockdown of either CYLD or RIPK3 (XREF_SUPPLEMENTARY)."

reach
"22 Therefore, we propose that CYLD protein levels decrease to evade the necrosis elicited by sustained high CYLD levels."

reach
"Overexpression of CYLD-Flag Induces Cell Necrosis of Lung Cancer Cells."

reach
"Interestingly, CYLD protein levels decreased in late-phase apoptosis, despite consistently upregulated mRNA levels (XREF_FIG), likely due to CYLD cleavage by caspase-8 to prevent necrosis."

reach
"These reports proved that CYLD induction of necrosis is not limited to a single cell type but that the CYLD-RIPK1 pathway is probably conserved throughout the body."

reach
"They inhibit programmed necrosis by cleavage and inactivation of essential necrosis mediators including RIP1, RIP3 and CYLD [XREF_BIBR - XREF_BIBR]."

reach
"In addition, knockdown of CYLD, a deubiquitinase of RIP1, blocked TNF-alpha-induced necrosis of HT-22 cells."
CYLD affects NLRP6
| 9 8
CYLD binds NLRP6.
| 3 8
| 3 8

reach
"These results suggested that Cyld associates with NLRP6 during an inflammatory response."

sparser
"These results suggested that Cyld associates with NLRP6 during an inflammatory response."

sparser
"GST—Cyld but not GST alone precipitated His—NLRP6, confirming a direct CyldNLRP6 interaction ( xref )."

sparser
"Cyld interaction with NLRP6 was specific, as Cyld did not associate with other members of the NLR family such as NLRP3 and NLRP12 ( xref , xref ), which are also expressed in the colon."

sparser
"Further, to investigate the role of NLRP6 and Cyld interaction in regulating IL-18, we induced colitis in Nlrp6 −/− , Cyld −/− and Cyld −/− Nlrp6 −/− mice using C. rodentium ."

sparser
"To determine whether this interaction occurs endogenously, we performed co-immunoprecipitation experiments with anti-Cyld and anti-NLRP6 using the colonic mucosal lysates of C. rodentium —infected mice, which showed an interaction between Cyld and NLRP6 ( xref )."

reach
"To determine whether this interaction occurs endogenously, we performed co-immunoprecipitation experiments with anti-Cyld and anti-NLRP6 using the colonic mucosal lysates of C. rodentium -- infected mice, which showed an interaction between Cyld and NLRP6 (XREF_FIG)."

sparser
"Cyld binds to NLRP6."

reach
"Cyld binds to NLRP6."

sparser
"Anti-Myc immunoprecipitated Flag—NLRP6 and anti-Flag immunoprecipitated Myc—Cyld, suggesting that Cyld and NLRP6 physically interact ( xref )."
CYLD deubiquitinates NLRP6.
| 6
CYLD deubiquitinates NLRP6. 6 / 6
| 6

reach
"For the regulation of the NLRP6 inflammasome, Mukherjee et al. [107] found that the assembly of this inflammasome was regulated by deubiquitinase Cyld, which mediates deubiquitination of NLRP6; as a consequence, Cyld inhibits NLRP6-ASC assembly and IL-18 production."

reach
"Cyld deubiquitinated NLRP6, suggesting that Cyld directly deubiquitinates NLRP6 (XREF_FIG)."

reach
"To confirm that Cyld directly deubiquitinates NLRP6, we coexpressed Flag -- NLRP6 with Ub."

reach
"Coexpression of Cyld with NLRP6 and UbK63 markedly inhibited ubiquitination of NLRP6 (XREF_FIG, lane 4), suggesting that Cyld cleaves K63 linked Ub chains."

reach
"NLRP6 ubiquitination was diminished in the presence of wild-type Cyld but not with the Cyld (C601A) deubiquitinase defective mutant, suggesting that Cyld deubiquitinates NLRP6 (XREF_FIG)."

reach
"Deubiquitination of NLRP6 inflammasome by Cyld critically regulates intestinal inflammation."
| 12 2
CYLD inhibits Cell Survival.
| 5 2
| 5 2

sparser
"Overexpressed CYLD also significantly inhibited cell viability."

reach
"In T cell acute lymphoblastic leukemia (T-ALL), CYLD expression is repressed by the Notch and Hes1 pathway to promote persistent IKK activation and cell survival [XREF_BIBR]."

reach
"Loss of CYLD in different types of tumors leads to either cell survival or proliferation."

reach
"Reduced expression of CYLD promotes cell survival and inflammation in gefitinib treated NSCLC PC-9 cells : targeting CYLD may be beneficial for acquired resistance to gefitinib therapy."

reach
"Furthermore, cell viability assessed by MTS assay was also suppressed by overexpressed CYLD (20% inhibition; P < 0.05, compared with control), but not by catalytically inactive CYLD."

sparser
"The results indicated that cell viability of Huh-7 and HepG2 cells was inhibited by EAC and EACG (Figures xref )."

reach
"In various tumor types, CYLD loss can lead to cell survival or cell proliferation."
CYLD activates Cell Survival.
| 7
| 7

reach
"CYLD is among the most frequently mutated genes in multiple myeloma and likely contributes to the persistent NF-kappaB activation and enhanced cell survival in these tumors."

reach
"Downregulation of CYLD promoted cell survival and migratory activities through NF-kappaB activation, whereas CYLD overexpression inhibited those activities in MDA-MB-231 cells."

reach
"miR-19a is a member of the miR-17-92 cluster and has been shown to be overexpressed in T-cell acute lymphoblastic leukemia and multiple myeloma where it was revealed that miR-19a negatively regulates the expression of CYLD and SOCS-1 respectively to promote cell survival and pathogenesis [XREF_BIBR, XREF_BIBR]."

reach
"CYLD deficiency promotes cancer cell proliferation, cell survival and tumorigenesis."

reach
"We focused on investigation of the mechanism by which CYLD promotes cell survival in Mel-CV and ME1007 cells."

reach
"The decrease in cell viability caused by CYLD knockdown was due to induction of apoptosis, as it was associated with activation of the caspase cascade and was abolished by treatment with a general caspase inhibitor."

reach
"Strikingly, while CYLD silencing decreased cell viability as measured using CellTiter-Glo assays in Mel-CV and ME1007 cells, it resulted in a moderate yet statistically significant increase in cell viability in ME4405 cells and had no effect on the viability of Mel-FH cells (XREF_FIG)."
CDKN2C affects CYLD
| 5 12
| 5 12

sparser
"To investigate the effect of the CYLD-p18 axis in EBV lytic replication, CYLD was transfected into HK1-EBV and HONE1-EBV cells."

sparser
"We also found that EBV deregulates the CYLD-p18 axis, which contributes to viral DNA replication and tumor growth."

sparser
"In this paper, we identified CYLD as a deubiquitinase of CKI p18, offering mechanistic insights into the contribution of CYLD-p18 axis to the cell cycle progression."

reach
"Positive fluorescent signals were observed, which indicates CYLD interacts directly with p18."

sparser
"CYLD interacts with p18."

reach
"CYLD interacts with p18."

sparser
"Here we found that EBV drives a replication passive environment by deregulating the CYLD-p18 axis."

reach
"To better understand how CYLD regulates p18, we examined whether CYLD interacts with p18."

sparser
"Therefore, we concluded that EBV deregulates the host CYLD-p18 axis to push host cells to provide suitable replication-passive cellular environments for EBV DNA replication."

reach
"The co-IP analysis revealed that the N-terminal region, especially amino acids 1-304 of CYLD, was critical for the interaction between CYLD and p18."
USP affects CYLD
| 16
CYLD binds USP. 9 / 9
| 9

sparser
"Strikingly, the SPATA2 PUB domain (aa 1–241, 27.6 kDa), a monomer on its own (26.6 kDa), formed a 2:2 complex with dimeric CYLD USP domain of 136 kDa (calculated 140 kDa) in SEC-MALS ( xref A)."

sparser
"Although the conserved CAP-GLY domains provide structural basis for the interactions of CYLD with microtubules and many other proteins, an interesting finding is that EB1 containing a known CAP-GLY domain-interacting motif interacts with the C-terminal USP domain of CYLD other than the CAP-GLY domains, implicating a previously unknown role for the USP domain in mediating protein-protein interactions."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesisassociated 2 (SPATA2) [31, [33] [34] [35] , which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [31] (Fig. 1 )."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesis-associated 2 (SPATA2) [31, 33–35], which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [31] (Fig. 1)."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesis-associated 2 (SPATA2) [ xref , xref – xref ], which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [ xref ] (Fig.  xref )."

sparser
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis-associated protein 2 (Spata2) ( xref ), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

sparser
"SPATA2 contains both a PIM sequence, which is tightly bound by HOIP-PUB, and also a PUB domain on its own, which cannot bind a canonical PIM sequence but was found to interact with the ubiquitin-specific protease (USP) domain of CYLD [ xref , xref ]."

sparser
"TNF-α stimulation also induces rapid ubiquitylation of components of the TNF-RSC Temporal analysis of the TNF-RSC composition identified SPATA2 as a novel component of the TNF-RSC The predicted PUB domain in the N-terminus of SPATA2 interacts with the USP domain of CYLD, whereas the C-terminus of SPATA2 interacts with HOIP SPATA2 is required for recruitment of CYLD to the TNF-RSC Downregulation of SPATA2 augments transcriptional activation of NF-κB and inhibits TNF-α-induced necroptosis, pointing to an important function of SPATA2 in modulating the outcomes of TNF-α signaling."

sparser
"Moreover, Nox4 was deubiquitinated via a direct interaction with the ubiquitin-specific protease domain of CYLD."
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
Tax affects CYLD
| 8 8
| 8 8

reach
"Interestingly, the Tax and CYLD interaction appeared to be enhanced by the IKK regulatory subunit, IKKgamma, which is known to interact with both Tax [XREF_BIBR - XREF_BIBR] and CYLD [XREF_BIBR, XREF_BIBR]."

reach
"We first examined the potential physical interaction between Tax and CYLD."

sparser
"Acting in opposition to Tax ubiquitination, the deubiquitinase CYLD interacts with Tax and removes ubiquitin moieties thereby reducing the association of Tax with IKK."

reach
"We show here that the deubiquitinase CYLD physically interacts with Tax and negatively regulates the ubiquitination of this viral protein."

sparser
"We show here that the deubiquitinase CYLD physically interacts with Tax and negatively regulates the ubiquitination of this viral protein."

sparser
"In the present study, we have shown that Tax forms a complex with CYLD, in which CYLD strongly inhibits the ubiquitination and signaling function of Tax."

reach
"A recent study showed that CYLD, a DUB and tumor suppressor involved in NF-kappaB signaling pathways, interacts with Tax and removes ubiquitin chains that results in impaired Tax interaction with NEMO [XREF_BIBR]."

sparser
"Interestingly, the Tax/CYLD interaction appeared to be enhanced by the IKK regulatory subunit, IKKγ, which is known to interact with both Tax [ xref - xref ] and CYLD [ xref , xref ]."

sparser
"We found that Tax interacts with CYLD, a deubiquitinase that negatively regulates NF-κB activity, by inactivating it ( xref )."

reach
"Furthermore, Tax also interacted with CYLD in transiently transfected cells."
STING1 affects CYLD
| 4 12
| 4 12

sparser
"CYLD associates with STING in a ubiquitination-dependent manner."

reach
"In contrast, the E3 ligase Trim32 or Trim 56 failed to promote the association between STING and CYLD (Fig 4A and 4B)."

sparser
"We found that ubiquitinated STING, but not unmodified STING, interacted with CYLD in vitro , suggesting that CYLD associates with STING in a ubiquitination-dependent manner."

reach
"Then, the endogenous association between STING and CYLD was further investigated."

sparser
"As shown in xref , unlike RNF5, TRIM29 could not promote CYLD-STING association."

sparser
"Fifth, CYLD associated with STING via the K48-linked polyubiquitin chains on STING, and this association appeared to be enhanced upon HSV-1 infection."

sparser
"HA-tagged STING did not interact with Myc-tagged CYLD."

sparser
"Furthermore, as it was reported that RNF5 ubiquitinated STING at K150 [ xref ], we examined whether lysine 150 of STING could influence the association of STING with CYLD."

reach
"Interestingly, the association between CYLD and STING was detected only when the E3 ligase RNF5 was coexpressed."

sparser
"Notably, the endogenous interaction between STING and CYLD was substantially enhanced upon HSV-1 infection ( xref )."
CYLD affects USP
| 16
CYLD binds USP. 9 / 9
| 9

sparser
"Strikingly, the SPATA2 PUB domain (aa 1–241, 27.6 kDa), a monomer on its own (26.6 kDa), formed a 2:2 complex with dimeric CYLD USP domain of 136 kDa (calculated 140 kDa) in SEC-MALS ( xref A)."

sparser
"Although the conserved CAP-GLY domains provide structural basis for the interactions of CYLD with microtubules and many other proteins, an interesting finding is that EB1 containing a known CAP-GLY domain-interacting motif interacts with the C-terminal USP domain of CYLD other than the CAP-GLY domains, implicating a previously unknown role for the USP domain in mediating protein-protein interactions."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesisassociated 2 (SPATA2) [31, [33] [34] [35] , which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [31] (Fig. 1 )."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesis-associated 2 (SPATA2) [31, 33–35], which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [31] (Fig. 1)."

sparser
"The interaction with CYLD is mediated by the adaptor protein Spermatogenesis-associated 2 (SPATA2) [ xref , xref – xref ], which interacts with the CYLD USP domain and contains a PIM that facilitates binding to the HOIP PUB domain [ xref ] (Fig.  xref )."

sparser
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis-associated protein 2 (Spata2) ( xref ), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

sparser
"SPATA2 contains both a PIM sequence, which is tightly bound by HOIP-PUB, and also a PUB domain on its own, which cannot bind a canonical PIM sequence but was found to interact with the ubiquitin-specific protease (USP) domain of CYLD [ xref , xref ]."

sparser
"TNF-α stimulation also induces rapid ubiquitylation of components of the TNF-RSC Temporal analysis of the TNF-RSC composition identified SPATA2 as a novel component of the TNF-RSC The predicted PUB domain in the N-terminus of SPATA2 interacts with the USP domain of CYLD, whereas the C-terminus of SPATA2 interacts with HOIP SPATA2 is required for recruitment of CYLD to the TNF-RSC Downregulation of SPATA2 augments transcriptional activation of NF-κB and inhibits TNF-α-induced necroptosis, pointing to an important function of SPATA2 in modulating the outcomes of TNF-α signaling."

sparser
"Moreover, Nox4 was deubiquitinated via a direct interaction with the ubiquitin-specific protease domain of CYLD."
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
TP53 affects CYLD
4 | 6 3
4 | 6 3

reach
"Mechanistically, we show that CYLD interacts with and deubiquitinates p53 in response to DNA damage."

No evidence text available

sparser
"Furthermore, GST pull-down assays showed that recombinant His-CYLD bound recombinant GST-p53 but not GST, suggesting that CYLD directly interacts with p53 ( xref )."

No evidence text available

No evidence text available

reach
"Together, these results showed that CYLD interacts with p53 and this interaction is enhanced by genotoxic stress."

sparser
"Together, these results showed that CYLD interacts with p53 and this interaction is enhanced by genotoxic stress."

reach
"Together, these results suggested that CYLD directly interacts with and deubiquitinates p53 facilitating its optimal stabilization in response to DNA damage."

No evidence text available

reach
"CYLD interacts with p53 in response to DNA damage."
| 11
| 10

reach
"In addition, CYLD modulates dendritic growth and postsynaptic differentiation in mouse hippocampal neurons [XREF_BIBR]."

reach
"The decreased JNK pathway activation in the H-CYLD WT cells appears as a plausible mechanism for CYLD induction of keratinocytes differentiation."

reach
"Furthermore, depletion of beta-TRCP induced CYLD accumulation and TRAF6 deubiquitination in osteoclast precursor cells, leading to suppression of RANKL induced osteoclast differentiation."

reach
"As a result, we have found that forced expression of wild-type CYLD (CYLD WT) both in HaCaT keratinocytes and in the skin equivalents enhances keratinocyte differentiation, while the inhibition of CYLD function by expression of a catalytically inactive form of CYLD impairs epidermal differentiation."

reach
"The diminished function of CYLD impairs the differentiation of keratinocytes in human HaCaT skin equivalents."

reach
"Our data demonstrate that alterations in CYLD expression in keratinocytes disrupt normal epidermal homeostasis : the forced expression of CYLD WT in human HaCaT keratinocytes and the skin equivalents enhance keratinocyte differentiation."

reach
"Increased CYLD expression enhances the differentiation of keratinocytes in human skin equivalents."

reach
"Importantly, we have discovered that CYLD WT also promotes the differentiation of A431 tumoral keratinocytes through inhibition of JNK activation."

reach
"We show that CYLD overexpression increases keratinocyte differentiation while CYLD loss of function impairs epidermal differentiation."

reach
"In addition to the skin appendages changes, the K5-CYLD C/S mice show epidermal alterations, mainly impaired keratinocyte differentiation, thus confirming in vivo the results that our group have previously described using a model of skin equivalents of human HaCaT keratinocytes [XREF_BIBR], in which we demonstrated that the overexpression of the wild-type CYLD (CYLD wt) promoted keratinocyte differentiation, whereas the expression of the mutant CYLD C/S prevented, through the activation of the JNK pathway, the epidermal differentiation [XREF_BIBR]."
| 1

reach
"Late mTEC differentiation is also disrupted by altered CYLD function, suggesting that regulation of RANK signaling via TRAF6 deubiqutination might be important during late mTEC development, possibly by regulating RelB induction by the canonical NF-kappaB pathway."
CYLD affects STAT3
| 9 6
CYLD binds STAT3.
| 2 6
| 2 6

sparser
"Hepatocytes are the most important cellular source of fibrinogen xref and, herein, we show that the increased STAT3 activity in the liver of Lm-infected Cyld −/− mice associated with an increased fibrin production ( xref )."

sparser
"Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63-ubiquitination of STAT3 in IL-6 stimulated hepatocytes."

reach
"In immunoprecipitates of nuclear STAT3, CYLD was undetectable further indicating that CYLD interacted with STAT3 in the cytosol (XREF_FIG)."

reach
"Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63 ubiquitination of STAT3 in IL-6 stimulated hepatocytes."

sparser
"STAT3 and CYLD interacted in the cytoplasm but not in the nucleus of IL-6-stimulated hepatocytes ( xref )."

sparser
"Of note, the amount of CYLD associated with STAT3 increased upon IL-6 stimulation ( xref )."

sparser
"Catalytically inactive CYLD still interacted with STAT3 but failed to reduce K63-ubiquitination of STAT3 ( xref )."

sparser
"In immunoprecipitates of nuclear STAT3, CYLD was undetectable further indicating that CYLD interacted with STAT3 in the cytosol ( xref )."
CYLD inhibits STAT3.
| 7
CYLD inhibits STAT3. 7 / 7
| 7

reach
"CYLD reduced activation of p65, JAK2, STAT3, and p38 MAPK as well as fibrin production in livers of Listeria infected WT mice."

reach
"In WT mice, IL-6 neutralization only slightly reduced pSTAT3 without affecting fibrin (XREF_FIG) indicating that IL-6 induced pSTAT3 is strongly regulated by CYLD, which limits STAT3 activity and STAT3 dependent fibrin production."

reach
"CYLD knockdown resulted in an increase of pSTAT3 (XREF_FIG) as well as fibrin (XREF_FIG) in Lm infected WT mice."

reach
"In extension, we newly identified that IL-6 does not only induce STAT3 phosphorylation in hepatocytes XREF_BIBR, but that CYLD strongly reduced IL-6-dependent accumulation of activated STAT3 in hepatic nuclei."

reach
"In addition, CYLD diminished IL-6-induced STAT3 activity by reducing nuclear accumulation of phosphorylated STAT3."

reach
"The observation that siRNA mediated inhibition of CYLD in WT mice increased hepatic p-STAT3 and fibrin levels, diminished hemorrhage and significantly increased survival indicates that inhibition of CYLD might be a therapeutic option in severe listeriosis and potentially other infectious diseases including acute lung injury induced by S. pneumoniae XREF_BIBR."

reach
"In extension to current knowledge, we uncover that the CYLD dependent suppression of STAT3 activity in hepatocytes resulted in a decreased fibrin production, which identifies CYLD as an important regulator of IL-6-induced STAT3 dependent fibrin production."
CYLD affects OTULIN, and RNF31
| 15
| 15

sparser
"Concomitant Loss of OTULIN and CYLD Interaction with HOIP Increases M1 Ubiquitination at the TNF-RSC and Enhances TNF-Induced Gene Activation."

sparser
"HOIP interacts with both CYLD and OTULIN even in unstimulated cells."

sparser
"Mutually Exclusive Binding of CYLD and OTULIN to HOIP Causes CYLD-Selective Recruitment to SCs."

sparser
"The HOIP missense mutation affects the conserved PUB domain of HOIP ( xref ), which has recently been shown to be important for the interaction of HOIP with OTULIN and CYLD, two deubiquitinases ( xref ; xref ; xref )."

sparser
"Additionally, we used a HOIP-PUB domain point mutant (N102A), which abolishes the interaction of both OTULIN and CYLD with HOIP ( xref , xref )."

sparser
"In line with recent reports ( xref , xref , xref , xref , xref ), our data showed that prior to stimulation, both CYLD and OTULIN interacted with HOIP ( xref B–S1D)."

sparser
"In contrast to these findings, Draber et al. demonstrated that, although both OTULIN and CYLD interact with HOIP under basal conditions, OTULIN is absent from RSCs [ xref ] (Fig.  xref ) and that knock-out of OTULIN resulted in an increase of Met1-linked poly-Ub chains in the cytosol but not at TNFR1 or NOD2 RSCs [ xref ]."

sparser
"The explanation was provided by our discovery that HOIP cannot simultaneously bind OTULIN and CYLD as both require HOIP-Asn102 for binding."

sparser
"An interaction between HOIP and OTULIN or CYLD at first inspection would seem contradictory, as a futile energy-consuming cycle would exist."

sparser
"This suggested that steric hindrance may prevent simultaneous interaction of HOIP with CYLD and OTULIN."
| 1 13
| 1 8

reach
"CYLD inhibits proliferation and metastasis of melanoma cells in vivo."

reach
"Functional assays revealed CYLD inhibits NPC cell proliferation and migration in vitro and suppresses NPC tumorigenicity and metastasis in vivo by negatively regulating the NF-kB signaling pathway."

reach
"In summary, these data show that reduced CYLD expression induces tumorigenicity of melanoma, and that reexpression of CYLD reduces their tumor growth and metastasis in vivo."

reach
"CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK and AP1 Signaling at Multiple Levels."

reach
"CYLD overexpression strongly suppressed the growth, proliferation, metastasis, and migration of NPC cells [135]."

reach
"This mechanism plays an important role for the growth of melanoma cells because stable expression of CYLD in melanoma cells reduced tumor growth and metastasis in vivo in a xenograft model."

eidos
"Functional assays revealed CYLD inhibits NPC cell proliferation and migration in vitro and suppresses NPC tumorigenicity and metastasis in vivo by negatively regulating the NF-kB signaling pathway ."

reach
"Loss of CYLD up-regulates NFKB signaling and enhance metastasis in breast cancer [37]."

reach
"Based on our results, loss of CYLD positively affects the formation of lymph vessels in melanoma and enhances metastasis, supporting the important role of CYLD especially in the early process of melanoma progression."
| 5

reach
"Hayashi et al. have found that CYLD downregulation promoted breast cancer metastasis via NF-kappaB activation, including RANKL signaling [XREF_BIBR]."

reach
"Moreover, CYLD has also been reported to promote melanoma tumorigenesis and metastasis through suppression of JNK and activating protein 1 (AP-1), leading to decreased expression of cyclin D1 and N-cadherin XREF_BIBR."

reach
"CYLD downregulation may promote breast cancer metastasis via NF-kappaB activation, including RANKL signaling."

reach
"It has been recently suggested that CYLD down-regulation could increase breast cancer metastasis through NFkappaB activation."

reach
"In conclusion, PCDH-gamma-A12 and SLC19A1 promoters, but not CREB and CYLD promoters, are hypermethylated and contribute to the occurrence and metastasis of colorectal cancer."
CYLD affects E6
| 3 12
| 3 12

reach
"Thus, we postulated that hypoxia would lead to an enhanced protein protein interaction between E6 and CYLD, thereby allowing for more efficient E6 mediated ubiquitination."

sparser
"Hypoxia-induced degradation of CYLD is associated with E6-mediated CYLD ubiquitination."

sparser
"Thus, we postulated that hypoxia would lead to an enhanced protein-protein interaction between E6 and CYLD, thereby allowing for more efficient E6-mediated ubiquitination."

sparser
"To further define the relationship between E6 and CYLD, we tested whether E6 expression is associated with CYLD polyubiquitination."

sparser
"We performed co-immunoprecipitation studies in HeLa and SiHa cells to compare the intensity of the putative E6-CYLD protein-protein interaction in normoxia versus hypoxia."

sparser
"It is also plausible that post-translational hydroxylation may take place on a protein involved in formation of a protein complex that includes E6 and CYLD, whereby hydroxylation impairs complex formation and, by extension, the ability of E6 to target CYLD for ubiquitination."

sparser
"Indeed, these immunoprecipitation studies demonstrated that E6 and CYLD weakly interact in SiHa and HeLa cells under normoxia ( xref , lanes 2 and 6)."

sparser
"It should be noted that E6-mediated degradation of CYLD was specific to cells exposed to prolonged hypoxia, where the physical interaction of E6 and CYLD might be stabilized through posttranslational modifications ( xref )."

reach
"Whether E6 's from low-risk HPV types interact with either CYLD or NFX1-91 is currently unknown."

sparser
"E6 interacts with Cylindromatosis (CYLD) deubiquitinase to inactivate the tumor suppressor CYLD and to activate the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathway in hypoxic conditions. xref E6 interacts with p300/cAMP response element binding protein (CREB) xref , xref and interferon regulatory factor 3 (IRF-3) xref to regulate gene expression and with c-Myc to induce upregulation of human telomerase reverse transcriptase to promote cell immortalization. xref , xref , xref HPV16 E6 in the cytoplasm is also important for the oncogenic activity through its regulation of signal transduction by interactions with cytoplasmic E6BP (Erc55), xref E6TP1, xref , xref tumor-necrosis factor (TNF) receptor 1 xref and protein tyrosine phosphatase H1. xref In addition to its oncogenic activities, HPV16 E6 also protects HPV16-infected keratinocytes from the innate immune system by suppressing pro-IL-1β expression. xref "
| 15
| 15

reach
"Flow cytometry and immunofluorescence microscopy reveal that CYLD increases the ability of noscapine to induce mitotic arrest and apoptosis."

reach
"Based on the data presented in this work, we propose the following model for how CYLD promotes noscapine activity in leukemia cells."

reach
"We found that CYLD, but not its DeltaCG1 mutant, significantly promoted the effect of noscapine on microtubule assembly in vitro."

reach
"CYLD enhances noscapine activity to induce mitotic arrest and apoptosis in a microtubule dependent manner."

reach
"Examination of cellular microtubules as well as in vitro assembled microtubules shows that CYLD enhances the effect of noscapine on microtubule polymerization."

reach
"Immunofluorescence microscopy also showed that CYLD and its C/S mutant, but not its DeltaCG1 mutant, increased noscapine activity to cause mitotic arrest."

reach
"XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR, XREF_BIBR CYLD has also been shown to stimulate noscapine activity in acute lymphoblastic leukemia via a microtubule dependent mechanism."

reach
"CYLD enhances the effect of noscapine on microtubule polymerization."

reach
"Thus, we examined whether CYLD modulates the ability of noscapine to cause mitotic arrest."

reach
"In addition, flow cytometric analysis of DNA content showed that CYLD and its C/S mutant, but not its DeltaCG1 mutant, promoted the ability of noscapine to induce the accumulation of G2/M cells."
MiR-181b affects CYLD
| 2 12
MiR-181b activates CYLD.
| 6
MiR-181b activates CYLD. 6 / 6
| 6

reach
"miR-21 and miR-181b act as an epigenetic switch to inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain the transformed state XREF_BIBR."

reach
"Xu et al demonstrated that miR-181b regulated the proliferation of esophageal cancer stem like cells via the CYLD pathway and that CYLD was directly targeted by miR-181b."

reach
"Effects of miR-181b targeting CYLD on human colon cancer cell apoptosis and the NF-kappaB signaling pathway."

reach
"For example, PDCD4 is regulated by miR-21 and miR-183, and miR-181b can simultaneously target WIF-1 and CYLD."

reach
"Furthermore, the present study also demonstrated that miR-181b downregulation promoted CYLD upregulation and attenuated the activity of the NF-kappaB signaling pathway, thereby inhibiting cell growth and promoting cell apoptosis both in vitro and in vivo."

reach
"Downregulation of miR-181b inhibits human coloncancer cell proliferation by targeting CYLD and inhibiting the NF-kappaB signaling pathway."
MiR-181b inhibits CYLD.
| 2 2
MiR-181b inhibits CYLD. 4 / 4
| 2 2

reach
"The present study demonstrated that miR-181b was associated with the resistance of pancreatic cancer cells to gemcitabine, and verified that miR-181b enhances the activity of NF-kappaB by inhibiting CYLD, leading to the resistance to gemcitabine."

reach
"Down-regulation of miR-181b promotes apoptosis by targeting CYLD in thyroid papillary cancer."

eidos
"As was expected , miR-181b repressed CYLD expression by directly targeting its 3'UTR ."

eidos
"Furthermore , the present study also demonstrated that miR-181b downregulation promoted CYLD upregulation and attenuated the activity of the NF-kappaB signaling pathway , thereby inhibiting cell growth and promoting cell apoptosis both in vitro and in vivo ."
MiR-181b decreases the amount of CYLD.
| 4
MiR-181b decreases the amount of CYLD. 4 / 4
| 4

reach
"Specifically, upregulation and downregulation of miR-181b (through transfection of either pre- or small interfering miR-181b, respectively) could negatively regulate CYLD protein levels as well as N2A cell survival rate and apoptosis following CoCl 2 -induced injury."

reach
"However, western blot analysis showed that overexpression of miR-181b remarkably suppressed CYLD expression in SFCs and that inhibition of miR-181b increased CYLD expression in SFCs, indicating that miR-181b regulates CYLD in SFCs at the post-transcriptional level."

reach
"As was expected, miR-181b repressed CYLD expression by directly targeting its 3 ' UTR."

reach
"MiR-181b is directly regulated by NF-kappaB and inhibits CYLD expression, which in turn positively regulates NF-kappaB activity [14,26]."
PRNP affects CYLD
3 | 7 4
3 | 7 4

reach
"Experiments are also in progress to determine whether the binding between PrP and CYLD is direct."

sparser
"We posit that when PrP binds CYLD, it sequesters CYLD, preventing it from binding RIP1 and TRAF2."

reach
"When PrP binds CYLD, it may sequester CYLD, consequentially reducing the levels of CYLD available to bind RIP1 or TRAF2."

reach
"Thus, in the presence of PrP, TNFalpha treatment increased the interaction between PrP and CYLD but alleviated binding between CYLD and RIP1 or TRAF2."

sparser
"Because CYLD is involved in NF-κB cascade and PrP expression is critical for activation of NF-κB pathway, we thus focused on studying the interaction between PrP and CYLD."

No evidence text available

reach
"PrP interacts with CYLD to regulate NF-kappaB signaling."

No evidence text available

reach
"Binding between PrP and CYLD reduces RIP1 and TRAF2 ubiquitination."

reach
"Because CYLD is involved in NF-kappaB cascade and PrP expression is critical for activation of NF-kappaB pathway, we thus focused on studying the interaction between PrP and CYLD."
CYLD affects signaling
| 14
CYLD inhibits signaling. 10 / 14
| 14

sparser
"First, CYLD inhibits NF- κ B signaling by deubiquitinating NF- κ B-positive regulators, such as TAK1 (TGF- β -activated Kinase 1), TRAF2 and NEMO/IKK γ . xref , xref Second, caspase 8-mediated cleavage of CYLD generates a survival signal, whereas the mutation of caspase 8-mediated cleavage site on CYLD switches cell survival to necrotic cell death in response to TNF α . xref Last but not least, CYLD interacts with and deubiquitinates RIP1. xref However, it is still controversial whether CYLD affects the ubiquitination of RIP1 in complex I or in the necrosome. xref , xref Given that the above DUBs can remove ubiquitin chains from RIP1, how is RIP1 ubiquitinated?"

sparser
"It was demonstrated by a biochemical study that CYLD has an ability to cleave not only Lys 63-linked ubiquitin chains, but also linear ubiquitin chains ( xref ), which discovery was followed up by a cellular signaling study showing that CYLD inhibits the NF-κB signaling by forming a complex with LUBAC ( xref )."

sparser
"Using an shRNA approach, Brummelkamp et al. showed that CYLD inhibits NF-κB signaling by counteracting TRAF2 ubiquitination [ xref ]."

sparser
"It is possible that fibulin-3 downregulation increases CYLD that in turn inhibits NF-κB signaling, but the mechanisms by which fibulin-3 regulates CYLD at the transcriptional level is yet unknown."

sparser
"Furthermore, EAC also inhibited the cell survival signaling by enhancing the amount of IkappaBalpha in cytoplasm and reducing the level and activity of NF-kappaB in the nucleus, and subsequently attenuated the expression of Bcl-X(L) in Hep G2 and PLC/PRF/5 cells."

sparser
"The deubiquitylating enzyme CYLD additionally inhibits TGF-β signaling by forming a complex with Smad7 and facilitates its deubiquitylation at two sites in its MH2 domain ( xref )."

sparser
"CYLD inhibits RANK-mediated signaling in osteoclasts in a negative feedback loop by deubiquitinating TRAF6 ( xref ) ( xref )."

sparser
"It was initially believed that CYLD inhibited IFN signaling by deubiquitinating the PRR, RIG‐1, and downstream kinases TANK‐binding kinase 1 (TBK‐1) and inhibitor of NF‐κB kinase Ε (IKKΕ) xref ; but, surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated. xref On the basis of these reports, TRAF3 and CYLD may serve similar functions after viral infection, namely, to inhibit NF‐κB and activate IFN."

sparser
"In the Wnt signal transduction pathway, CYLD inhibits β-catenin signaling by removing Lysine-63 linked ubiquitination from Dishevelled (Tauriello et al., xref )."

sparser
"Finally, the deubiquitylase CYLD inhibits TGF-β signaling by decreasing the stability of Smad3."
CYLD affects SDC4
1 | 7 3
1 | 7 3

sparser
"As shown in the co-IP assays ( xref ), CYLD, but not TRIM25, was present in the SDC4 immunoprecipitate, suggesting a strong association of SDC4 with the deubiquitinating enzyme CYLD, rather than the ubiquitin E3 ligase TRIM25."

reach
"Interestingly, the association between CYLD and SDC4 was significantly enhanced after the cells were infected with Sendai virus (XREF_SUPPLEMENTARY)."

reach
"Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region."

sparser
"Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region."

No evidence text available

reach
"We provide extensive biochemical evidence to demonstrate that SDC4, via its carboxyl-terminal intracellular domain, interacts with RIG-I and CYLD, thereby facilitating the interaction between RIG-I and CYLD."

reach
"Of note, our finding that SDC4 strongly interacts with CYLD is very intriguing."

reach
"As shown in XREF_SUPPLEMENTARY, both the wild-type and catalytically inactive mutant proteins were present in the SDC4 immunoprecipitate, suggesting that the association between SDC4 and CYLD is independent of the enzymatic activity of CYLD."

reach
"SDC4 interacts with and recruits CYLD to the RIG-I complex."

sparser
"Of note, our finding that SDC4 strongly interacts with CYLD is very intriguing."
CYLD affects PRNP
3 | 7 4
3 | 7 4

reach
"Experiments are also in progress to determine whether the binding between PrP and CYLD is direct."

sparser
"We posit that when PrP binds CYLD, it sequesters CYLD, preventing it from binding RIP1 and TRAF2."

reach
"When PrP binds CYLD, it may sequester CYLD, consequentially reducing the levels of CYLD available to bind RIP1 or TRAF2."

reach
"Thus, in the presence of PrP, TNFalpha treatment increased the interaction between PrP and CYLD but alleviated binding between CYLD and RIP1 or TRAF2."

sparser
"Because CYLD is involved in NF-κB cascade and PrP expression is critical for activation of NF-κB pathway, we thus focused on studying the interaction between PrP and CYLD."

No evidence text available

reach
"PrP interacts with CYLD to regulate NF-kappaB signaling."

No evidence text available

reach
"Binding between PrP and CYLD reduces RIP1 and TRAF2 ubiquitination."

reach
"Because CYLD is involved in NF-kappaB cascade and PrP expression is critical for activation of NF-kappaB pathway, we thus focused on studying the interaction between PrP and CYLD."
CYLD affects Interferon
| 1 12
CYLD inhibits Interferon.
| 1 7
| 1 7

eidos
"However , as viral infection goes on , CYLD accumulates and cleaves the K63-linked ubiquitin chains of RIG-I , inhibiting virus-triggered type I IFN signaling ."

reach
"Ectopic expression of CYLD antagonizes the IFN response whereas siRNA-mediated knockdown of CYLD expression allows for a more robust IFN response."

reach
"For example, CYLD removes polyubiquitin chains from TBK1 and RIG-I and thus inhibits the IRF3 signaling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances this response (58)."

reach
"Several DUBs were shown to have an inhibitory effect on the RIG-I signalling pathway (Fig XREF_FIG), as for example knockdown of CYLD enhanced type-I IFN production in response to SeV infection whereas ectopic CYLD expression inhibited it XREF_BIBR."

reach
"Since CYLD negatively regulates IFN induction, XREF_BIBR, XREF_BIBR we examined whether the loss of CYLD renders mice more resistant to viral infection."

reach
"Ectopic expression of CYLD inhibits the IRF3 signalling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances the response."

reach
"The deubiquitinating enzyme CYLD cleaves K63 linked polyubiquitin chains from specific substrates, including tumor necrosis factor receptor associated factors (TRAF)-2, TRAF6, transforming growth factor beta activated kinase 1 (TAK1), B cell lymphoma 3 (BCL3), STAT3, nuclear factor kappa B essential modulator (NEMO), and retinoic acid inducible gene 1 (RIG-1), and negatively regulates the activation of NF-kappaB, MAPKs, and type I IFN production."

reach
"Strikingly, the CYLD and TRAF3 genetic alterations affected mutually exclusive HPV+ HNSCC tumor groups, suggesting that alterations in either TRAF3 or CYLD may function independently and sufficiently to deregulate the downstream NF-kappaB and IFN responses."
CYLD activates Interferon.
| 5
| 5

reach
"Release of the CYLD mediated inhibition of TBK1 during this phase results in enhanced IFN and ISG signaling pathway, independently of viral infection."

reach
"For example, the DUB enzyme cylindromatosis (CYLD) was shown to directly bind RIG-I and mediate the removal of K63-ub and limit IFN induction [XREF_BIBR]."

reach
"It was initially believed that CYLD inhibited IFN signaling by deubiquitinating the PRR, RIG-1, and downstream kinases TANK binding kinase 1 (TBK-1) and inhibitor of NF-kappaB kinase Epsilon (IKKEpsilon) 44; but, surprisingly, IFN response to vesicular stomatitis virus in CYLD knockout mice or cells from these mice was abrogated.45 On the basis of these reports, TRAF3 and CYLD may serve similar functions after viral infection, namely, to inhibit NF-kappaB and activate IFN."

reach
"For example, the DUB enzyme cylindromatosis (CYLD) was shown to directly bind RIG-I and mediate the removal of K63-ub and limit IFN induction [45]."

reach
"Based on these reports, TRAF3 and CYLD may serve similar functions after viral infection, namely to inhibit NF-kappaB and activate IFN."
CYLD affects IKBKE
| 12 2
CYLD activates IKBKE.
| 5 2
CYLD activates IKBKE. 7 / 7
| 5 2

sparser
"CYLD deficiency causes constitutive activation of TBK1 and IKKε in DCs, and the CYLD-deficient DCs and MEFs are hyper-responsive to VSV in IFNβ induction xref ."

reach
"Although this phenotype may involve ubiquitin dependent activation of RIG-I, CYLD also directly targets TBK1 and IKKepsilon to inhibit their ubiquitination 79."

sparser
"Because CYLD deficiency causes constitutive activation of IKKε and TBK1, this DUB has been suggested to play an essential role in preventing the aberrant activation of these kinases during the induction of type1 interferon that occurs during viral infection ( xref )."

reach
"Genetic deficiency in the DUB CYLD causes constitutive activation of TBK1 and IKKepsilon in DCs, rendering the cells hyperresponsive to VSV induced type I IFN expression XREF_BIBR, XREF_BIBR."

reach
"CYLD deficiency causes constitutive activation of IKKepsilon and TBK1, which is associated with hyper-induction of IFNs in virus infected cells."

reach
"CYLD deficiency causes constitutive activation of TBK1 and IKKepsilon in DCs, and the CYLD deficient DCs and MEFs are hyper-responsive to VSV in IFNbeta induction 80."

reach
"Because CYLD deficiency causes constitutive activation of IKKepsilon and TBK1, this DUB has been suggested to play an essential role in preventing the aberrant activation of these kinases during the induction of type1 interferon that occurs during viral infection."
CYLD inhibits IKBKE.
| 4
CYLD inhibits IKBKE. 4 / 4
| 4

reach
"CYLD also negatively regulates the IKK related kinases, IKKepsilon and TBK1, by the same mechanisms."

reach
"The effect of CYLD was not specific to RIG-I, as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKe."

reach
"Our previous studies as well as others have demonstrated that A20, TAX1BP1, ABIN1 and CYLD inhibit TBK1 and IKKi by antagonizing their Lys63 linked polyubiquitation XREF_BIBR, XREF_BIBR, XREF_BIBR."

reach
"The effect of CYLD was not specific to RIG-I, as CYLD also deubiquitinated and inhibited the signaling activities of TBK1 and IKKepsilon."
CYLD deubiquitinates IKBKE.
| 3
CYLD leads to the deubiquitination of IKBKE. 3 / 3
| 3

reach
"In addition, CYLD also inhibits the ubiquitination of TBK1 and IKKepsilon, which also contributes to the negative regulation of IFN responses by CYLD 79."

reach
"We further show that CYLD targets a cytoplasmic RNA sensor, RIG-I, and inhibits the ubiquitination of this IKKepsilon and TBK1 stimulator."

reach
"XREF_BIBR, XREF_BIBR We and others have recently shown that RIG-I ubiquitination and TBK1 and IKKepsilon activation are negatively regulated by CYLD, XREF_BIBR, XREF_BIBR a deubiquitinase known to digest K63 linked ubiquitin chains."
TRPA1 affects CYLD
1 | 4 8
1 | 4 8

sparser
"Fig. 2 B shows that over-expressed CYLD interacts with endogenous TRPA1."

No evidence text available

reach
"3 F suggests that the interaction between TRPA1 and CYLD is dynamic, and depends upon the activation status of TRPA1."

sparser
"Taken together, these data suggest that TRPA1 and CYLD can interact in a physiological complex."

reach
"We sought to validate the potential interaction of TRPA1 and CYLD."

sparser
"The interaction between CYLD and TRPA1 suggests: (1) that CYLD may have substrates that lie outside the TNF/NFκB pathway, and (2) that TRPA1 expression levels may be controlled by a ubiquitination mec[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"We also explored the potential for TRPA1 to interact with CYLD in a native TRPA1 expression context."

sparser
"Fig. 3 F suggests that the interaction between TRPA1 and CYLD is dynamic, and depends upon the activation status of TRPA1."

reach
"Taken together, these data suggest that TRPA1 and CYLD can interact in a physiological complex.The interaction between CYLD and TRPA1 suggests : (1) that CYLD may have substrates that lie outside the [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"We performed co-immunoprecipitations to test whether CYLD and TRPA1 are associated in a physiological complex."
CYLD affects autophagy
| 1 11
CYLD inhibits autophagy.
| 1 7
| 1 7

reach
"Indeed, our results demonstrate that upregulation of CYLD in cardiomyocytes impairs autophagy at the stage of autolysosome efflux and enhances myocardial death in PO-hearts."

reach
"Yin et al. reported that CYLD could increase apoptosis and decrease autophagy to improve the chemosensitivity to gemcitabine in bladder cancer [XREF_BIBR]."

reach
"CYLD suppresses autophagy at a stage of autolysosome efflux in cardiomyocytes."

reach
"Mechanistically, CYLD suppresses autophagy by selectively interrupting autolysosome efflux in cardiomyocytes, thereby switching autophagic adaptation into autophagic damage in PO-hearts."

reach
"Noteworthy, CYLD also inhibited autophagy of Listeria in a RIPK2-ERK1/2-dependent manner."

reach
"In the present study, we demonstrated that CYLD suppresses autophagy at the stage of autolysosome efflux in cardiomyocytes, thereby exaggerating cardiac pathological remodeling and dysfunction in the setting of PO."

reach
"Our findings highlight a unique role of CYLD in suppressing autophagy at the step of autolysosome efflux in pressure overloaded hearts and suggest that targeting CYLD may be a novel therapeutic approach for the treatment of adverse cardiac remodeling and dysfunction associated with hypertensive heart disease."

eidos
"Yin et al. reported that CYLD could increase apoptosis and decrease autophagy to improve the chemosensitivity to gemcitabine in bladder cancer [ 26 ] ."
CYLD activates autophagy.
| 4
| 4

reach
"In search of underlying molecular mechanisms, we find that CYLD knockout mice display marked overactivation of Akt and mTOR and reduced autophagic flux, and conversely, CYLD overexpression potently suppresses Akt and mTOR activity and promotes autophagy."

reach
"As the aforementioned results suggested that NAC could inhibit the generation of ROS in HPCCs, it is possible that mTOR, ULK1, AKT, 4E-BP1 and CYLD participate in wogonin induced autophagy, acting as upstream signals of autophagy."

reach
"The K63 deubiquitinase CYLD modulates autism-like behaviors and hippocampal plasticity by regulating autophagy and mTOR signaling."

reach
"By providing evidence that CYLD can modulate mechanistic target of rapamycin (mTOR) signaling and autophagy at the synapse, we propose that synaptic K63-linked ubiquitination processes could be fundamental in understanding the pathomechanisms underlying autism spectrum disorder."
CYLD affects TRPA1
1 | 4 8
1 | 4 8

sparser
"Fig. 2 B shows that over-expressed CYLD interacts with endogenous TRPA1."

No evidence text available

reach
"3 F suggests that the interaction between TRPA1 and CYLD is dynamic, and depends upon the activation status of TRPA1."

sparser
"Taken together, these data suggest that TRPA1 and CYLD can interact in a physiological complex."

reach
"We sought to validate the potential interaction of TRPA1 and CYLD."

sparser
"The interaction between CYLD and TRPA1 suggests: (1) that CYLD may have substrates that lie outside the TNF/NFκB pathway, and (2) that TRPA1 expression levels may be controlled by a ubiquitination mec[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"We also explored the potential for TRPA1 to interact with CYLD in a native TRPA1 expression context."

sparser
"Fig. 3 F suggests that the interaction between TRPA1 and CYLD is dynamic, and depends upon the activation status of TRPA1."

reach
"Taken together, these data suggest that TRPA1 and CYLD can interact in a physiological complex.The interaction between CYLD and TRPA1 suggests : (1) that CYLD may have substrates that lie outside the [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"We performed co-immunoprecipitations to test whether CYLD and TRPA1 are associated in a physiological complex."
CYLD affects TGFB
| 1 9
CYLD inhibits TGFB. 10 / 13
| 1 9

reach
"CYLD negatively regulates TGFbeta responsiveness, adversely affecting extrathymic Treg induction and the pTreg pool."

eidos
"CYLD deubiquitinates Smad7 and inhibits TGF-beta signaling ( 58 ) ."

reach
"Lim and co-workers showed that CYLD suppresses TGF-beta signalling and prevents lung fibrosis by (indirectly) reducing the stability of Smad3, in an AKT, GSK3beta and E3 ligase carboxy terminus of Hsc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CYLD also can negatively regulate TGF-β signaling which is involved in the generation of pTreg cells."

reach
"Finally, the deubiquitylase CYLD inhibits TGF-beta signaling by decreasing the stability of Smad3."

reach
"CYLD also negatively regulates signaling and TGFbeta responsiveness, suppressing extrathymic Treg induction and the pTreg pool."

reach
"The deubiquitylating enzyme CYLD additionally inhibits TGF-beta signaling by forming a complex with Smad7 and facilitates its deubiquitylation at two sites in its MH2 domain."

reach
"It is interesting that CYLD knockdown promoted transforming growth factor-beta (TGF-beta) signalling by inducing stabilization of TGF-beta receptor I (ALK5) in a cell autonomous fashion."

reach
"This study proposes that CYLD inhibits TGFbeta signalling by decreasing the stability of SMAD3 via the AKT-GSK3-CHIP pathway."

reach
"A deficiency of CYLD causes constitutive NF-kB activation and enhanced TGF-b signaling, which increases the frequency of Treg cells in peripheral lymphoid organs and promotes Treg cell differentiation in vitro (149, 150)."
PDE4B affects CYLD
| 10
PDE4B inhibits CYLD.
| 4
PDE4B inhibits CYLD. 4 / 6
| 4

reach
"Moreover, PDE4B negatively regulates CYLD via selective activation of JNK2 but not JNK1."

reach
"PDE4B downregulates CYLD via activation of JNK2 pathway."

reach
"Moreover, PDE4B negatively regulates CYLD via specific activation of JNK2 but not JNK1."

reach
"For example, inhibiting PDE4B in an HMEEC cell line caused an upregulation of CYLD and a concomitant reduction in inflammation [XREF_BIBR]."
PDE4B decreases the amount of CYLD.
| 6
PDE4B decreases the amount of CYLD. 6 / 6
| 6

reach
"In the present study, we identified PDE4B as a key negative regulator for CYLD via selective activation of c-jun N-terminal kinase 2 (JNK2), but not JNK1, and inhibition of PDE4B significantly enhanced NTHi induced CYLD expression and suppressed inflammation."

reach
"In the present study, we showed that inhibition of PDE4B markedly enhanced upregulation of CYLD expression by the bacterial pathogen NTHi, thereby suggesting that PDE4B acts as a negative regulator for CYLD."

reach
"Inhibition of PDE4B markedly increased the expression of CYLD and subsequently suppressed bacteria induced inflammation in well established models of both lung and middle ear inflammation."

reach
"As shown in XREF_FIG, PDE4B knockdown selectively inhibited activation of JNK2 but not JNK1, thereby confirming that PDE4B negatively regulates NTHi induced CYLD expression and mediates inflammation via specific activation of JNK2 but not JNK1."

reach
"These results suggest that PDE4B negatively regulates CYLD expression and mediates inflammation via the JNK pathway."

reach
"Taken together, it is evident that PDE4B negatively regulates CYLD expression and mediates NTHi induced inflammation via specific activation of JNK2 but not JNK1 pathway."
Notch affects CYLD
| 12
Notch decreases the amount of CYLD.
| 9
Notch decreases the amount of CYLD. 9 / 9
| 9

reach
"The results showed that blockade of Notch signal up-regulated expression of CYLD in BMDMs treated with CM from I/R injured hepatocytes (XREF_FIG)."

reach
"To test whether the Notch pathway and specifically Hes1 was directly repressing CYLD transcription, we used the Genomatix software to identify putative Hes1 binding sites, and found three distinct N-box consensus sites in the promoter and 5 ' UTR of the CYLD transcriptional start site (XREF_FIG, denoted as PRO1 and PRO2)."

reach
"Previous studies have reported that the Notch and Hes -1 pathway repressed the expression of CYLD XREF_BIBR, XREF_BIBR, a deubiquitination protease, and that CYLD can regulate the activation of TAK1 XREF_BIBR, XREF_BIBR, which is a member of the mitogen activated protein kinase kinase family."

reach
"Previous reports have demonstrated that Notch signal represses the expression of CYLD that negatively regulates NF-kappaB activation in macrophages XREF_BIBR."

reach
"On the other hand, activation of Notch signaling in macrophages led to increased inflammatory cytokine production and NF-kappaB activation and decreased CYLD expression in vitro."

reach
"Furthermore, suppression of Notch signaling by DAPT upregulated Cylindromatosis (CYLD) expression but downregulated TRAF6 expression, IκB kinase (IKK) α/β phosphorylation, and subsequently, phosphorylation and degradation of IκB-α, indicating that DAPT inhibited NF-κB activation triggered by TLR-4."

reach
"Next, we confirmed that miRNA-9-5p and Thbs-2-induced activation of the Notch pathway can inhibit the expression of CYLD and increase the phosphorylation of TAK1 in neurons, thus promoting activation of ERK and AKT and the expression of synapse proteins."

reach
"In T cell acute lymphoblastic leukemia (T-ALL), CYLD expression is repressed by the Notch and Hes1 pathway to promote persistent IKK activation and cell survival [XREF_BIBR]."

reach
"A previous study found that Notch stimulates NF-κB activation by initiating the transcription of Hes1, which then suppresses the expression of CYLD, a negative regulator of IKK activity in T-ALL cells [23]; however, this finding does not rule out the possibility that other mechanisms co-exist."
Notch inhibits CYLD.
| 3
Notch inhibits CYLD. 3 / 3
| 3

reach
"Therefore, we reasoned that fibulin-3 stimulation of Notch could downregulate CYLD and indirectly activate NF-kappaB."

reach
"Similarly, CYLD is downregulated by Notch and Hes1 in T-cell acute lymphoblastic lymphoma (T-ALL), thus leading to constitutive NF-kappaB activation."

reach
"Notch activation in CYLD siRNA transfected cells was normalised to cells transfected with non silencing siRNA."
NDRG1 affects CYLD
| 7 5
NDRG1 binds CYLD.
| 4 5
| 4 5

reach
"We further evaluated the association between CYLD and NDRG1 in NPC cell lines."

sparser
"To fully reveal the molecules potentially interacting with CYLD, we performed co-IP and MS analyses, with the results revealing for the first time that CYLD interacts with NDRG1."

reach
"Consistently, the anti-NDRG1 antibody pulled down NDRG1, as well as CYLD, confirming an interaction between CYLD and NDRG1 in CNE2 cells (XREF_FIG)."

sparser
"Consistently, the anti-NDRG1 antibody pulled down NDRG1, as well as CYLD, confirming an interaction between CYLD and NDRG1 in CNE2 cells ( xref )."

sparser
"In the present study, we demonstrated for the first time a direct interaction between CYLD and NDRG1 in NPC cells along with upregulated NDRG1 protein levels but not mRNA levels."

sparser
"To further study the CYLDNDRG1 interaction, we performed co-IP experiments in CNE2 cells overexpressing CYLD ."

sparser
"CYLD Directly Interacts with NDRG1."

reach
"In the present study, we demonstrated for the first time a direct interaction between CYLD and NDRG1 in NPC cells along with upregulated NDRG1 protein levels but not mRNA levels."

reach
"To fully reveal the molecules potentially interacting with CYLD, we performed co-IP and MS analyses, with the results revealing for the first time that CYLD interacts with NDRG1."
NDRG1 activates CYLD.
| 3
NDRG1 activates CYLD. 3 / 3
| 3

reach
"Additionally, we observed that the CYLD specific promotion of NPC cell apoptosis was reversed by NDRG1 silencing (XREF_FIG and XREF_FIG)."

reach
"Additionally, we revealed that CYLD bound and upregulated N-Myc downstream regulated 1 (NDRG1), and that silencing NDRG1 abolished the tumor-suppressor effect of CYLD on NPC cells."

reach
"NDRG1 is a Functional Target of CYLD in NPC."
MYB affects CYLD
| 1 11
MYB activates CYLD.
| 9
MYB activates CYLD. 9 / 9
| 9

reach
"Notably, we also show that MYB drives the proliferation of CYLD defective cylindroma cells."

reach
"Our experiment supported that silenced MYB suppressed OTSCC malignancy by inhibiting miR-130a and activating CYLD."

reach
"Overexpression of MYB is known to drive proliferation of CYLD defective cylindroma cells, and molecular heterogeneity in the pathogenesis of sporadic and inherited cutaneous cylindromas appears to converge on MYB activation [XREF_BIBR]."

reach
"CYLD defective cylindroma cells were treated with MYB siRNAs for 72h, after which total cellular protein was prepared by lysing cells in RIPA lysis buffer (Millipore) supplemented with complete Mini Protease Inhibitors (Roche)."

reach
"MYB Knockdown Activates CYLD to Suppress OTSCC in vivo by Downregulating miR-130a Expression."

reach
"CYLD defective cylindroma cells were treated with MYB siRNAs for 6 consecutive days, after which cell proliferation was assayed using Alamar Blue Reagent (Thermo Fisher Scientific) and a VICTOR-3 multilabel reader (Perkin-Elmer), according to instructions supplied by the manufacturers."

reach
"This resulted in a significant inhibition of MYB target genes and proliferation of cylindroma cells from three independent tumours, suggesting that MYB activation drives the growth of CYLD defective cylindromas and potentially also the growth of MYB-NFIB-positive sporadic cylindromas."

reach
"MYB promotes the proliferation of CYLD defective cylindroma cells."

reach
"CYLD defective cylindroma cells were treated with MYB siRNAs for 48h before total RNA was extracted using an RNeasy Micro-kit (Qiagen)."
MYB inhibits CYLD.
| 1 2
MYB inhibits CYLD. 3 / 3
| 1 2

reach
"Additionally, knockdown of MYB activated CYLD to suppress OSCC in vivo by inactivating miR-130a expression."

eidos
"Additionally , MYB knockdown activated CYLD to suppress OTSCC by downregulating miR-130a ."

reach
"Additionally, MYB knockdown activated CYLD to suppress OTSCC by downregulating miR-130a."
CYLD affects SERPINE1
| 11 1
CYLD decreases the amount of SERPINE1.
| 10
CYLD decreases the amount of SERPINE1. 10 / 10
| 10

reach
"CYLD was suggested to interfere with the NFAT signalling pathway by deubiquitylating transforming growth factor-β-activated kinase 1 (TAK1), and to negatively regulate KK3-p38 kinase-dependent expression of plasminogen activator inhibitor-1 [39], [40]."

reach
"In this study, we provided evidence to show that CYLD inhibits PAI-1 expression probably through directly interacting with and deubiquitinating TRAF-6."

reach
"In this issue of Immunity, Lim et al. (2007) demonstrate that CYLD, a deubiquinating enzyme, represses the expression of plasminogen activator inhibitor-1, which is critical in preventing tissue damage."

reach
"Cylindromatosis (CYLD) inhibits Streptococcus pneumonia induced plasminogen activator inhibitor-1 expression via interacting with TRAF-6."

reach
"Our evidences here demonstrated that CYLD inhibited S. p -stimulated PAI-1 expression."

reach
"Together, these results indicate that TRAF-6 mediates S.p-induced PAI-1 expression, and CYLD inhibits PAI-1 expression probably through deubiquitinating TRAF-6."

reach
"Pneumolysin (a virulence factor produced by S pneumonia) induces CYLD expression, which inhibits the expression of plasminogen activator inhibitor-1 (PAI-1) in the lung, they report, and CYLD deficiency protects mice against pneumolysin induced lung injury."
| PMC

reach
"The authors showed that CYLD inhibited S. p -induced PAI-1 expression in lung, thereby potentiating pulmonary damages [18]."

reach
"Results from the same study using the CYLD knockout cells have showed that CYLD negatively regulates PAI-1 expression via inhibition of MKK3-p38 MAPK signaling pathway [18]."

reach
"Based on these information, we propose that CYLD associates, deubiquinites and in-activates TRAF-6, thus inhibiting subsequent PAI-1 expression."
CYLD inhibits SERPINE1.
| 1 1
| 1 1

reach
"Since PAI-1 inhibits plasminogen production and fibrinolysis, the indirect inhibition of PAI-1 by CYLD in combination with reduced lung hemorrhage and increased PAI-1 production of Cyld -/- mice indicate that CYLD caused augmented fibrinolysis."

sparser
"Since PAI-1 inhibits plasminogen production and fibrinolysis, the indirect inhibition of PAI-1 by CYLD in combination with reduced lung hemorrhage and increased PAI-1 production of Cyld −/− mice indicate that CYLD caused augmented fibrinolysis."
Ubiquitin affects CYLD
| 8

sparser
"CYLD binds linear ubiquitin."

sparser
"Since the N terminus and Lys63 side chain of ubiquitin are in close proximity, the most distal ubiquitin moiety, attached to the N terminus of the adjacent ubiquitin moiety bound to the distal ubiquit[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"In both catalytic states, the distal Ub is bound to CYLD in a similar manner, and the scissile bond is located close to the catalytic residue, whereas the proximal Ub is bound in a manner specific to Met1- or Lys63-linked chains."

sparser
"However, modeling indicates that, similar to HAUSP and USP14, the Lys48 side chain of the distal ubiquitin would be occluded and that a Lys48-linked chain could not be extended from a ubiquitin molecu[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"The detection of CYLD bound to M1-Ub reveals another, LUBAC-independent, layer of crosstalk between the two deubiquitinases."

sparser
"These data reveal a direct, LUBAC-independent but OTULIN-dependent binding of M1-Ub to CYLD."

sparser
"We identified no Gly-Gly ubiquitination signature sites on CYLD by proteomic approaches, suggesting that the posttranslational modification is not ubiquitination itself and that the binding of CYLD to M1-Ub is non-covalent."

sparser
"We confirmed the specific binding of CYLD to M1-Ub in an OTULIN gene-dosage dependent manner ( xref , xref )."
STAT3 affects CYLD
| 5 6
STAT3 binds CYLD.
| 2 6
| 2 6

sparser
"Hepatocytes are the most important cellular source of fibrinogen xref and, herein, we show that the increased STAT3 activity in the liver of Lm-infected Cyld −/− mice associated with an increased fibrin production ( xref )."

sparser
"Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63-ubiquitination of STAT3 in IL-6 stimulated hepatocytes."

reach
"In immunoprecipitates of nuclear STAT3, CYLD was undetectable further indicating that CYLD interacted with STAT3 in the cytosol (XREF_FIG)."

reach
"Immunoprecipitation experiments revealed that CYLD interacted with STAT3 in the cytoplasm and strongly reduced K63 ubiquitination of STAT3 in IL-6 stimulated hepatocytes."

sparser
"STAT3 and CYLD interacted in the cytoplasm but not in the nucleus of IL-6-stimulated hepatocytes ( xref )."

sparser
"Of note, the amount of CYLD associated with STAT3 increased upon IL-6 stimulation ( xref )."

sparser
"Catalytically inactive CYLD still interacted with STAT3 but failed to reduce K63-ubiquitination of STAT3 ( xref )."

sparser
"In immunoprecipitates of nuclear STAT3, CYLD was undetectable further indicating that CYLD interacted with STAT3 in the cytosol ( xref )."
STAT3 activates CYLD.
| 3
STAT3 activates CYLD. 3 / 3
| 3

reach
"Importantly, STAT3 siRNA treatment induced 100% mortality of Lm infected Cyld -/- mice, thus, resembling WT mice (XREF_FIG)."

reach
"Accordingly, knockdown of STAT3 significantly reduced serum IL-6 levels in Lm infected Cyld -/- mice as compared to mock treated infected Cyld -/- mice as well as untreated infected Cyld -/- mice (XREF_FIG)."

reach
"In this model inflammatory genes were activated by STAT3 mediated induction of miR-181b-1 that targets the tumor suppressor CYLD."
NLRP6 affects CYLD
| 3 8
| 3 8

reach
"These results suggested that Cyld associates with NLRP6 during an inflammatory response."

sparser
"These results suggested that Cyld associates with NLRP6 during an inflammatory response."

sparser
"GST—Cyld but not GST alone precipitated His—NLRP6, confirming a direct CyldNLRP6 interaction ( xref )."

sparser
"Cyld interaction with NLRP6 was specific, as Cyld did not associate with other members of the NLR family such as NLRP3 and NLRP12 ( xref , xref ), which are also expressed in the colon."

sparser
"Further, to investigate the role of NLRP6 and Cyld interaction in regulating IL-18, we induced colitis in Nlrp6 −/− , Cyld −/− and Cyld −/− Nlrp6 −/− mice using C. rodentium ."

sparser
"To determine whether this interaction occurs endogenously, we performed co-immunoprecipitation experiments with anti-Cyld and anti-NLRP6 using the colonic mucosal lysates of C. rodentium —infected mice, which showed an interaction between Cyld and NLRP6 ( xref )."

reach
"To determine whether this interaction occurs endogenously, we performed co-immunoprecipitation experiments with anti-Cyld and anti-NLRP6 using the colonic mucosal lysates of C. rodentium -- infected mice, which showed an interaction between Cyld and NLRP6 (XREF_FIG)."

sparser
"Cyld binds to NLRP6."

reach
"Cyld binds to NLRP6."

sparser
"Anti-Myc immunoprecipitated Flag—NLRP6 and anti-Flag immunoprecipitated Myc—Cyld, suggesting that Cyld and NLRP6 physically interact ( xref )."
Glu-Ala affects CYLD
| 11
Glu-Ala increases the amount of CYLD.
| 6
Glu-Ala increases the amount of CYLD. 6 / 6
| 6

reach
"We have also demonstrated that EA induced both apoptosis and necroptosis in CLL cells by inhibiting LEF1 function and restoring CYLD expression."

reach
"EA interfered with LEF1 binding to DNA and restored CYLD expression."

reach
"Thus, EA upregulated expression of CYLD in peri-ischemic areas after focal cerebral ischemia and reperfusion."

reach
"Thus, we hypothesized that EA would enhance CYLD expressions by restricting LEF1 function."

reach
"CYLD expression was increased by EA so we speculate that the negative feedback may control CYLD activity over time and this may inhibit excessive regulation."

reach
"Interestingly, we found that EA enhanced CYLD expression in all 6 samples."
Glu-Ala activates CYLD.
| 3
Glu-Ala activates CYLD. 3 / 3
| 3

reach
"EA upregulated CYLD mRNA and protein expression in the peri-ischemic cortex after ischemia and reperfusion but EA caused a substantial drop in CYLD protein at 6 h reperfusion."

reach
"CYLD silencing partially weakens anti-inflammatory effects of EA so EA may repress excessive activation of microglia and reduce deleterious pro inflammatory cytokines in part by upregulating CYLD after focal cerebral ischemia and reperfusion."

reach
"In addition, EA increased the number of neuronal CYLD positive cells in the ischemic cortical border region at 24 h reperfusion."
Glu-Ala inhibits CYLD.
| 2
Glu-Ala inhibits CYLD. 2 / 2
| 2

reach
"Therefore, EA may reduce inflammatory injury by upregulating CYLD."

reach
"Also, EA inhibited the p38 MAPK signaling pathway in the hippocampus of rats with cerebral ischemia and reperfusion injury and EA reduces CYLD protein at 6 h reperfusion, which may be associated with p38 MAPK signaling."
CYLD affects signalling
| 11
CYLD inhibits signalling. 10 / 11
| 11

sparser
"To first determine at which level CYLD inhibits TGF-β-signalling, we took advantage of the available lung epithelial cell lines, DR26 and R1B that are derived from the WT Mv1Lu cells and lack functional TβRII and TβRI, respectively xref ."

sparser
"We further show that CYLD inhibits TGF-β-signalling via decreasing the stability of Smad3 protein in a glycogen synthase kinase3-β (GSK3β)-Hsc70-interacting protein (CHIP)-dependent manner."

sparser
"CYLD inhibits TGF-β-signalling via decreasing Smad3 stability."

sparser
"This study proposes that CYLD inhibits TGFβ signalling by decreasing the stability of SMAD3 via the AKT–GSK3–CHIP pathway."

sparser
"CYLD inhibits TGF-β-signalling and thereby prevents fibrosis via decreasing stability of Smad3 protein in a GSK3β-CHIP-dependent manner."

sparser
"To further determine how CYLD inhibits TGF-β-signalling via Smad3, we next evaluated the effect of CYLD on Smad3 activation by using antibody against phosphorylated Smad3."

sparser
"To further determine whether CYLD inhibits TGF-β-signalling by likely targeting Smad3, we next evaluated the effect of CYLD knockdown in Smad3-deficient MEF cells."

sparser
"Because S. pneumoniae induces TGF-β-signalling and TGF-β-signalling is known as a crucial signalling pathway involved in the development of lung fibrosis xref xref xref xref xref xref xref , we determined whether CYLD inhibits TGF-β-signalling using various approaches including short interfering RNA (siRNA)."

sparser
"We further determined whether K14 residue in Akt is indeed functionally critical for mediating CYLD-induced inhibition of TGF-β-signalling."

sparser
"Having identified CYLD as a negative regulator of TGF-β-signalling and lung fibrosis, we next sought to determine how CYLD inhibits TGF-β-signalling."
| 10 1
| 7 1

reach
"In this study, we used transgenic mouse and human SCC models to investigate how CYLD loss-of-function leads to abnormal signal transduction and promotes tumorigenesis."

reach
"CYLD is a deubiquitination enzyme targeting lysine 63 linked ubiquitin chains and was shown to negatively regulate signal transduction factors and pathways including transforming growth factor-beta and NF-kappaB signaling pathways [XREF_BIBR - XREF_BIBR]."

reach
"As both CYLD and OTULIN negatively regulate the NF-kappaB signalling cascade, the impact of these deubiquitinases in different LUBAC dependent signalling cascades may be context dependent."

sparser
"It has been proposed that CYLD inhibits proinflammatory signal transduction [23,35] ."

reach
"These findings suggest that CYLD can both positively and negatively regulate signal transduction and homeostasis of B cells in vivo, depending on the expression of CYLD splice variants."

reach
"Because of abnormal activation of NF-kappaB, CYLD deficiency attenuates the signal transduction of NKT cells stimulated by IL-7."

reach
"For example, CYLD removes polyubiquitin chains from TBK1 and RIG-I and thus inhibits the IRF3 signaling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances this response (58)."

reach
"Ectopic expression of CYLD inhibits the IRF3 signalling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances the response."
| 3

reach
"Treatment of MEFs with either 12-O-tetradecanoylphorbol-13 acetate (TPA) (XREF_FIG) or TNF-alpha (XREF_FIG) which was shown earlier to regulate CYLD mediated signal transduction XREF_BIBR, XREF_BIBR, were unable to increase the proliferation rate of CYLD-/- MEFs compared to CYLD +/+ over a period of 24-96 hours (XREF_FIG)."

reach
"A proposed model explaining how p62 mutations lead to the Paget's disease of bone is the following: mutations of the UBA domain cause an impairment in the interaction between p62 and ubiquitinated TRAF6 and/or CYLD, an enzyme deubiquitinating TRAF6, which in turn enhances the activation of the NF-κB signaling pathway and the resulting increased osteoclastogenesis (Figure 3(b)) [160]."

reach
"CYLD deficiency impairs the DNA-triggered signaling pathway."
| 1 10
CYLD inhibits cell migration.
| 1 6
| 1 6

reach
"XREF_BIBR Additionally, Sanches et al XREF_BIBR showed that CYLD suppresses cell migration and invasion in cervical cancer, and Suenaga et al XREF_BIBR reported that CYLD downregulates induction of cisplatin resistance in oral squamous cell carcinoma."

reach
"In addition, CYLD substantially slowed down scratchwounding induced cell migration (XREF_FIG)."

reach
"In addition, CYLD m induced an increased rate of cell migration as assessed by a scratch wounding assay, while CYLD WT markedly slowed cell migration (XREF_FIG)."

reach
"Moreover, the wound healing assay shows that CYLD WT inhibits cell migration, while S323X and S371X showed significant differences with the WT (XREF_FIG E)."

eidos
"Furthermore , we found that CYLD deficiency promoted cervical cancer cell proliferation , colony formation , cell migration and invasion , and inhibited apoptosis instead , whereas it is just opposite with CYLD over-expression ."

reach
"The data are consistent with CYLD acting as a tumor suppressor gene to inhibit cell migration in vitro and metastasis in vivo."

reach
"The in vitro chamber migration and wound healing assays show that CYLD dramatically suppresses cell migration in both HK1 and C17 (XREF_FIG D, E, Figure S3)."
CYLD activates cell migration.
| 4
| 4

reach
"Catalytic domain mutation in CYLD inactivates its enzyme function by structural perturbation and induces cell migration and proliferation."

reach
"In contrast to the proliferation related activity, CYLD knockdown significantly decreased the cell migration of all the melanoma cell lines (n = 7, p < 0.05), and we demonstrated that the mechanism regulating melanoma cell migration was activation of RAC1 through the action of CYLD."

reach
"CYLD has also been shown to stimulate cell migration and thereby contribute to normal physiological processes."

reach
"In addition, CYLD m induced an increased rate of cell migration as assessed by a scratch wounding assay, while CYLD WT markedly slowed cell migration (XREF_FIG)."
CYLD affects CLIP3
3 | 1 4
3 | 1 4

No evidence text available

sparser
"These findings suggested that CYLD associates with the de-ubiquitinating function of CLIPR-59."

sparser
"CLIPR-59 subsequently associates with CYLD and mediates de-ubiquitination of RIP1, thus promoting the recruitment of Caspase-8 and FADD to create Complex-II."

No evidence text available

sparser
"Functional association of CLIPR-59 with CYLD in TNF- α signaling."

No evidence text available

reach
"CLIPR-59 subsequently associates with CYLD and mediates de-ubiquitination of RIP1, thus promoting the recruitment of Caspase-8 and FADD to create Complex-II."

sparser
"It is suggested that interaction of CLIPR-59 with CYLD but not RIP1 is regulated during TNF- α stimulation ( xref )."
Tubulin affects CYLD
| 7
| 7

sparser
"In addition, treatment of keratinocytes with TSA caused an increase in the interaction of CYLD with tubulin as compared with that in untreated cells ( xref )."

sparser
"For instance, Gao et al. identified that, Cyld interacts with tubulins, and the activity of this DUB is required for microtubule assembly and maintaining its stability."

sparser
"CYLD binds directly and indirectly to tubulin and microtubules via CG domains to regulate microtubule dynamics, with certain differences in tubulin-binding affinity and interacting partners among these CG domains [ xref ]."

sparser
"Interaction of CYLD with tubulin and MT."

sparser
"The alteration of MT dynamics and CYLDtubulin association is functionally linked to CYLD deubiquitylating activity and signaling ."

sparser
"Furthermore, exposure of keratinocytes ( xref ) or melanocytes ( xref ) to nocodazole, which depolymerises MTs, induced rapid dissociation of CYLD from MTs, suggesting that CYLD associates with polymerised tubulin."

sparser
"The interaction of CYLD with tubulin was confirmed by reverse immunoprecipitation of α-tubulin and subsequent immunoblotting against CYLD in melanocytes ( xref ) and in primary mouse keratinocytes ( xref )."
CYLD affects activity
| 10
CYLD inhibits activity. 10 / 10
| 10

sparser
"CYLD and OTULIN were not inhibiting NF-κB activity per se because the DUBs did not appreciably inhibit NF-κB activity induced by an engineered non-cleavable Met1-Ub4 protein targeted to inactive XIAP ( xref ; xref E and S3F)."

sparser
"CYLD can inhibit NF-κB activity by deubiquitinating and inactivating TRAF2 and TRAF6, RIP, NEMO, and the NF-κB co-activator BCL-3 ( xref ; xref )."

sparser
"Effect of H486R optineurin on CYLD-dependent inhibition of TNFα-induced NF-κB activity."

sparser
"In fact, in vitro infection of IFN-γ-stimulated BMDMs demonstrated that CYLD inhibited activity of NF-κB resulting in reduced IL-6 production, ROS synthesis, and bacterial killing, which were all dependent on NF-κB ( xref )."

sparser
"The finding that the increased NF-κB activity is not inhibited by over-expressed CYLD prompted us to investigate whether loss of optineurin affects levels of ubiquitinated RIP."

sparser
"Here, we newly identified that CYLD inhibits NOD2-dependent antibacterial activity of macrophages by K63 deubiquitination of RIPK2."

sparser
"In light of evidence that Hes1 appears to serve as a direct repressor of Cyld ( Cylindromatosis ) gene expression, with CYLD in turn inhibiting NF-κB pathway activity, the Akt impact on NF-κB and T-ALL may involve collaboration of Akt with other signaling components ( xref )."

sparser
"CYLD inhibits HDAC6 activity by binding to its catalytic domains."

sparser
"However, CYLD strongly inhibited TBK1-induced ISRE reporter activity, whereas USP21 had no obvious effect on TBK1-induced ISRE reporter activity (unpublished data)."

sparser
"Consistent with these previous studies, CYLD strongly inhibits TBK1-induced ISRE reporter activity (unpublished data)."
CYLD affects Tubulin
| 7
| 7

sparser
"In addition, treatment of keratinocytes with TSA caused an increase in the interaction of CYLD with tubulin as compared with that in untreated cells ( xref )."

sparser
"For instance, Gao et al. identified that, Cyld interacts with tubulins, and the activity of this DUB is required for microtubule assembly and maintaining its stability."

sparser
"CYLD binds directly and indirectly to tubulin and microtubules via CG domains to regulate microtubule dynamics, with certain differences in tubulin-binding affinity and interacting partners among these CG domains [ xref ]."

sparser
"Interaction of CYLD with tubulin and MT."

sparser
"The alteration of MT dynamics and CYLDtubulin association is functionally linked to CYLD deubiquitylating activity and signaling ."

sparser
"Furthermore, exposure of keratinocytes ( xref ) or melanocytes ( xref ) to nocodazole, which depolymerises MTs, induced rapid dissociation of CYLD from MTs, suggesting that CYLD associates with polymerised tubulin."

sparser
"The interaction of CYLD with tubulin was confirmed by reverse immunoprecipitation of α-tubulin and subsequent immunoblotting against CYLD in melanocytes ( xref ) and in primary mouse keratinocytes ( xref )."
CYLD affects RHOA
| 7 1
CYLD activates RHOA.
| 5
CYLD activates RHOA. 5 / 6
| 5

reach
"In agreement with the CYLD shRNA result, overexpression of GFP-CYLD promoted RhoA activity (XREF_FIG)."

reach
"These findings prompted us to investigate whether CYLD modulates other Rho family members."

reach
"We thus studied whether CYLD promoted RhoA activity by interacting with LARG."

reach
"We then investigated whether CYLD promoted RhoA activity via an interaction between these two proteins."

reach
"These results indicate that CYLD stimulates RhoA activity in a deubiquitinase activity dependent manner."
CYLD inhibits RHOA.
| 2
CYLD inhibits RHOA. 2 / 2
| 2

reach
"The data presented here are consistent with a model whereby CYLD cleavage initiates microtubule disruption and release of Rho GEFs."

reach
"Data presented here are consistent with a model whereby CYLD cleavage initiates microtubule disruption and release of Rho GEFs."
CYLD binds RHOA.
| 1
| 1

sparser
"Mechanistically, CYLD does not interact with RhoA; instead, it interacts with and deubiquitinates leukemia-associated RhoGEF (LARG)."
Eac affects CYLD
| 9
| 9

sparser
"Despite the suggested association of HPV with Barrett's dysplasia and EAC, a few studies found contradictory results."

sparser
"More and more lncRNAs associated with ESCC or EAC were identified and employed to the diagnosis, prognosis, and therapy."

sparser
"Gall and coworkers recently found that Streptococcus and Prevotella dominate the upper gastrointestinal tract and the ratio of these two species can be associated with two known EAC risk factors in BE (waist-to-hip ratio and hiatal hernia length) [ xref ]."

sparser
"Similarly, both ESCC and EAC are associated with more gram-negative microbiota."

sparser
"BE and EAC risk factor associated stimuli are capable of inducing the expression and secretion of inflammatory mediators."

sparser
"Since BE predisposes to EAC and LS predisposes to UGI cancer, we assessed the prevalence of BE, BE-related dysplasia, and BE-related EAC and factors associated with BE in a cohort of patients with LS."

sparser
"Additionally, esophageal microbiota is likely associated with both ESCC and EAC."

sparser
"Human studies suggest associations of the microbiome with ESCC and EAC ( xref )."

sparser
"In conclusion, in BE patients with baseline HGD/IMC, both DNA content abnormality and treatment with EMR alone were significantly associated with persistent/recurrent HGD/IMC or EAC following each endoscopic session."
ERK affects CYLD
| 5 4
ERK binds CYLD.
| 4
| 4

sparser
"Endogenous CYLD and ERK1/2 also interacted with each other in A375 cells ( xref )."

sparser
"Thus, the CYLD-ERK interaction, like the TRIM15-ERK interaction, may be mediated by the D domain-docking site and the CD domain on the respective proteins."

sparser
"As the interaction of ERK1/2 with CYLD declined following IGF1 stimulation, the interaction of ERK1/2 with MEK increased ( xref )."

sparser
"CYLD interacts with ERK1/2 via conserved domains."
ERK inhibits CYLD.
| 3
ERK inhibits CYLD. 3 / 3
| 3

reach
"BRAF mediated ERK activation induced Snail1 and down-regulated CYLD in melanoma cells."

reach
"Moreover, we demonstrate that suppression of CYLD by ERK1/2 signaling plays an important role in maintaining RIP1 expression, and that melanoma cells with acquired resistance to BRAF inhibitors are more critically dependent on RIP1 for survival."

reach
"Moreover, silencing of ERK1/2 caused downregulation of Snail1 and upregulation of CYLD, whereas silencing of Snail1 recapitulated the effect of ERK1/2 silencing on the expression of CYLD and RIP1 in Mel-CV."
ERK activates CYLD.
| 2
ERK activates CYLD. 2 / 2
| 2

reach
"To investigate whether any of these signalling pathways can mediate serum induced expression of CYLD, wild-type cells were treated with p38MAPK, ERK, and JNK specific pharmacological inhibitors."

reach
"Thus, both the increased NF-kappaB and ERK1/2 activation in Cyld -/- BMDM contributes to the increased ROS and NO production, although NF-kappaB seems to be the more potent regulator."

reach
"In the search for the tumor suppressor function of CYLD, several laboratories reported that CYLD can inhibit the activation of the classical NF-kappaB p65 and p50 transcription factor (Trompouki et al[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CYLD has deubiquitinating enzyme activity and inhibits the activation of transcription factor NF-kappaB."

reach
"The tumor suppressor gene CYLD, which was recently identified as the cylindromatosis gene, has a deubiquitinating enzyme (DUB) activity and inhibits activation of the transcription factor NF-kappaB, which has key roles in inflammation, immune responses, carcinogenesis, and protection against apoptosis [XREF_BIBR]."

reach
"CYLD, a tumor suppressor gene, has deubiquitinating enzyme activity and inhibits the activation of transcription factor NF-kappaB."

reach
"Consequently, CYLD inhibits the activation of the transcription factor NF-kappaB, which plays an important role for immune responses."

reach
"These observations suggest that suppression of CYLD enhances the activity of the IKK kinase and the nuclear localization of NF-kappaB transcription factors."

reach
"CYLD (the familial cylindromatosis tumor suppressor gene) enhances the activation of the transcription factor NFkapa-B [XREF_BIBR], RBBP6, (which binds to the retinoblastoma gene product pRB) [XREF_BIBR], and PNUTL2 (which is an apoptosis related protein in the TGF-beta signaling pathway) [XREF_BIBR]."

reach
"Our study supported the involvement of six candidate genes in susceptibility to psoriasis : SCL12A8, which belongs to the solute carrier gene family; FLG and TGM5, which are involved in epidermal differentiation; CARD15 and CYLD, which modulate the transcription factor NF-kB; and IL1RN, which encodes an IL receptor antagonist."

reach
"These researchers found that the familial cylindromatosis tumour suppressor gene (CYLD), previously of unknown function, could enhance the activation of the transcription factor NF-kappaB, leading to increased resistance to apoptosis."
CYLD affects eac
| 9
| 9

sparser
"Despite the suggested association of HPV with Barrett's dysplasia and EAC, a few studies found contradictory results."

sparser
"More and more lncRNAs associated with ESCC or EAC were identified and employed to the diagnosis, prognosis, and therapy."

sparser
"Gall and coworkers recently found that Streptococcus and Prevotella dominate the upper gastrointestinal tract and the ratio of these two species can be associated with two known EAC risk factors in BE (waist-to-hip ratio and hiatal hernia length) [ xref ]."

sparser
"Similarly, both ESCC and EAC are associated with more gram-negative microbiota."

sparser
"BE and EAC risk factor associated stimuli are capable of inducing the expression and secretion of inflammatory mediators."

sparser
"Since BE predisposes to EAC and LS predisposes to UGI cancer, we assessed the prevalence of BE, BE-related dysplasia, and BE-related EAC and factors associated with BE in a cohort of patients with LS."

sparser
"Additionally, esophageal microbiota is likely associated with both ESCC and EAC."

sparser
"Human studies suggest associations of the microbiome with ESCC and EAC ( xref )."

sparser
"In conclusion, in BE patients with baseline HGD/IMC, both DNA content abnormality and treatment with EMR alone were significantly associated with persistent/recurrent HGD/IMC or EAC following each endoscopic session."
CYLD affects NDRG1
| 4 5
| 4 5

reach
"We further evaluated the association between CYLD and NDRG1 in NPC cell lines."

sparser
"To fully reveal the molecules potentially interacting with CYLD, we performed co-IP and MS analyses, with the results revealing for the first time that CYLD interacts with NDRG1."

reach
"Consistently, the anti-NDRG1 antibody pulled down NDRG1, as well as CYLD, confirming an interaction between CYLD and NDRG1 in CNE2 cells (XREF_FIG)."

sparser
"Consistently, the anti-NDRG1 antibody pulled down NDRG1, as well as CYLD, confirming an interaction between CYLD and NDRG1 in CNE2 cells ( xref )."

sparser
"In the present study, we demonstrated for the first time a direct interaction between CYLD and NDRG1 in NPC cells along with upregulated NDRG1 protein levels but not mRNA levels."

sparser
"To further study the CYLDNDRG1 interaction, we performed co-IP experiments in CNE2 cells overexpressing CYLD ."

sparser
"CYLD Directly Interacts with NDRG1."

reach
"In the present study, we demonstrated for the first time a direct interaction between CYLD and NDRG1 in NPC cells along with upregulated NDRG1 protein levels but not mRNA levels."

reach
"To fully reveal the molecules potentially interacting with CYLD, we performed co-IP and MS analyses, with the results revealing for the first time that CYLD interacts with NDRG1."
CYLD affects LCK
| 6 2
CYLD binds LCK.
| 2 2
| 2 2

reach
"CYLD physically interacts with LCK and facilitates the binding of active LCK to its target ZAP-70, thereby enhancing the TCR induced tyrosine phosphorylation of ZAP-70."

reach
"CYLD physically interacted with active Lck and promoted recruitment of active Lck to its substrate, Zap70."

sparser
"Notably, CYLD selectively interacts with the active form of LCK."

sparser
"CYLD physically interacted with active Lck and promoted recruitment of active Lck to its substrate, Zap70."
CYLD activates LCK.
| 4
CYLD activates LCK. 4 / 4
| 4

reach
"In regulating T-cell receptor (TCR) signaling during the transition from DP thymocytes to mature SP thymocytes, CYLD targets the tyrosine kinase LCK, playing a critical role in this transition."

reach
"Specifically, CYLD positively regulates LCK in thymocytes and negatively regulates TAK1 in peripheral T cells XREF_BIBR, XREF_BIBR."

reach
"We have previously shown that CYLD positively regulates LCK function and TCR proximal signaling in thymocytes."

reach
"In contrast to its negative role in the regulation of NF-kappaB, CYLD positively regulates LCK 18, a SRC family protein tyrosine kinase that is required for TCR proximal signalling and thymocyte development 77."
CYLD affects AP1
| 8 1
CYLD inhibits AP1.
| 5
CYLD inhibits AP1. 5 / 5
| 5

reach
"We found that CYLD m increased AP1 driven expression both in the presence and absence of EGF; whereas CYLD WT reduced AP1 activity in both conditions (XREF_FIG)."

reach
"We therefore examined whether the loss of CYLD also promoted the activation of AP-1."

reach
"CYLD loss-of-function promotes human SCC in an AP1 dependent manner."

reach
"In contrast, expression of the wild type CYLD inhibited SCC tumorigenesis and AP1 function."

reach
"Taken together, these findings indicated that CYLD negatively regulates the activation of TAK1, p38, and AP-1."
CYLD activates AP1.
| 3 1
CYLD activates AP1. 4 / 4
| 3 1

reach
"In addition, CYLD WT markedly reduced while CYLD m significantly potentiated AP1 activity driven by exogenous c-Fos expression; conversely, gene silencing of c-Jun or c-Fos abolished AP1-induction by CYLD m (XREF_FIG)."

sparser
"Thus, the exact mechanism of MALT1- and CYLD-dependent AP-1 activation and the role of JNK in this pathway remain to be further explored."

reach
"We found that CYLD m increased AP1 driven expression both in the presence and absence of EGF; whereas CYLD WT reduced AP1 activity in both conditions (XREF_FIG)."

reach
"CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK and AP1 Signaling at Multiple Levels."
CHUK affects CYLD
6 | 2 1
CHUK inhibits CYLD.
5 |
CHUK inhibits CYLD. 5 / 5
5 |

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"Thus, serine 418 is phosphorylated in vivo. Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

"The phosphorylation of cyld was completely abolished by the combined mutations of the entire serine cluster (m4, lane 5). Similar results were obtained with the ikk holoenzyme (fig. 4c, panel 1), recombinant ikk_ (panel 2), and recombinant ikk_cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."
CHUK phosphorylates CYLD.
1 | 2 1
CHUK phosphorylates CYLD on S418. 4 / 4
1 | 2 1

reach
"Previous work demonstrated that TNF-alpha induces IKKalpha- and IKKbeta mediated serine phosphorylation of CYLD (Ser 418) [49]."

"Thus, serine 418 is phosphorylated in vivo. Cyld phosphorylation may serve as a mechanism to inactivate its traf2 deubiquitination activity."

reach
"While it has been reported that IKKalpha and IKKbeta can phosphorylate Ser418 of CYLD, we demonstrated that CYLD is phosphorylated much more efficiently by IKKepsilon than by either of the canonical IKKs."

sparser
"While it has been reported that IKKα and IKKβ can phosphorylate Ser418 of CYLD ( xref ), we demonstrated that CYLD is phosphorylated much more efficiently by IKKε than by either of the canonical IKKs."

reach
"Interaction of CYLD with tubulin and MT. We have earlier shown that UV or TPA treatment of primary mouse keratinocytes triggers perinuclear accumulation of CYLD, which correlates with its ability to interact with its downstream targets."

reach
"These data suggest that TPA increases tumor promotion in Cyld -/- mice by enhancing tumor cell proliferation."

reach
"Importantly, TPA or UV-B failed to activate the Mut-CD1 promoter in Cyld +/+ as well as Cyld -/- keratinocytes, indicating that Cyld modulates TPA- or UV-B-mediated cyclin D1 promoter activation in an[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"As expected, TPA induced interaction of CYLD with Bcl-3, while this interaction (XREF_FIG), as well as perinuclear localization of CYLD (XREF_SUPPLEMENTARY), was prevented in the presence of nocodazole."

reach
"Importantly, nuclear accumulation of Bcl-3 was also significantly increased in DMBA and TPA induced Cyld -/- tumors when compared with tumors from control littermates."

reach
"This is supported by the finding that depletion of HDAC6 was not sufficient to induce the interaction of CYLD with Bcl-3, but TPA mediated activation of CYLD is additionally required."

reach
"TPA stimulated Cyld +/+ keratinocytes and EGFP-CYLD-expressing melanoma cells showed reduced levels of BrdU positive nuclei as an indication of delayed S-phase progression in the presence of activated CYLD (XREF_FIG)."

reach
"In addition, we found that TPA treatment of Cyld +/+ keratinocytes caused redistribution of CYLD and induced its accumulation in the perinuclear region, which has been previously shown to be critical in mediating the interaction with its downstream substrate Bcl-3."
WHAMM affects CYLD
| 8
| 8

sparser
"Meanwhile, two amino-terminal cytoskeleton-associated protein glycine-rich (CAP-Gly) domains of CYLD interact with the astral microtubules and increase their stability [ xref ]."

sparser
"If the basic side chain contributes significantly to MT binding, then CYLD may not interact with microtubules; however, β-tubulin, as well as Cdc37 and Hsp90, reportedly exists in the IKK complex (Ch[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Given that the extreme N-terminal CAP-Gly domain of CYLD is essential for its interaction with microtubules 17-19 , the above data indicate that the effect of CYLD on noscapine activity is dependent on the binding of CYLD to microtubules and is independent of its deubiquitinase activity."

sparser
"Although the conserved CAP-GLY domains provide structural basis for the interactions of CYLD with microtubules and many other proteins, an interesting finding is that EB1 containing a known CAP-GLY domain-interacting motif interacts with the C-terminal USP domain of CYLD other than the CAP-GLY domains, implicating a previously unknown role for the USP domain in mediating protein-protein interactions."

sparser
"CYLD interacts with microtubules primarily through its extreme N-terminal cytoskeleton associated protein glycine-rich (CAP-Gly) domain 17-19 ."

sparser
"For example, the cytoskeleton-associated protein-glycine-rich domain mediates the interaction of CYLD with microtubules, whereas calponin homology domain mediates the interaction of EB1 with microtubules. xref , xref , xref In this study, using a combination of taxol-based microtubule isolation and mass spectrometry, we have identified a list of proteins that may potentially associate with microtubules."

sparser
"In agreement with the role of the extreme N-terminal CAP-Gly domain in mediating CYLD interaction with microtubules, immunoblotting revealed that a significant proportion of CYLD, but not its ΔCG1 mutant, was present in the microtubule pellet fraction (Figure xref A)."

sparser
"The DUB CYLD can associate with microtubules through a CAP-Gly domain, regulate their dynamics, and control entry into mitosis ( xref ; xref ; xref ), whereas a ubiquitin C-terminal hydrolase, UCHL1, has also been found associated with microtubules in certain cell types ( xref )."
TRAF6 affects SQSTM1
| 8
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
MIR21 affects CYLD
| 7
MIR21 inhibits CYLD.
| 3
MIR21 inhibits CYLD. 3 / 4
| 3

reach
"has shown that miR-21, together with miR-181b-1, inhibit PTEN and cylindromatosis (CYLD) tumor suppressor functions, respectively, leading to increased NF-kB activity thus underlying the epigenetic switch that links inflammation to cancer."

reach
"IL-6 also activates STAT3 causing direct activation of miR-21 and miR-18b-1, which respectively inhibit PTEN and CYLD (tumor suppressor genes)."

reach
"This suggests that these miRNAs are part of the regulatory circuit, and indeed they found that their expression is regulated by IL-6 and that both miR-21 and miR-181b-1 can activate NF-kappaB by targeting and inhibiting the tumour suppressors PTEN and CYLD [XREF_BIBR]."
MIR21 activates CYLD.
| 4
MIR21 activates CYLD. 4 / 4
| 4

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-jB activity required to maintain the transformed state."

reach
"MiR-21 and miR-181b act as an epigenetic switch to inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain the transformed state XREF_BIBR."

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-κB activity required to maintain the transformed state."

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kappaB activity required to maintain the transformed state."
GATD3B affects CYLD
| 8
GATD3B inhibits CYLD.
| 5
GATD3B inhibits CYLD. 5 / 5
| 5

reach
"It has been reported that NF-kappaB is activated via NICD and Hes1 mediated repression of the deubiquitinase CYLD and has a crucial role in the survival and drug resistance of T-ALL cells."

reach
"The experiments performed by Espinosa and collaborators [XREF_BIBR] in T-ALL and HEK293T cells support the notion that HES1 induced CYLD repression results in increased IKK kinase activity, IkappaBalpha degradation, RelA nuclear translocation, and NF-kappaB transcriptional activity."

reach
"Similarly, CYLD is downregulated by Notch and Hes1 in T-cell acute lymphoblastic lymphoma (T-ALL), thus leading to constitutive NF-kappaB activation."

reach
"The mechanism of Notch induced NF-kappaB activation in T-ALL involves Hes1, which transcriptionally represses CYLD (cylindromatosis), a deubiquitinase which down-regulates NF-kappaB signaling by removing the activator K63 ubiquitin chains from different elements of the NF-kappaB signalosome [XREF_BIBR]."

reach
"Hes1 downregulated CYLD, a negative regulator of NF-kappaB signalling, and then activated the IKK/IkappaBalpha/NF-kappaB signalling pathway."
GATD3B decreases the amount of CYLD.
| 3
GATD3B decreases the amount of CYLD. 3 / 3
| 3

reach
"In T cell acute lymphoblastic leukemia (T-ALL), CYLD expression is repressed by the Notch and Hes1 pathway to promote persistent IKK activation and cell survival [XREF_BIBR]."

reach
"To test whether the Notch pathway and specifically Hes1 was directly repressing CYLD transcription, we used the Genomatix software to identify putative Hes1 binding sites, and found three distinct N-box consensus sites in the promoter and 5 ' UTR of the CYLD transcriptional start site (XREF_FIG, denoted as PRO1 and PRO2)."

reach
"A significant portion of these effects can be attributed to the suppression of CYLD expression by Hes1."
EGFR affects CYLD
| 7 1
EGFR increases the amount of CYLD.
| 3
EGFR increases the amount of CYLD. 3 / 3
| 3

reach
"Follow-up validation revealed that K. pneumoniae exploits an EGF receptor (EGFR)-PI3K-AKT-PAK4-ERK-GSK3beta signaling pathway to induce the expression of the deubiquitinase CYLD to attenuate the cytokine dependent nuclear translocation of NF-kappaB."

reach
"Finally, we found that CYLD expression was triggered by the multikinase inhibitor, sorafenib, by the inhibition of Raf-1, as well as by the blockage of the pro survival kinases, MEK (U0126) and the epidermal growth factor receptor (AG1478)."

reach
"RT-qPCR results showed that EGFR silencing decreased miR-222-5p expression, but enhanced CYLD expression, whereas miR-222-5p inhibitor increased CYLD expression (Figure 5A)."
EGFR activates CYLD.
| 3
EGFR activates CYLD. 3 / 3
| 3

reach
"In summary, EGFR silencing inhibited cell proliferation, migration, and invasion by activating CYLD via miR-222-5p in HepG2 cells."

reach
"EGFR silencing represses cell proliferation, migration, and invasion by upregulating CYLD through miR-222-5p in HepG2 cells."

reach
"These results show that EGFR upregulated miR-222-5p, while miR-222-5p downregulated CYLD."
EGFR inhibits CYLD.
| 1 1
EGFR inhibits CYLD. 2 / 2
| 1 1

reach
"In other words, EGFR inhibited CYLD by mediating effects on miR-222-5p."

sparser
"In other words, EGFR inhibited CYLD by mediating effects on miR-222-5p."

sparser
"In this study, using an oxidative damage model in RPE cells, we identified a novel oxidation-related lncRNA named CYLD-AS1."

sparser
"We further revealed that the expression of CYLD-AS1 was increased in RPEs during oxidative stress."

sparser
"Depletion of CYLD-AS1 promoted cell proliferation and mitochondrial function and protected RPE cells against hydrogen peroxide (H 2 O 2 )-induced damage."

sparser
"Oxidative stress-induced lncRNA CYLD-AS1 promotes RPE inflammation via Nrf2/miR-134-5p/NF-κB signaling pathway."

sparser
"In summary, our study revealed that CYLD-AS1 affects the oxidative stress-related and inflammatory functions of RPE cells by sponging miR-134-5p to mediate NRF2/NF-κB signaling pathway activity, suggesting that targeting CYLD-AS1 could be a promising strategy for the treatment of AMD and related diseases."

sparser
"Remarkably, these two signaling pathways were mediated by the CYLD-AS1 interactor miR-134-5p."

sparser
"Moreover, exosomes secreted by CYLD-AS1 knockdown RPE cells had a lower proinflammatory effect than those secreted by control cells."

sparser
"Mechanistically, CYLD-AS1 also regulated the expression of NRF2, which is related to oxidative stress, and NF-κB signaling pathway members, which are related to inflammation."

reach
"The higher sensitivity of Cyld -/- mice to DSS induced inflammation indicates a role for CYLD in the negative regulation of the mucosal innate immune response to microorganisms."

reach
"CYLD inhibits activation of nuclear factor-kappaB (NF-kappaB) and innate immune response."

reach
"For example, CYLD has been shown to downregulate the inflammatory response following bacterial infection with Escherichia coli by negatively regulating the innate immune response via inhibition of NF-kappaB signalling."

reach
"Cellular proteins DUBA and CYLD also negatively regulate the innate immune response."

reach
"Interestingly, CYLD is reported to negatively regulate the innate immune response to infection by Listeria monocytogenes, an intracellular bacterial pathogen recognized by NOD1 and NOD2."

reach
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63-based chains [55, 56] , and USP15 inhibits the NFkB pathway by removing K48-Ub from IkBa, preventing its degradation [57] ."

reach
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63-based chains [55], [56], and USP15 inhibits the NFκB pathway by removing K48-Ub from IκBα, preventing its degradation [57]."

reach
"Three human DUBs, CYLD, A20 and DUBA, have been shown to negatively regulate the innate immune response by removing K63 based chains XREF_BIBR, XREF_BIBR, and USP15 inhibits the NFkappaB pathway by removing K48-Ub from IkappaBalpha, preventing its degradation XREF_BIBR."
CYLD affects Wnt
| 7
CYLD inhibits Wnt.
| 4
CYLD inhibits Wnt. 4 / 5
| 4

reach
"In human cylindroma, CYLD negatively regulates Wnt and beta-catenin signaling via deubiquitination of Dishevelled, which is a key component in Wnt mediated beta-catenin nuclear translocation."

reach
"Increased CYLD expression may likewise diminish Wnt pathway activation and beta-catenin accumulation (XREF_FIG) via K63 linked deubiquitination of Dvl."

reach
"XREF_BIBR - XREF_BIBR Additionally, Tauriello et al XREF_BIBR demonstrated that CYLD inhibits the Wnt pathway by deubiquitinating disheveled in familial cylindromatosis tumors."

reach
"In addition, CYLD was proposed to inhibit Wnt signalling by deubiquitinating dishevelled XREF_BIBR."
CYLD activates Wnt.
| 3
CYLD activates Wnt. 3 / 3
| 3

reach
"Therefore, the activity of this DUB should stimulate rather than attenuate the signalling activity of Dvl, which means that the observed downregulation of Wnt signalling by CYLD XREF_BIBR can not be explained by its effect on Dvl polymerization."

reach
"Loss of the tumor suppressor CYLD enhances Wnt and beta-catenin signaling through K63 linked ubiquitination of Dvl."

reach
"The DIX domain is ubiquitinated in vivo at multiple lysines, which can be antagonized by various deubiquitinases (DUBs) including the CYLD tumour suppressor that attenuates Wnt signalling."
CYLD affects WHAMM
| 8
| 8

sparser
"Meanwhile, two amino-terminal cytoskeleton-associated protein glycine-rich (CAP-Gly) domains of CYLD interact with the astral microtubules and increase their stability [ xref ]."

sparser
"If the basic side chain contributes significantly to MT binding, then CYLD may not interact with microtubules; however, β-tubulin, as well as Cdc37 and Hsp90, reportedly exists in the IKK complex (Ch[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Given that the extreme N-terminal CAP-Gly domain of CYLD is essential for its interaction with microtubules 17-19 , the above data indicate that the effect of CYLD on noscapine activity is dependent on the binding of CYLD to microtubules and is independent of its deubiquitinase activity."

sparser
"Although the conserved CAP-GLY domains provide structural basis for the interactions of CYLD with microtubules and many other proteins, an interesting finding is that EB1 containing a known CAP-GLY domain-interacting motif interacts with the C-terminal USP domain of CYLD other than the CAP-GLY domains, implicating a previously unknown role for the USP domain in mediating protein-protein interactions."

sparser
"CYLD interacts with microtubules primarily through its extreme N-terminal cytoskeleton associated protein glycine-rich (CAP-Gly) domain 17-19 ."

sparser
"For example, the cytoskeleton-associated protein-glycine-rich domain mediates the interaction of CYLD with microtubules, whereas calponin homology domain mediates the interaction of EB1 with microtubules. xref , xref , xref In this study, using a combination of taxol-based microtubule isolation and mass spectrometry, we have identified a list of proteins that may potentially associate with microtubules."

sparser
"In agreement with the role of the extreme N-terminal CAP-Gly domain in mediating CYLD interaction with microtubules, immunoblotting revealed that a significant proportion of CYLD, but not its ΔCG1 mutant, was present in the microtubule pellet fraction (Figure xref A)."

sparser
"The DUB CYLD can associate with microtubules through a CAP-Gly domain, regulate their dynamics, and control entry into mitosis ( xref ; xref ; xref ), whereas a ubiquitin C-terminal hydrolase, UCHL1, has also been found associated with microtubules in certain cell types ( xref )."
CYLD affects TRAF7
1 1 | 3
CYLD inhibits TRAF7.
| 1
CYLD inhibits TRAF7. 1 / 4
| 1

reach
"CYLD also negatively regulates TRAF7, a recently identified TRAF family member, likely via a deubiquitination dependent mechanism."
CYLD deubiquitinates TRAF7.
1 | 1
CYLD deubiquitinates TRAF7. 2 / 2
1 | 1

reach
"CYLD deubiquitinates TRAF6 and TRAF7 to negatively regulate peptidoglycan-induced Toll-Like receptor 2 (TLR2) signaling and inflammation [45]."

"Other identified CYLD substrates include TNF receptor associated factor 7 (TRAF7), TRAF interacting protein (TRIP), transforming growth factor beta-activated kinase 1 (TAK1), NF-kappa-B essential modifier (NEMO), lymphocyte cell specific protein-tyrosine kinase (LCK), receptor-interacting protein 1 (RIP1), retinoic acid inducible gene (RIG), and polo-like kinase 1 (PLK1)"
CYLD binds TRAF7.
1 | 1
1 | 1

reach
"Later work studying signaling through the toll like receptor 2 (TLR2) performed cell based experiments to demonstrate that CYLD binds to TRAF6 and TRAF7 and that depletion of CYLD increases the ability of transfected TRAF6 or TRAF7 to activate an NFkappaB dependent reporter gene [XREF_BIBR]."

No evidence text available
CYLD affects TNFRSF11A
| 8
| 8

reach
"Further, the de-ubiquitinase CYLD has been shown to inactivate TRAF6 downstream of RANK in osteoclasts, as evidenced by removal of polyubiquitin chains, and the physiologic relevance of this mechanism is supported by the phenotype of CYLD deficient osteoclasts, which exhibit hyper-responsiveness to RANK."

reach
"Deubiquitinating enzyme CYLD negatively regulates RANK signaling and osteoclastogenesis in mice."

reach
"Thus, CYLD inhibits RANK mediated signaling function by deubiquitinating TRAF6 or its downstream targets involved in NF-kappaB activation."

reach
"CYLD inhibits RANK mediated signaling in osteoclasts in a negative feedback loop by deubiquitinating TRAF6 (XREF_FIG)."

reach
"The deubiquitinating enzyme, CYLD has been shown to interact with p62 UBA domain to inhibit TRAF6 ubiquitination and thereby negatively regulates RANK signaling and osteoclastogenesis."

reach
"Interestingly, CYLD has been shown to negatively regulate RANK signalling and osteoclastogenesis in mice [XREF_BIBR]."

reach
"Deubiquitinating enzyme cylindromatosis (CYLD) has been shown to negatively regulate RANK ligand-RANK signaling essential for OCL differentiation."

reach
"In addition, CYLD negatively regulates RANK signaling, which is known to be a key factor in bone resorption in cholesteatoma [XREF_BIBR]."
CYLD affects SQSTM1, and TRAF6
| 8
| 8

sparser
"Sal A Restrains Angiogenesis by Promoting P62-CYLD-TRAF6 Interactions."

sparser
"Co-IP results in our study presented that Sal A remarkably promotes P62-CYLD-TRAF6 interaction."

sparser
"Coimmunoprecipitation result (Figures xref – xref ) reveals apparent P62-CYLD-TRAF6 interaction in the Sal A + OX-LDL group than that in the OX-LDL group."

sparser
"Sal A antagonized OX-LDL effects and restrained CNV progression by decreasing VEGF/PDGF/CYLD, increasing antiangiostatin levels, and promoting P62-CYLD-TRAF6 interaction."

sparser
"Thus, CYLD appears to play dual roles in angiogenesis pathology: facilitating tube formation and promoting VEGF expression, meanwhile negatively regulating TRAF6 function via P62-CYLD-TRAF6 interaction."

sparser
"Given that this was seen within 1–2 h after stimulation, much earlier than increased p62 expression, the ordered interaction of p62 with TRAF6 and CYLD during macrophage activation is not likely to be entirely attributed to inducible p62 expression, but may involve posttrans-lational modification of p62, such as ubiquitination ( xref ) and phosphorylation ( xref )."

sparser
"What we found in macrophages was a time-dependent, ordered interaction of p62 with TRAF6 and CYLD."

sparser
"We also demonstrated that Sal A modulates angiogenesis process by decreasing CYLD level and promoting P62-CYLD-TRAF6 interaction."
CYLD affects PRKCQ
| 8
CYLD binds PRKCQ.
| 6
| 6

reach
"It was recently revealed that PKCtheta, a facilitator of TCR and CD28 induced NFkappaB signaling, binds to CYLD in T cells antagonizing the DUB 's inhibition of NFkappaB and NFAT transactivation."

reach
"The formation of a direct PKCtheta and CYLD complex appears to regulate the short-term spatial distribution of CYLD, subsequently affecting NFkappaB and NFAT repressional activity of CYLD prior to its MALT1 dependent inactivation."

reach
"Interestingly, we observed increased activation of PKC-theta and NF-kappaB in CYLD deficient CD8 + T cells, suggesting that the interaction between CYLD and PKC-theta might also lead to the inhibition of PKC-theta-mediated NF-kappaB activation."

reach
"The different requirement for PKC and the altered kinetics in the mouse system led to the analysis of the stimulation dependent spatial and temporal organization of the PKCtheta and CYLD complex using immunofluorescence microscopy."

reach
"Alternatively, the existence of a constitutive CYLD and PKCtheta complex might suggest that PKCtheta, which shows activation dependent subcellular translocation, is important for removing CYLD from its NFkappaB related targets and attenuates the negative regulatory function of CYLD, enabling feedback control of NFkappaB activation."

reach
"demonstrated that PKC-theta interacts with CYLD leading to inhibition of CYLD function."
CYLD inhibits PRKCQ.
| 2
CYLD inhibits PRKCQ. 2 / 2
| 2

reach
"CYLD Reduces Activation of PKC-theta and Impairs NF-kappaB Activation in CD8 + T Cells."

reach
"Thus, CYLD, which is known to interact with PKC-theta, impaired the activation of PKC-theta and NF-kappaB in CD8 + T cells."
CYLD affects Neoplasms
| 1 5
CYLD inhibits Neoplasms.
| 1 3
| 1 3

reach
"This cluster also displays losses on chromosome 16, including the tumor suppressors CYLD and TSC2, and the DNA repair gene PALB2, as well as reduced expression of all three."

reach
"Regarding TC, with more aggressive behavior, several tumor suppressors including CYLD, CBFB, CDH1, CDH11, CTCF, and ZFHX3 was found, as well as a higher Tumor Mutational Burden (TMB) compared to thymomas (22)."

eidos
"Thus , the up-regulation of CYLD activity is associated with neurodegenerative diseases , whereas the down-regulation of CYLD causes cancers ."

reach
"CYLD deficiency enhances metabolic reprogramming and tumor progression in nasopharyngeal carcinoma via PFKFB3."
CYLD activates Neoplasms.
| 2
Mutated CYLD activates Neoplasms. 2 / 2
| 2

reach
"A benign tumor syndrome of hair follicles known as cylindromatosis is caused by the mutation of CYLD, a USPfamily DUB named after the disease it causes."

reach
"Since it is been well-known that CYLD mutation in humans causes several types of skin tumors and CYLD also has an anti-inflammatory function in IBD patients, our findings suggest that CYLD may regulate immune tolerance by regulating Treg function in humans."
CYLD affects IL6
| 8
CYLD inhibits IL6.
| 6
CYLD inhibits IL6. 6 / 6
| 6

reach
"CYLD overexpression clearly inhibited hypoxia induced synthesis and secretion of IL-6."

reach
"CYLD Enhances Severe Listeriosis by Impairing IL-6 and STAT3-Dependent Fibrin Production."

reach
"CYLD reduced IL-6, ROS production and killing of Lm in Listeria infected macrophages by impairing NF-kappaB activation."

reach
"In fact, CYLD overexpression significantly inhibited hypoxia triggered induction of IL-6 and IL-8."

reach
"Previously, we have shown that CYLD inhibits IL-6 production by macrophages, which in turn induces STAT3 dependent protective fibrin production by hepatocytes in listeriosis."

reach
"In fact, CYLD overexpression completely blocked hypoxia mediated induction of those inflammatory mediators and suppressed basal expression of some cytokines (IL-6, IL-8, IL1beta, IL-1F5, IL-1F8, and CXCL2)."
CYLD activates IL6.
| 2
CYLD activates IL6. 2 / 2
| 2

reach
"In the present study, we found that high glucose dose- and time-dependently downregulated the protein and mRNA expressions of CYLD in GMCs (SV40 MES 13 and HBZY-1) and increased the expression levels of p-IkappaBalpha, NF-kappaBp65, and p-NF-kappaBp65, and furthermore induced the release of MCP-1, IL-6, and IL-8."

reach
"CYLD impairs production of fibrin in Listeria infection in mice by inhibiting NF-kB-mediated activation of IL-6 production and IL-6 's activation of the STAT3 pathway that leads to fibrosis [XREF_BIBR]."

sparser
"In this study, using an oxidative damage model in RPE cells, we identified a novel oxidation-related lncRNA named CYLD-AS1."

sparser
"We further revealed that the expression of CYLD-AS1 was increased in RPEs during oxidative stress."

sparser
"Depletion of CYLD-AS1 promoted cell proliferation and mitochondrial function and protected RPE cells against hydrogen peroxide (H 2 O 2 )-induced damage."

sparser
"Oxidative stress-induced lncRNA CYLD-AS1 promotes RPE inflammation via Nrf2/miR-134-5p/NF-κB signaling pathway."

sparser
"In summary, our study revealed that CYLD-AS1 affects the oxidative stress-related and inflammatory functions of RPE cells by sponging miR-134-5p to mediate NRF2/NF-κB signaling pathway activity, suggesting that targeting CYLD-AS1 could be a promising strategy for the treatment of AMD and related diseases."

sparser
"Remarkably, these two signaling pathways were mediated by the CYLD-AS1 interactor miR-134-5p."

sparser
"Moreover, exosomes secreted by CYLD-AS1 knockdown RPE cells had a lower proinflammatory effect than those secreted by control cells."

sparser
"Mechanistically, CYLD-AS1 also regulated the expression of NRF2, which is related to oxidative stress, and NF-κB signaling pathway members, which are related to inflammation."
CYLD affects DVL
| 6 2
CYLD binds DVL.
| 3 2
| 3 2

sparser
"For instance, CYLD interacts with Dishevelled (DVL) and counteracts its K63-linked ubiquitination, leading to inhibition of this cytoplasmic effector in the Wnt/β-catenin pathway ( xref )."

reach
"The deubiquitinating enzyme CYLD binds to and deubiquinates Dvl, inhibiting the signaling activity of Dvl and the activation of the Wnt pathway."

sparser
"At the molecular level, we show that CYLD interacts with Dvl and regulates K63-linked ubiquitination of the polymerization-prone DIX domain of Dvl."

reach
"CYLD interacts with Dvl and edits its ubiquitin chains, supporting a model in which the effect of CYLD on Wnt signaling is mediated by CYLD dependent deubiquitination of Dvl.How does Dvl function depe[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"XREF_BIBR - XREF_BIBR In addition, the deubiquitinating enzymes USP34 and USP7, CYLD and USP9X and USP4 can bind to Axin, Dvl and beta-catenin, respectively, thereby promoting the nuclear localization of beta-catenin and the Wnt signaling pathway by inhibiting their ubiquitination."
CYLD deubiquitinates DVL.
| 3
CYLD leads to the deubiquitination of DVL. 3 / 3
| 3

reach
"Knockout of CYLD in tumor cells can prevent K63 linked deubiquitination of Dvl [Dishevelled], which enhances Wnt and beta-catenin signaling [XREF_BIBR]."

reach
"It is also reported that a tumor suppressor CYLD deubiquitinase inhibits the ubiquitination of Dvl."

reach
"Based on the established role of Wnt signaling in self-renewal of the skin, associated cell lineage decisions, and skin appendage formation (Fuchs, 2007), we propose that increased or prolonged activa[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CYLD affects Cyclin
| 8
CYLD inhibits Cyclin.
| 3
CYLD inhibits Cyclin. 3 / 3
| 3

reach
"These findings indicate that Bcl-3 is required for the inhibitory effect of Cyld on TPA- and UV induced cyclin D1 activation and proliferation.To test whether the retention of Bcl-3 is dependent on th[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Moreover, regulation of JNK/AP -1 activation also plays a role in CYLD mediated suppression of cyclin D1 expression XREF_BIBR."

reach
"A potential area may be the downregulation of Cyclins by CYLD."
CYLD decreases the amount of Cyclin.
| 3
CYLD decreases the amount of Cyclin. 3 / 3
| 3

reach
"Indeed, CYLD is upregulated in injured carotid arteries of rats, reduces cyclin D1 levels, and is capable of suppressing vascular lesion formation."

reach
"In agreement with the mechanism in keratinocytes, CYLD markedly reduced expression of Cyclin D1 (XREF_FIG), cyclin D1 promoter activity (XREF_FIG), and BCL-3 recruitment to the cyclin D1 promoter in a complex with p50 or p52 (XREF_FIG, left) as compared with cells transduced with viral vectors carrying a catalytically inactive mutant of CYLD (C/S-CYLD), a GFP expression cassette or noninfected cells."

reach
"Also supporting this line of evidence is the finding that the tumor suppressor CYLD blocks cyclin D1 expression by inhibiting Bcl-3 signaling [XREF_BIBR]."
CYLD activates Cyclin.
| 2
CYLD activates Cyclin. 2 / 2
| 2

reach
"In agreement, down-regulation of CYLD in asSnail clones 1 and 2 resulted in up-regulation of Cyclin D1 and N-cadherin (XREF_FIG)."

reach
"Importantly, TPA or UV-B failed to activate the Mut-CD1 promoter in Cyld +/+ as well as Cyld -/- keratinocytes, indicating that Cyld modulates TPA- or UV-B-mediated cyclin D1 promoter activation in an[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
USP affects SPATA2
| 7
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
Trim14 affects CYLD
| 7
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
TRAF6 affects TNFAIP3
| 7
| 7

sparser
"Nonetheless, depletion of TRIP6 can significantly enhance the association of A20 or CYLD with TRAF6 in ovarian cancer cells and promote the binding of A20 to TRAF6 in glioblastoma cells, suggesting that targeting TRIP6 may prove to be an effective strategy to restore the function of A20 and CYLD in restricting the NF-κB activity in these cancer cells."

sparser
"To address this issue, we expressed FLAG-TRAF6 in HEK293T cells and treated cells with LPA for various times to determine how TRAF6 associates with deubiquitinase A20 or CYLD."

sparser
"Nonetheless, depletion of TRIP6 by either shRNA ( xref ) or Cas9/sgRNA ( xref ) not only enhanced the association of TRAF6 with A20, but also with CYLD in untreated and treated cells, suggesting a significant role for TRIP6 in antagonizing the binding of TRAF6 to both A20 and CYLD in ovarian cancer cells."

sparser
"On the other hand, in ovarian cancer cells and glioblastoma cells that show persistent NF-κB activity and high levels of TRIP6, both A20 and CYLD bind to TRAF6 very weakly."

sparser
"In this regard, here we provide evidence that the adaptor protein TRIP6 (thyroid hormone receptor-interacting protein 6), a specific interacting protein of the LPA2 receptor but not other LPA receptors, recruits TRAF6 to the LPA2 receptor and enhances the E3 ligase activity of TRAF6 by antagonizing the association of A20 and CYLD to TRAF6."

sparser
"Overexpression of TRIP6 interferes with the recruitment of A20 to TRAF6, whereas depletion of TRIP6 enhances the association of TRAF6 with A20 and CYLD, and eliminates LPA-promoted K63-linked polyubiquitination of TRAF6."

sparser
"In contrast, depletion of TRIP6 by TRIP6-specific shRNA or Cas9/sgRNA greatly enhances the association of TRAF6 with A20 and CYLD, and attenuates lysophosphatidic acid-induced muclear factor-κB and JNK/p38 activation in ovarian cancer cells."
SPATA2 affects USP
| 7
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
RIPK2 affects CYLD
| 4 3
| 4 3

sparser
"Catalytically inactive CYLD interacted with RIPK2 but failed to reduce K63 ubiquitination of RIPK2 (Figure xref B)."

sparser
"WB analysis of immunoprecipitates detected CYLD and RIPK2 only in WT BMDM but not in Cyld −/− BMDM indicating that CYLD interacts with RIPK2 (Figure xref A)."

reach
"The crucial importance of the CYLD and RIPK2 interaction for the reduction of protective anti-Lm immune responses is shown by the complete abolishment of the protective effect of Cyld deficiency by RIPK2 inhibition."

reach
"During in vitro infection of mouse bone marrow derived macrophages (BMDMs) with L. monocytogenes, CYLD binds and deubiquitylates RIPK2, resulting in decreased activation of NF-kappaB and ERK1/2 signaling."
| PMC

sparser
"Here, we demonstrate that CYLD also directly binds to RIPK2 and cleaves K63-polyubiquitin chains from RIPK2 in Lm-infected macrophages resulting in a reduced activation of NF-κB, p38 MAPK, and ERK1/2 and, consequently, in an impaired control of Lm in macrophages."

reach
"Here, we demonstrate that CYLD also directly binds to RIPK2 and cleaves K63-polyubiquitin chains from RIPK2 in Lm infected macrophages resulting in a reduced activation of NF-kappaB, p38 MAPK, and ERK1/2 and, consequently, in an impaired control of Lm in macrophages."

reach
"WB analysis of immunoprecipitates detected CYLD and RIPK2 only in WT BMDM but not in Cyld -/- BMDM indicating that CYLD interacts with RIPK2."
LEF1 affects CYLD
| 5 2
LEF1 inhibits CYLD.
| 4
LEF1 inhibits CYLD. 4 / 4
| 4

reach
"TNFa induced necrotic signaling can be blocked in some chronic leukemias by the action of LEF1 (Lymphoid Enhancer binding Factor 1), which acts on the Wnt and betaCatenin pathway to downregulate CYLD at the transcriptional level [XREF_BIBR]."

reach
"CYLD was negatively regulated by LEF1, and this repression was abolished upon selenite treatment."

reach
"Our team has previously demonstrated that LEF1 is a transcriptional repressor of CYLD in CLL."

reach
"For example, RIP3 and CYLD are downregulated in chronic lymphocytic leukemia (CLL) because lymphoid enhancer-binding factor 1 (LEF1), which is a transcriptional repressor of CYLD, is upregulated [65]."
LEF1 binds CYLD.
| 1 2
| 1 2

sparser
"In addition, LEF1 silencing sensitised CRC cells to selenite-induced apoptosis, which provides a new avenue for enhancing chemotherapy by targeting the efficiency of LEF1 binding to the CYLD promoter."

sparser
"Our study showed that LEF1 binds the CYLD promoter and suppresses endogenous CYLD levels, whereas selenite caused LEF1 to dissociate from the CYLD promoter."

reach
"Our study showed that LEF1 binds the CYLD promoter and suppresses endogenous CYLD levels, whereas selenite caused LEF1 to dissociate from the CYLD promoter."
CYLD affects p38
| 1 5 1
CYLD inhibits p38. 7 / 7
| 1 5 1

reach
"By interacting with TRAF2, CYLD prevents p38MAPK activation."

reach
"CYLD Impairs Production of Cytokines, ROS, and NO and Reduces Activation of NF-kappaB, ERK1/2, and p38MAPK in Lm Infected BMDM."

reach
"Thus, CYLD prevents excessive activation of TAK1 and p38, which results in reduced FOXP3 expression and Treg generation."

eidos
"CYLD inhibits p38 , causing increased vascular leakage and acute lung injury [ 82 ] ."

reach
"Taken together, these findings indicated that CYLD negatively regulates the activation of TAK1, p38, and AP-1."

sparser
"CYLD inhibits p38, causing increased vascular leakage and acute lung injury [ xref ]."

reach
"CYLD reduced activation of p65, JAK2, STAT3, and p38 MAPK as well as fibrin production in livers of Listeria infected WT mice."
CYLD affects Trim14
| 7
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
CYLD affects TNFAIP3, and TRAF6
| 7
| 7

sparser
"Nonetheless, depletion of TRIP6 can significantly enhance the association of A20 or CYLD with TRAF6 in ovarian cancer cells and promote the binding of A20 to TRAF6 in glioblastoma cells, suggesting that targeting TRIP6 may prove to be an effective strategy to restore the function of A20 and CYLD in restricting the NF-κB activity in these cancer cells."

sparser
"To address this issue, we expressed FLAG-TRAF6 in HEK293T cells and treated cells with LPA for various times to determine how TRAF6 associates with deubiquitinase A20 or CYLD."

sparser
"Nonetheless, depletion of TRIP6 by either shRNA ( xref ) or Cas9/sgRNA ( xref ) not only enhanced the association of TRAF6 with A20, but also with CYLD in untreated and treated cells, suggesting a significant role for TRIP6 in antagonizing the binding of TRAF6 to both A20 and CYLD in ovarian cancer cells."

sparser
"On the other hand, in ovarian cancer cells and glioblastoma cells that show persistent NF-κB activity and high levels of TRIP6, both A20 and CYLD bind to TRAF6 very weakly."

sparser
"In this regard, here we provide evidence that the adaptor protein TRIP6 (thyroid hormone receptor-interacting protein 6), a specific interacting protein of the LPA2 receptor but not other LPA receptors, recruits TRAF6 to the LPA2 receptor and enhances the E3 ligase activity of TRAF6 by antagonizing the association of A20 and CYLD to TRAF6."

sparser
"Overexpression of TRIP6 interferes with the recruitment of A20 to TRAF6, whereas depletion of TRIP6 enhances the association of TRAF6 with A20 and CYLD, and eliminates LPA-promoted K63-linked polyubiquitination of TRAF6."

sparser
"In contrast, depletion of TRIP6 by TRIP6-specific shRNA or Cas9/sgRNA greatly enhances the association of TRAF6 with A20 and CYLD, and attenuates lysophosphatidic acid-induced muclear factor-κB and JNK/p38 activation in ovarian cancer cells."
CYLD affects TLR2
| 3 3 1
CYLD inhibits TLR2. 7 / 7
| 3 3 1

reach
"For example, CYLD has been proven to negatively regulate TLR2 by TRAF6 and TRAF7 and an antiviral response in an H. influenza co-infection model [XREF_BIBR, XREF_BIBR]."

reach
"The TLR2 signaling inhibition by CYLD involves the TRAF6 and TRAF7 inhibition via their deubiquitination (MSK) 1 and 2 are nuclear proteins which share homology with the 90 kDa ribosomal S6 kinase (p90 rsk) family."
| DOI

sparser
"The TLR2 signaling inhibition by CYLD involves the TRAF6 and TRAF7 inhibition via their deubiquitination (MSK) 1 and 2 are nuclear proteins which share homology with the 90 kDa ribosomal S6 kinase (p90 rsk ) family."
| DOI

reach
"The ubiquitin editing enzyme CYLD inhibits TRAF6 and -7 and TLR2 [XREF_BIBR]."

eidos
"The TLR2 signaling inhibition by CYLD involves the TRAF6 and TRAF7 inhibition via their deubiquitination ( MSK ) 1 and 2 are nuclear proteins which share homology with the 90 kDa ribosomal S6 kinase ( p90 rsk ) family ."
| DOI

eidos
"The TLR2 signaling inhibition by CYLD involves the TRAF6 and TRAF7 inhibition via their deubiquitination ( Table 2 ) [ 174 ] ."
| PMC

eidos
"Tumor suppressor deubiquitinase ( DUB ) , cylindromatosis ( CYLD ) , inhibits TLR2 signaling responsible for the recognition of Gram-positive bacterial PAMPs [ PGN , LTA , MALP-2 ( Mycoplasma-derived lipopeptide 2 ) , and Pam3CSK4 ( a synthetic triacylated lipopeptide recognized by TLR1 / TLR2 heterodimer ] [ 174 ] ."
| PMC
CYLD affects NFKB1
| 6
CYLD activates NFKB1.
| 3
CYLD activates NFKB1. 3 / 4
| 3

reach
"CYLD activates NFKB signaling through deubiquitination of NFKB upstream regulators ubiquitylated by cIAP ubiquitin E3 ligase, and inhibition of cIAP by cIAP antagonist blocks NFKB activation XREF_BIBR XREF_BIBR."

reach
"Cyld inhibits tumor cell proliferation by blocking Bcl3 dependent NFkB signaling."

reach
"The para-caspase mucosa associated lymphoid tissue (MALT-1) has recently emerged as the most critical regulator of CYLD- mediated NFkB activation in various immune and non immune cells [6-8]."
CYLD inhibits NFKB1.
| 3
CYLD inhibits NFKB1. 3 / 3
| 3

reach
"Loss of CYLD up-regulates NFKB signaling and enhance metastasis in breast cancer [37]."

reach
"CYLD is downregulated in several cancers and inhibits the NFkB pathway [XREF_BIBR, XREF_BIBR]."

reach
"Even though the extensively studied deubiquitinases CYLD and A20 are also known to negatively regulate NFkB activation, as does MCPIP, the target substrate and physiological functions of virtually all deubiquitinases remain obscure."
CYLD affects MAPK3
| 2 3 2
CYLD inhibits MAPK3.
| 2 2
CYLD inhibits MAPK3. 4 / 4
| 2 2

eidos
"Depleting CYLD in TRIM15-knockdown A375 cells also restored ERK1 activity and proliferation ( Fig. 7e , f and Extended Data Fig. 8d ) ."

reach
"Vinpocetine suppresses Streptococcus pneumoniae-induced inflammation via inhibition of ERK1 by CYLD."

reach
"Depleting CYLD in TRIM15-knockdown A375 cells also restored ERK1 activity and proliferation (Fig. 7e,f and Extended Data Fig. 8d)."

eidos
"CYLD inhibitsERK1 / 2 activity and their interaction with MEK1 / 2 a , Knockout Cyldin MEFs increases ERK1 / 2 activity ."
CYLD binds MAPK3.
| 1 2
| 1 2

sparser
"In vitro , Flag-CYLD was pulled down by GST-ERK1, but not GST ( xref ), indicating that a direct interaction between CYLD and ERK1."

sparser
"Moreover, an increase in the TRIM15-ERK1 association upon IGF1 stimulation was accompanied by a decline in the CYLD-ERK1 association ( xref )."

reach
"In vitro, Flag-CYLD was pulled down by GST-ERK1, but not GST (Fig. 6b), indicating that a direct interaction between CYLD and ERK1."
CYLD affects MAPK
| 4 1
CYLD inhibits MAPK. 5 / 7
| 4 1

sparser
"Recently, we, along with others, have demonstrated that CYLD also inhibits MAPKs including p38 and JNK xref – xref ."

reach
"When transfected in cell lines, CYLD inhibits the activation of NF-kappaB and mitogen activated protein kinases stimulated by innate immune receptors, such as the Toll like receptors and TNF receptors."

reach
"CYLD was shown to negatively regulate NF-kappaB and MAPK activation by removing ubiquitin chains from key signalling molecules including NEMO, TRAF2, TRAF6 and RIPK1."

reach
"Moreover, knockdown of CYLD enhanced mitogen activated protein kinase (MAPK) ERK- and p38 mediated expression of c-jun, c-fos, and c-myc, which govern Nrf2 expression in cardiomyocytes."

reach
"CYLD also negatively regulates the c-Jun N-terminal kinase (JNK) signaling pathway and mitogen activated protein kinase (MAPK) pathway, which are known to participate in a wide range of cellular processes, including proliferation, differentiation, and apoptosis of cholesteatoma [XREF_BIBR, XREF_BIBR]."
CYLD affects Death
| 7
CYLD activates Death. 7 / 7
| 7

reach
"Indeed, our results demonstrate that upregulation of CYLD in cardiomyocytes impairs autophagy at the stage of autolysosome efflux and enhances myocardial death in PO-hearts."

reach
"Overexpression of CYLD promoted more apoptotic death ratio in PC-9/GR cells than that in PC-9 cells."

reach
"IKK blockade reactivates CYLD, as evidenced by the reduction in RIPK1 ubiquitination, which leads to the association of RIPK1 with the death-inducing signaling complex (DISC) to trigger cell death."

reach
"CYLD inactivates mechanistic target of rapamycin complex 1 (mTORC1) reactivation, upregulates Ras genes from rat brain 7 (Rab7) and enhances cardiomyocyte death in pressure overloaded hearts.."

reach
"Following the TNFR1 mediated assembly of pro inflammatory complex I, deubiquitinases (CYLD or A20) remove polyubiquitin chains from RIPK1 to terminate inflammation and enable downstream death signaling [50,51]."
| PMC

reach
"In addition, Cyld gene gain- and/or loss-of-function approaches in vitro and in vivo demonstrated that CYLD mediated cardiomyocyte death associated with impaired reactivation of mechanistic target of rapamycin complex 1 (mTORC1) and upregulated Ras genes from rat brain 7 (Rab7), two key components for autolysosomal degradation."

reach
"Nonetheless, it is possible for death-signaling CYLD and RIPK1 molecules, activated by disruption of the early checkpoint, to override the protection provided by the second NFκB-dependent checkpoint."
CYLD affects CEP192
4 | 1 2
4 | 1 2

reach
"CEP192 interacts physically and functionally with the K63-deubiquitinase CYLD to promote mitotic spindle assembly."

No evidence text available

sparser
"CYLD interacts with a centrosome protein, CEP192, which plays a critical role in centrosome maturation and has a more specific role in the organization of the mitotic microtubules [ xref , xref ]."

sparser
"Mitotic spindle formation is a critical step in the cell cycle and CEP192 (Centrosomal Protein of 192kD) interacts directly with CYLD to form the mitotic spindle, further bolstering the proof of CYLD’s regulatory role in cell division [ xref ]."

No evidence text available

No evidence text available

No evidence text available
CYLD affects CASP8
| 4 2
CYLD activates CASP8.
| 4
CYLD activates CASP8. 4 / 5
| 4

reach
"Increased caspase-8 activation was also observed in selenite treated cells transfected with CYLD, indicating that CYLD promoted caspase-8 activation via RIP1 deubiquitination (XREF_FIG)."

reach
"An alternative explanation holds that CYLD is the target of caspase-8 during the decision point between apoptosis vs. necroptosis, although this model is not mutually exclusive from the aforementioned."

reach
"These changes in sensitivity to TNF-alpha cytoxicity, mediated by the treatment of siCLIPR-59 or siCYLD, correlated with differences in RIP1 ubiquitination (XREF_SUPPLEMENTARY) These findings thus suggest that both CLIPR-59 and CYLD are essential for activation of Caspase-8 by TNF-alpha in the presence of Compound-3."

reach
"CYLD was also found to promote the assembly of an alternative caspase-8 activating complex containing RIP1 and FADD [XREF_BIBR]."
CYLD binds CASP8.
| 2
| 2

sparser
"Interaction between transfected CYLD and CASPASE 8 by co-immunoprecipitation was observed only when the activity of CASPASE 8 was blocked by the pan-caspase inhibitor zVAD-fmk, or by mutation of the CASPASE 8 active site, suggesting that CYLD is a substrate for proteolytic cleavage by CASPASE 8 ( xref )."

sparser
"Thus, the CASPASE-8:CYLD interaction is an early switch that determines survival versus necroptotic death in the TNFR1 pathway."
CEP192 affects CYLD
4 | 1 2
4 | 1 2

reach
"CEP192 interacts physically and functionally with the K63-deubiquitinase CYLD to promote mitotic spindle assembly."

No evidence text available

sparser
"CYLD interacts with a centrosome protein, CEP192, which plays a critical role in centrosome maturation and has a more specific role in the organization of the mitotic microtubules [ xref , xref ]."

sparser
"Mitotic spindle formation is a critical step in the cell cycle and CEP192 (Centrosomal Protein of 192kD) interacts directly with CYLD to form the mitotic spindle, further bolstering the proof of CYLD’s regulatory role in cell division [ xref ]."

No evidence text available

No evidence text available

No evidence text available
6 |
Valproic acid increases the amount of CYLD. 6 / 6
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
Sponging miR-96-5p affects CYLD
| 6
Sponging miR-96-5p activates CYLD. 6 / 6
| 6

eidos
"GMDS-AS1 acts as a ceRNA to upregulate the expression of CYLD by sponging miR-96-5p ."

eidos
"In LUAD cells , GMDS-AS1 acts as a ceRNA , which promotes the expression of CYLD by sponging miR-96-5p , thereby inhibiting the proliferation of tumor cells and promoting apoptosis ."

eidos
"These results indicate that GMDS-AS1 can act as a ceRNA to upregulate the expression of CYLD by sponging miR-96-5p ."

eidos
"Further studies have found that GMDS-AS1 can act as a ceRNA to upregulate the expression level of CYLD by sponging miR-96-5p , which may be one of the mechanisms in LUAD ."

eidos
"Therefore , our study revealed the mechanism by which GMDS-AS1 acts as a ceRNA to upregulate CYLD expression by sponging miR-96-5p ."

eidos
"Through various validations , we confirmed that GMDS-AS1 can act as a ceRNA to upregulate the expression of CYLD by sponging miR-96-5p ."
MiR-181b-1 affects CYLD
| 6
MiR-181b-1 activates CYLD. 6 / 6
| 6

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kappaB activity required to maintain the transformed state."

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-jB activity required to maintain the transformed state."

reach
"CYLD is directly targeted by miR-181b-1 and miR-19, which leads to inflammation and tumor progression [XREF_BIBR, XREF_BIBR]."

reach
"STAT-3 directly activates miR-21 and miR-181b-1, which inhibit PTEN and CYLD tumor suppressors, leading to increased NF-κB activity required to maintain the transformed state."

reach
"MiR-21 and miR-181b-1 respectively inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kappaB activity required to maintain the transformed state."

reach
"Taken together, these observations are consistent with a pathway in which miR-181b-1 directly targets CYLD, leading to increased NF-kappaB activity and maintenance of the inflammatory feedback loop necessary for the transformed states."
TNFRSF1A affects CYLD
3 | 2 1
3 | 2 1

No evidence text available

No evidence text available

reach
"Importantly, the recruitment of CYLD to the TNFR1 complex depended on SPATA2 (XREF_FIG D)."

sparser
"The fact that KO of SPATA2 already prevents association of CYLD with the TNFR1 ( xref D) indicates that SPATA2L cannot simply substitute for SPATA2, at least in the cellular systems tested."

No evidence text available

reach
"As shown in Fig. 3B, the recruitment and ubiquitylation of RIPK1, and the subsequent, time dependent recruitment of TRADD, SHARPIN, and CYLD to the TNFR1 complex upon the addition of TNFalpha was unchanged in the presence of primidone."
PRKCQ affects CYLD
| 6
| 6

reach
"It was recently revealed that PKCtheta, a facilitator of TCR and CD28 induced NFkappaB signaling, binds to CYLD in T cells antagonizing the DUB 's inhibition of NFkappaB and NFAT transactivation."

reach
"The formation of a direct PKCtheta and CYLD complex appears to regulate the short-term spatial distribution of CYLD, subsequently affecting NFkappaB and NFAT repressional activity of CYLD prior to its MALT1 dependent inactivation."

reach
"Interestingly, we observed increased activation of PKC-theta and NF-kappaB in CYLD deficient CD8 + T cells, suggesting that the interaction between CYLD and PKC-theta might also lead to the inhibition of PKC-theta-mediated NF-kappaB activation."

reach
"The different requirement for PKC and the altered kinetics in the mouse system led to the analysis of the stimulation dependent spatial and temporal organization of the PKCtheta and CYLD complex using immunofluorescence microscopy."

reach
"Alternatively, the existence of a constitutive CYLD and PKCtheta complex might suggest that PKCtheta, which shows activation dependent subcellular translocation, is important for removing CYLD from its NFkappaB related targets and attenuates the negative regulatory function of CYLD, enabling feedback control of NFkappaB activation."

reach
"demonstrated that PKC-theta interacts with CYLD leading to inhibition of CYLD function."
MAPRE1 affects CYLD
4 | 2
4 | 2

No evidence text available

No evidence text available

sparser
"The CYLD-EB1 interaction was confirmed both in cells and in vitro, and these 2 proteins colocalized at the plus ends of microtubules."

No evidence text available

No evidence text available

sparser
"Interestingly, the association of CYLD with EB1 was significantly increased upon the stimulation of cell migration."
Flag affects CYLD
| 6
| 6

sparser
"The result showed that Myc-p18 was detected in the Flag-CYLD immunoprecipitates (Fig. xref )."

sparser
"We found that the anti-Flag antibody, but not the anti-IgG antibody, pulled down Flag-CYLD, as well as NDRG1, from CNE2 cells."

sparser
"To further confirm the physiological interaction, Flag-CYLD and Myc-p18 were transfected into 293T cells, and co-immunoprecipitation was performed using a Flag antibody."

sparser
"In vitro , Flag-CYLD was pulled down by GST-ERK1, but not GST ( xref ), indicating that a direct interaction between CYLD and ERK1."

sparser
"To investigate which type of poly-Ub chain on p18 is cleaved by CYLD, we used 293T cells transfected with Myc-p18, Flag-CYLD, together with HA-tagged ubiquitin mutants (K6, K11, K27, K29, K33, K48, or K63)."

sparser
"The interaction of Flag-CYLD and Myc-RIP1 was taken as positive control."
CYLD affects ubiquitination
| 5
CYLD inhibits ubiquitination. 5 / 6
| 5

sparser
"In hepatic listeriosis, Cyld-deficiency increased K63-ubiquitination of STAT3, and further in vitro experiments demonstrated that CYLD inhibited K63-ubiquitination of STAT3 in the cytoplasm of IL-6-stimulated hepatocytes, which is in agreement with the exclusive cytoplasmic localisation of CYLD."

sparser
"CYLD can inhibit ubiquitination of the RIG1 cytoplasmic viral RNA sensor and also downregulate antiviral Interferon production by controlling IKK activation [ xref ]."

sparser
"CYLD inhibits Tax ubiquitination."

sparser
"Deubiquitinating enzyme CYLD inhibits NEMO linear ubiquitination, possibly by disassembling both K63-linked and linear polyubiquitin."

sparser
"In addition, CYLD also inhibits the ubiquitination of TBK1 and IKKε, which also contributes to the negative regulation of IFN responses by CYLD xref ."
CYLD affects miR-181b
| 6
CYLD activates miR-181b. 6 / 6
| 6

reach
"To determine whether CYLD is direct target of miR-181b, we engineered the 3 '-UTR fragments, in which wild-type and mutant binding sites were inserted into the region immediately downstream of the luciferase reporter gene."

reach
"Luciferase assays indicated that miR-181b can bind with its putative target site in the 3 '-untranslated region (3 '-UTR) of CYLD, suggesting that CYLD is a direct target of miR-181b."

reach
"Luciferase reporter assays revealed that CYLD is a target of miR-181b."

reach
"Luciferase assays were used to evaluate activity which CYLD is a target of miR-181b."

reach
"These results further suggest that CYLD is a target of miR-181b."

reach
"These data further support the notion that there is a positive and mutual regulation between STAT3 and miR-181b and that CYLD is a target of miR-181b."
CYLD affects localization
| 6
| 6

reach
"These observations suggest that suppression of CYLD enhances the activity of the IKK kinase and the nuclear localization of NF-kappaB transcription factors."

reach
"While the molecular mechanisms by which these proteins regulate the ciliary role of HDAC6 are elusive, our data demonstrate that HDAC6 is enriched at the centrosome and basal body and that this localization is enhanced by the loss of Cyld."

reach
"The inhibitory action of Bcl-3 nuclear translocation is executed by the tumour suppressor protein cylindromatosis (CYLD), which can bind directly to Bcl-3 and prevent its nuclear localization [XREF_BIBR]."

reach
"We further found by immunofluorescence microscopy a colocalization of CYLD and HDAC6 at the centrosome and basal body and, interestingly, loss of Cyld promoted the localization of HDAC6 at the centrosome and basal body."

reach
"Loss of CYLD in HMCLs was found to enhance β-catenin stabilization and localization to the nucleus, increase β-catenin-LEF/TCF reporter activity, and enhance MM cell growth and survival."

reach
"Interestingly, the ubiquitin ligase CYLD, which negatively regulates bcl3 nuclear localization, was increased 2.7-fold in the RNA-Seq analysis (XREF_SUPPLEMENTARY)."
CYLD affects cell cycle
| 6
CYLD inhibits cell cycle.
| 3
| 3

reach
"RNAi mediated CYLD knockdown prolongs the pro mytotic stage of cell cycle, thus suggesting a role for CYLD in the control of mitotic entry."

reach
"In the current work, we found that CYLD mainly prevents the G1/S cell cycle progression, but no significant change occurred in cyclin D or CDK4 and 6."

reach
"CYLD negatively regulates the cell cycle by inactivating HDAC6, a histone deactylase, and increases the concentration of acetylated tubulin."
CYLD activates cell cycle.
| 3
| 3

reach
"In a different study of HDAC6 and its role in tumorigenesis, it was found that CYLD mediated inhibition of HDAC6 was essential for CYLD activation and delay in the cell cycle."

reach
"The CYLD mediated deubiquitylation of certain substrates can affect different phases of the cell cycle, and ultimately, cellular proliferation.BCL3 was originally identified in a subgroup of B cell le[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The increased expression of CYLD triggers cell cycle arrest and apoptotic induction [36]."
CYLD affects TNFRSF1A
3 | 2 1
3 | 2 1

No evidence text available

No evidence text available

reach
"Importantly, the recruitment of CYLD to the TNFR1 complex depended on SPATA2 (XREF_FIG D)."

sparser
"The fact that KO of SPATA2 already prevents association of CYLD with the TNFR1 ( xref D) indicates that SPATA2L cannot simply substitute for SPATA2, at least in the cellular systems tested."

No evidence text available

reach
"As shown in Fig. 3B, the recruitment and ubiquitylation of RIPK1, and the subsequent, time dependent recruitment of TRADD, SHARPIN, and CYLD to the TNFR1 complex upon the addition of TNFalpha was unchanged in the presence of primidone."
CYLD affects RELA
| 6
CYLD inhibits RELA.
| 4
CYLD inhibits RELA. 4 / 4
| 4

reach
"CYLD reduced activation of p65, JAK2, STAT3, and p38 MAPK as well as fibrin production in livers of Listeria infected WT mice."

reach
"Moreover, transfection of p65 alone or in combination with p50 increased the 3XkappaB luciferase reporter activity to a similar extent in Cyld +/+ and Cyld -/- keratinocytes, confirming that Cyld nega[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"In the search for the tumor suppressor function of CYLD, several laboratories reported that CYLD can inhibit the activation of the classical NF-kappaB p65 and p50 transcription factor (Trompouki et al[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Based on these data, we conclude that loss of Cyld in keratinocytes does not promote the activity of the p65 and p50 NF-kappaB but rather promotes the synergistic activation of p50 and Bcl -3 or p52/B[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CYLD decreases the amount of RELA.
| 2
CYLD decreases the amount of RELA. 2 / 2
| 2

reach
"As shown in XREF_FIG, the si-miR, CYLD, si-miR + NC4 and si-miR + si-C groups exhibited significantly higher apoptotic rates, as well as increased Bax, cleaved caspase-3 and p-IkappaBalpha and IkappaBalpha expression levels, and decreased Bcl-2 and p-p65 and p65 levels compared with the BC group."

reach
"Additionally, CYLD reduced p65 expression; however, downregulation of LINC01260 slightly increased the expression level."
CYLD affects PPP2
| 1 3
CYLD binds PPP2.
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
CYLD activates PPP2.
| 1
CYLD activates PPP2. 1 / 3
| 1

reach
"Instead, CYLD interacts with protein phosphatase 2A (PP2A) and promotes the ability of PP2A to bind and dephosphorylate Aurora-B at threonine 232."
CYLD affects MYC
| 1 5
CYLD binds MYC.
| 4
| 4

sparser
"To confirm our MS findings, we transfected 293T cells with MycCyld and Flag—NLRP6 expression constructs."

sparser
"Anti-Myc immunoprecipitated Flag—NLRP6 and anti-Flag immunoprecipitated MycCyld, suggesting that Cyld and NLRP6 physically interact ( xref )."

sparser
"To test whether Cyld cleaves K48- or K63-linked ubiquitination, we coexpressed Flag—NLRP6, MycCyld and HA—UbK48 (in which all of the lysine residues within Ub except K48 were mutated to arginine) or HA—UbK63 (in which all of the lysine residues within Ub except K63 were mutated to arginine)."

sparser
"To investigate whether Cyld regulates NLRP6 via deubiquitination, we transfected 293T cells with Flag—NLRP6, MycCyld and hemagglutinin (HA)—Ub."
CYLD activates MYC.
| 1 1
CYLD activates MYC. 2 / 2
| 1 1

reach
"In agreement with the reported negative regulation of JNK and c-Myc activation by CYLD [XREF_BIBR], WB analysis of these molecules showed increased Akt, JNK and c-Myc activation (measured as levels of P-Akt, P-JNK and P-c-Myc respectively) in the skin of transgenic mice lacking the DUB function (XREF_FIG)."

sparser
"In agreement with the reported negative regulation of JNK and c-Myc activation by CYLD [ xref ], WB analysis of these molecules showed increased Akt, JNK and c-Myc activation (measured as levels of P-Akt, P-JNK and P-c-Myc respectively) in the skin of transgenic mice lacking the DUB function ( xref )."
CYLD affects MAPRE1
4 | 2
4 | 2

No evidence text available

No evidence text available

sparser
"The CYLD-EB1 interaction was confirmed both in cells and in vitro, and these 2 proteins colocalized at the plus ends of microtubules."

No evidence text available

No evidence text available

sparser
"Interestingly, the association of CYLD with EB1 was significantly increased upon the stimulation of cell migration."
CYLD affects IL4
| 6
CYLD decreases the amount of IL4.
| 4
CYLD decreases the amount of IL4. 4 / 4
| 4

reach
"CYLD-deficient Treg cells furthermore produced high levels of interleukin-4 (IL-4) and failed to suppress allergen-induced lung inflammation."

reach
"The mRNA level of Il4 was also markedly increased by the CYLD deficiency, whereas that of Ifng, Il17, or Il10 was not changed (Fig 3, B)."

reach
"Nevertheless, CYLD-deficient Treg cells still produced higher levels of IL-4 even in the presence of WT Treg cells (Fig 3, G) suggesting that CYLD directly restricted production of IL-4 in Treg cells."

reach
"As our preliminary data shows that CYLD knockdown is able to upregulate IL-4 and Scinderin expression in human Treg cells (data not shown), this indicates that CYLD may play an important role in Treg cells in humans."
CYLD inhibits IL4.
| 2
CYLD inhibits IL4. 2 / 2
| 2

reach
"IL-4 produced by CYLD-deficient Treg cells also appeared to impact conventional Th2 cells expressing type 2 cytokines such as IL-4 and IL-5, providing another mechanism to further boost type 2 immunity against helminth infection."

reach
"Strikingly, CYLD-deficient Treg cells strongly produced IL-4 protein compared to WT Treg cells that had minimal expression of IL-4 (Fig 3, A), and other cytokines were also elevated in CYLD-deficient Treg cells albeit to a lesser extent."
CYLD affects IKBKB
| 6
CYLD inhibits IKBKB. 6 / 6
| 6

reach
"We next used an alternative approach to confirm that the loss of CYLD in T cells causes the constitutive activation of IKKbeta."

reach
"However, because Cyld deficiency did not cause the activation of ERK, the target of CYLD might be an intermediate signaling factor specifically mediating the activation of JNK and IKKbeta."

reach
"Augmented CYLD activity suppressed IKKbeta which stabilized IkappaBalpha and retained NF-kappaB dimers in their inactive states in the cytosol."

reach
"Surprisingly, the loss of CYLD did not result in the basal activation of IKKbeta or Tak1 in macrophages."

reach
"These results establish a pivotal role for CYLD in controlling Tak1 function and explain how CYLD negatively regulates IKKbeta and JNK."

reach
"YM155 activated CYLD activity which led to suppressed IKKbeta activity and stabilization of inhibitory IkappaBalpha."
CYLD affects GS26575
| 6
CYLD inhibits GS26575. 6 / 6
| 6

reach
"Once recruited, CYLD limits NF-kappaB activation by removing K63 linked and M1 linked poly-Ub chains on several components of complex I, including RIPK1 [XREF_BIBR, XREF_BIBR - XREF_BIBR]."

reach
"CYLD inhibited M1 microglial activation and improved M2 microglial activation after 72 h of reperfusion."

reach
"We show here that A20 binding to M1 chains in the TNF-RSC stabilizes them, whereas CYLD antagonizes M1 chains in this complex."

reach
"CYLD, another DUB, is reported to limit NF-kappaB activation by removing K63- and M1 linked poly-ubiquitin chains on several complex I components (including TRAF2, NEMO and RIPK1), thereby disrupting the ubiquitin scaffold required for the recruitment and activation of the TAB2/3-TAK 1 and NEMO-IKKalpha-IKKbeta complexes [XREF_BIBR, XREF_BIBR - XREF_BIBR]."

reach
"Moreover, in addition to cleaving K63 ubiquitin linkages, CYLD has been shown to degrade M1 linked polyubiquitin chains from various components of the TNF-R1 and NOD2 signalling complexes, including RIP1."

reach
"Previous studies report that CYLD negatively regulates NF-kappaB signaling by removing K63- and M1 linked polyubiquitin chains from key signaling molecules, including NF-kappaB essential modulator, tumor necrosis factor (TNF)-associated factor (TRAF) 2, TRAF6, and Receptor interacting serine/threonine protein kinase 1, in familial cylindromatosis tumors."
CYLD affects Flag
| 6
| 6

sparser
"The result showed that Myc-p18 was detected in the Flag-CYLD immunoprecipitates (Fig. xref )."

sparser
"We found that the anti-Flag antibody, but not the anti-IgG antibody, pulled down Flag-CYLD, as well as NDRG1, from CNE2 cells."

sparser
"To further confirm the physiological interaction, Flag-CYLD and Myc-p18 were transfected into 293T cells, and co-immunoprecipitation was performed using a Flag antibody."

sparser
"In vitro , Flag-CYLD was pulled down by GST-ERK1, but not GST ( xref ), indicating that a direct interaction between CYLD and ERK1."

sparser
"To investigate which type of poly-Ub chain on p18 is cleaved by CYLD, we used 293T cells transfected with Myc-p18, Flag-CYLD, together with HA-tagged ubiquitin mutants (K6, K11, K27, K29, K33, K48, or K63)."

sparser
"The interaction of Flag-CYLD and Myc-RIP1 was taken as positive control."
CYLD affects Fibrin
| 6
CYLD inhibits Fibrin. 6 / 6
| 6

reach
"CYLD impairs production of fibrin in Listeria infection in mice by inhibiting NF-kB-mediated activation of IL-6 production and IL-6 's activation of the STAT3 pathway that leads to fibrosis [XREF_BIBR]."

reach
"Before, we have shown that CYLD inhibits protective fibrin production by hepatocytes in listeriosis."

reach
"In addition, in vivo Cyld siRNA treatment increased STAT3 phosphorylation, fibrin production, pathogen control and survival of Lm infected WT mice illustrating that therapeutic inhibition of CYLD augments the protective NF-kappaB/IL-6/STAT3 pathway and fibrin production."

reach
"In WT mice, IL-6 neutralization only slightly reduced pSTAT3 without affecting fibrin (XREF_FIG) indicating that IL-6 induced pSTAT3 is strongly regulated by CYLD, which limits STAT3 activity and STAT3 dependent fibrin production."

reach
"CYLD reduced activation of p65, JAK2, STAT3, and p38 MAPK as well as fibrin production in livers of Listeria infected WT mice."

reach
"The observation that siRNA mediated inhibition of CYLD in WT mice increased hepatic p-STAT3 and fibrin levels, diminished hemorrhage and significantly increased survival indicates that inhibition of CYLD might be a therapeutic option in severe listeriosis and potentially other infectious diseases including acute lung injury induced by S. pneumoniae XREF_BIBR."
CYLD affects E3_Ub_ligase
| 3 3
| 3
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
CYLD activates E3_Ub_ligase.
| 3
| 3

reach
"Thus, it is possible that CYLD functions in diverse pathways and loss of CYLD activity contributes to tumorigenesis via multiple mechanisms.Lys63-linked ubiquitin chains, synthesized in response to cy[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Additionally, CYLD interacted with FZR1 to promote APC/C-FZR1 E3 ligase activity, which further ubiquitinated and degraded PFKFB3 via the 26S proteasomal system."

reach
"Lim and co-workers showed that CYLD suppresses TGF-beta signalling and prevents lung fibrosis by (indirectly) reducing the stability of Smad3, in an AKT, GSK3beta and E3 ligase carboxy terminus of Hsc[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CYLD affects DUSP1
| 5
CYLD activates DUSP1. 5 / 6
| 5

reach
"Having shown that CYLD negatively regulates NTHi induced IL-8 expression via the inhibition of ERK and positively regulates MKP-1, we next investigated whether CYLD acts as a negative regulator for ERK dependent IL-8 induction via MKP-1."

reach
"CYLD also enhanced NTHi induced upregulation of MAP kinase phosphatase-1, which led to reduced ERK activation and subsequent suppression of IL-8."

reach
"Therefore, investigating the molecular mechanisms of how CYLD upregulates MKP-1 may bring new insights into the tight regulation of inflammatory responses."

reach
"Taken together, our data suggest that CYLD mediates NTHi induced upregulation of MKP-1."

reach
"Because CYLD has been identified as a DUB, we investigated whether DUB activity is required for the CYLD mediated upregulation of MKP-1 induced by NTHi."
CYLD affects CEP350
2 | 2 1
2 | 2 1

reach
"To understand the functional interaction between CYLD and CAP350, we studied mice carrying deletion of part of the deubiquitinase domain and mimicking the human pathology."
| PMC

sparser
"To understand the functional interaction between CYLD and CAP350, we studied mice carrying deletion of part of the deubiquitinase domain and mimicking the human pathology."
| PMC

reach
"In transgenic mice engineered to mimic the smallest truncation found in cylindromatosis patients, CYLD interaction with CAP350 is lost disrupting CYLD centrosome localization, which results in cilia formation defects due to impairment of basal body migration and docking."

No evidence text available

No evidence text available
CYLD affects ARHGEF12
1 1 | 3 1
CYLD deubiquitinates ARHGEF12.
1 | 2
CYLD deubiquitinates ARHGEF12. 3 / 3
1 | 2

"Mechanistically, CYLD does not interact with RhoA; instead, it interacts with and deubiquitinates leukemia-associated RhoGEF (LARG)."

reach
"In the present study, we show that CYLD deubiquitinates LARG, thus adding LARG to the growing list of CYLD substrates."

reach
"Taken together, our data provide the first evidence that CYLD deubiquitinates LARG and increases its ability to catalyze the GDP/GTP exchange on RhoA."
CYLD binds ARHGEF12.
1 | 1 1
1 | 1 1

sparser
"In addition, we found that endogenous CYLD associated with endogenous LARG, but not with endogenous p115RhoGEF or PDZ-RhoGEF ( xref ), demonstrating a specific interaction between CYLD and LARG."

reach
"In addition, we found that endogenous CYLD associated with endogenous LARG, but not with endogenous p115RhoGEF or PDZ-RhoGEF (XREF_FIG), demonstrating a specific interaction between CYLD and LARG."

No evidence text available
CEP350 affects CYLD
2 | 2 1
2 | 2 1

reach
"To understand the functional interaction between CYLD and CAP350, we studied mice carrying deletion of part of the deubiquitinase domain and mimicking the human pathology."
| PMC

sparser
"To understand the functional interaction between CYLD and CAP350, we studied mice carrying deletion of part of the deubiquitinase domain and mimicking the human pathology."
| PMC

reach
"In transgenic mice engineered to mimic the smallest truncation found in cylindromatosis patients, CYLD interaction with CAP350 is lost disrupting CYLD centrosome localization, which results in cilia formation defects due to impairment of basal body migration and docking."

No evidence text available

No evidence text available
Microtubule affects CYLD
| 1

sparser
"To further assess whether the catalytic activity and/or HDAC6 and MT binding of CYLD are necessary to induce a delay in the cell cycle, we analysed the duration of the cell cycle in melanoma cells expressing full-length CYLD, catalytically inactive CYLD C/S , and a deletion mutant that lacks the first CAP-Gly domains (CYLD 222–956 ) and does not bind HDAC6."
Glucose affects CYLD
| 5
Glucose decreases the amount of CYLD. 5 / 5
| 5

reach
"In the present study, we found that high glucose dose- and time-dependently downregulated the protein and mRNA expressions of CYLD in GMCs (SV40 MES 13 and HBZY-1) and increased the expression levels of p-IkappaBalpha, NF-kappaBp65, and p-NF-kappaBp65, and furthermore induced the release of MCP-1, IL-6, and IL-8."

reach
"Our data showed that high glucose significantly inhibited the protein and mRNA expression of CYLD in a dose- and time dependent manner (both p < 0.05)."

reach
"High Glucose Inhibits the Expression of CYLD in GMCs."

reach
"In conclusion, the present study found that high glucose significantly inhibited the expression of CYLD and activated NF-kappaB inflammatory signaling in a dose- and time dependent manner."

reach
"These data suggest that high glucose inhibited CYLD expression in GMCs (SV40 MES 13 and HBZY-1) in a time- and dose dependent manner."
TLR4 affects CYLD
| 5
TLR4 activates CYLD. 5 / 5
| 5

reach
"Cleavage of CYLD induced by TLR4 stimulation was not affected in the Myd88 -/- BMDMs (XREF_FIG), but was abrogated in the Trif -/- BMDMs (XREF_FIG), indicating that CASPASE-8 activation was dependent on TRIF."

reach
"The LPS induced TLR-4 ligation recruits FADD and caspase-8 in a complex and initiates the cleavage of CYLD."

reach
"The LPS induced TLR-4 ligation recruits FADD and caspase-8 in a complex and initiates the cleavage of CYLD (Legarda et al., 2016) ."
| DOI

reach
"One the other side, TLR4 activates caspase-8 in a TNF-independent manner and promotes so the “inactivating” cleavage of the deubiquitinase Cyld (Legarda et al., 2016; Figure 4)."

reach
"The Pseudomonas aeruginosa HSP90 like protein HtpG regulates IL-8 expression through NF-kappaB and p38 MAPK and CYLD signaling triggered by TLR4 and CD91."
SPATA2L affects CYLD
2 | 1 2
2 | 1 2

No evidence text available

sparser
"We found that Spata2L constitutively interacts with CYLD and that the deficiency of Spata2L enhances the LPS-induced NF-κB activation and proinflammatory cytokine gene expression."

No evidence text available

reach
"In addition to SPATA2, SPATA2L also interacts with CYLD in cells (XREF_FIG E; XREF_SUPPLEMENTARY) and may regulate other aspects of CYLD function."

sparser
"In addition to SPATA2, SPATA2L also interacts with CYLD in cells ( xref ) ( xref E; xref ) and may regulate other aspects of CYLD function."
NFE2L2 affects CYLD
| 2 3
| 2 3

reach
"Co-immunoprecipitation experiments (Co-IP) were used to analyse the interaction between CYLD and Nrf2 in ORN."

sparser
"Nrf2 directly bound to CYLD and was ubiquitinated in ORN cells."

reach
"Nrf2 directly bound to CYLD and was ubiquitinated in ORN cells."

sparser
"Co-immunoprecipitation experiments (Co-IP) were used to analyse the interaction between CYLD and Nrf2 in ORN."

sparser
"However, the expression of USP4 is decreased in failing human heart as well as in experimental animals with pathological hypertrophy. xref Similarly, CYLD prevents activation and recruitment of TAKl by cleaving the K63 polyubiquitin chain of TRAF2,TRAF6 and NEMO (Figure  xref ), which leads to inactivation of IKK and suppression of downstream of NF‐κB pathway. xref , xref Similarly, the ubiquitination of TRAF‐binding protein (TRIP) is required for the activation of TNFα‐induced NF‐κB. This signalling pathway is controlled by CYLD‐dependent removal of K63‐linked ubiquitination chains of TRIP, which leads to attenuation of TNFα‐dependent NF‐κB signalling. xref CYLDNrf2 axis plays a key role in the cardiac remodelling."
LCK affects CYLD
| 2 2
| 2 2

reach
"CYLD physically interacts with LCK and facilitates the binding of active LCK to its target ZAP-70, thereby enhancing the TCR induced tyrosine phosphorylation of ZAP-70."

reach
"CYLD physically interacted with active Lck and promoted recruitment of active Lck to its substrate, Zap70."

sparser
"Notably, CYLD selectively interacts with the active form of LCK."

sparser
"CYLD physically interacted with active Lck and promoted recruitment of active Lck to its substrate, Zap70."
IL18 affects CYLD
| 5
IL18 activates CYLD.
| 3
IL18 activates CYLD. 3 / 3
| 3

reach
"Moreover, injection of recombinant IL-18 rescued Nlrp6 -/- and Cyld -/- Nlrp6 -/- mice (XREF_SUPPLEMENTARY - XREF_SUPPLEMENTARY) but not Cyld -/- mice from body weight loss and diarrhea (XREF_FIG, XREF_FIG)."

reach
"Examination of colon length and histological analysis further suggested that injection of recombinant IL-18 rescues Il18 -/- and Cyld -/- Il18 -/- mice but not Cyld -/- mice (XREF_FIG - XREF_FIG)."

reach
"Injection of IL-18 rescued Il18 -/- and Cyld -/- Il18 -/- mice but not Cyld -/- mice from body weight loss and diarrhea (XREF_FIG, XREF_FIG)."
IL18 inhibits CYLD.
| 2
IL18 inhibits CYLD. 2 / 2
| 2

reach
"To further investigate this hypothesis, we tested whether deletion of one allele of either Il18 or Nlrp6 could rescue Cyld -/- mice from colitis severity."

reach
"To investigate whether genetic deletion of Il18 would rescue Cyld -/- mice from severe colitis, we crossed Cyld -/- mice with Il18 -/- mice and generated Cyld -/- Il18 -/- mice."
IKK_family affects CYLD
| 4 1
IKK_family phosphorylates CYLD. 5 / 5
| 4 1

reach
"Based on these prior reports and the data obtained thus far with the MT4 cells, we hypothesized that TAX activation of IKK family of kinases induces the phosphorylation of CYLD to suppress its deubiquitinating activity."

reach
"IKK family kinases phosphorylate CYLD in the ATLL MT4 cell line."

reach
"It is likely that the IKK family phosphorylates multiple targets including RIPK1 and CYLD, all with the goal of inhibiting RIPK1-mediated cell death.To understand further the role that CYLD phosphorylation may be playing in ATLL pathogenesis, we analyzed this modification in HTLV-1 transformed T-cell lines, representative of ATLL, as well as in primary human ATLL samples."

reach
"We now report that phosphorylation of CYLD by IKK family kinases in HTLV-1 transformed T cells inhibits RIPK1 from activating the cell death pathway and inhibiting these kinases reactivates CYLD and RIPK1-dependent tumor cell death."

sparser
"TNFα stimulation has also been shown to lead to phosphorylation of A20 and CYLD by IKK complex as well as activation of p38 xref – xref ."
HES1 affects CYLD
| 3 2
HES1 decreases the amount of CYLD.
| 3
HES1 decreases the amount of CYLD. 3 / 3
| 3

reach
"Hes1, which is downstream of Notch signalling, can inhibit the transcription of the deubiquitinase CYLD, which negatively regulates IKK [44]."

reach
"A previous study found that Notch stimulates NF-κB activation by initiating the transcription of Hes1, which then suppresses the expression of CYLD, a negative regulator of IKK activity in T-ALL cells [23]; however, this finding does not rule out the possibility that other mechanisms co-exist."

reach
"KBP activated the Notch signalling pathway to upregulate Hes1, which inhibited the expression of CYLD to activate the phosphorylation of IKK in macrophages."
HES1 binds CYLD.
| 2
CYLD binds HES1. 2 / 2
| 2

sparser
"Using a conventional ChIP assay in human Hes1 + T-ALL cells and a Hes1 antibody followed by PCR with specific primers flanking the identified putative N-box sites, we were able to show that endogenous Hes1 binds to the predicted PRO2 site in the CYLD 5’UTR ( xref ) and this association was lost following Hes1 knock-down ( xref ) as measured by qPCR."

sparser
"Endogenous Hes1 protein could bind the CYLD promoter in T-ALL cells, and the CYLD expression levels were found to be significantly decreased in most human primary T-ALL samples analyzed."
DVL affects CYLD
| 3 2
| 3 2

sparser
"For instance, CYLD interacts with Dishevelled (DVL) and counteracts its K63-linked ubiquitination, leading to inhibition of this cytoplasmic effector in the Wnt/β-catenin pathway ( xref )."

reach
"The deubiquitinating enzyme CYLD binds to and deubiquinates Dvl, inhibiting the signaling activity of Dvl and the activation of the Wnt pathway."

sparser
"At the molecular level, we show that CYLD interacts with Dvl and regulates K63-linked ubiquitination of the polymerization-prone DIX domain of Dvl."

reach
"CYLD interacts with Dvl and edits its ubiquitin chains, supporting a model in which the effect of CYLD on Wnt signaling is mediated by CYLD dependent deubiquitination of Dvl.How does Dvl function depe[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"XREF_BIBR - XREF_BIBR In addition, the deubiquitinating enzymes USP34 and USP7, CYLD and USP9X and USP4 can bind to Axin, Dvl and beta-catenin, respectively, thereby promoting the nuclear localization of beta-catenin and the Wnt signaling pathway by inhibiting their ubiquitination."
CYLD affects response
| 1 4
CYLD inhibits response. 5 / 5
| 1 4

sparser
"It is possible that CYLD may inhibit Akt-mediated fibrotic response by actually deubiquitinating TRAF6."

sparser
"As shown in xref , CYLD knockdown, using siCYLD, still enhanced TGF-β-induced fibrotic response in TRAF6-depleted cells, thereby suggesting that CYLD inhibits Akt-mediated fibrotic response at least in part by directly interacting with and deubiquitinating Akt."

sparser
"Thus, we next explored the possibility that CYLD may inhibit Akt-mediated fibrotic response via deubiquitinating TRAF6."

sparser
"Nonetheless, these data demonstrate that CYLD indeed inhibits Akt-mediated fibrotic response by at least in part directly interacting with and deubiquitinating Akt."

eidos
"For example , CYLD removes polyubiquitin chains from TBK1 and RIG-I and thus inhibits the IRF3 signaling pathway and IFN production triggered by RIG-I ; conversely , CYLD knockdown enhances this response ( 58 ) ."

reach
"CYLD Impairs Production of Cytokines, ROS, and NO and Reduces Activation of NF-kappaB, ERK1/2, and p38MAPK in Lm Infected BMDM."

reach
"Here, we also demonstrate that CYLD also inhibits ERK1/2 dependent ROS production."

reach
"CYLD reduced IL-6, ROS production and killing of Lm in Listeria infected macrophages by impairing NF-kappaB activation."
| 1 1

reach
"RNAi mediated silencing of CYLD attenuates ROS production and TNF induced programmed necrosis [XREF_BIBR]."

eidos
"An IKK inhibitor reduced lipid deposition , ROS production , CYLD phosphorylation levels and DeltaPsim in vitro , which were reversed by knockdown of CYLD ."
CYLD affects migration
| 3
CYLD activates migration.
| 1
CYLD activates migration. 1 / 3
| 1

eidos
"Deubiquitinase cylindromatosis ( CYLD ) has been reported to significantly aggravate vascular smooth muscle cell ( VSMC ) phenotypic transformation , proliferation , and migration ."
CYLD inhibits migration.
| 2
CYLD inhibits migration. 2 / 2
| 2

eidos
"Functional assays revealed CYLD inhibits NPC cell proliferation and migration in vitro and suppresses NPC tumorigenicity and metastasis in vivo by negatively regulating the NF-kB signaling pathway ."

eidos
"Loss of CYLD stimulates cellular proliferation , migration , and invasion by triggering BCL-3 nucleus translocation and activation of cyclin D1 and N-cadherin [ 99 ] ."
| PMC
CYLD affects microtubule
| 1

sparser
"To further assess whether the catalytic activity and/or HDAC6 and MT binding of CYLD are necessary to induce a delay in the cell cycle, we analysed the duration of the cell cycle in melanoma cells expressing full-length CYLD, catalytically inactive CYLD C/S , and a deletion mutant that lacks the first CAP-Gly domains (CYLD 222–956 ) and does not bind HDAC6."
CYLD affects expression
| 5
CYLD inhibits expression. 5 / 5
| 5

sparser
"Furthermore, EAC also inhibited the TNF-alpha-activated NF-kappaB-dependent reporter gene expression of MMP-9 and VEGF, and the invasion of cancer cells."

sparser
"But in these cells, CYLD also inhibited the expression of N-cadherin, a protein known to promote tumor spread."
| PMC

sparser
"In this study, we provided evidence to show that CYLD inhibits PAI-1 expression probably through directly interacting with and deubiquitinating TRAF-6."

sparser
"Lim et al. xref demonstrated that the deubiquitinating enzyme (DUB) CYLD inhibited p38 kinase-dependent expression of plasminogen activator inhibitor (PAI)-1 in murine lethal Streptococcus pneumoniae pneumonia."

sparser
"p-induced PAI-1 expression, and CYLD inhibits PAI-1 expression probably through deubiquitinating TRAF-6."
CYLD affects beta1-integrin
| 5
CYLD inhibits beta1-integrin. 5 / 5
| 5

reach
"At the molecular level, CYLD decreased beta1-integrin and inhibited pJNK induction by tumor necrosis factor-alpha or cell attachment to collagen IV."

reach
"Beta1-integrin and pJNK are downregulated by CYLD and display crosstalk."

reach
"At the molecular level, CYLD decreased beta1-integrin and inhibited pJNK induction by TNFalpha or cell-attachment to collagen IV."

reach
"We showed that CYLD downregulated beta1-integrin at a transcriptional level via suppression of AP-1 function."

reach
"Exogenous expression of CYLD downregulated beta1-integrin at both protein and mRNA levels as shown by RT-PCR and immunoblotting, respectively (XREF_FIG)."
CYLD affects TUBA
| 5
CYLD leads to the acetylation of TUBA. 5 / 5
| 5

reach
"As expected, only the CYLD 1-212 fragment, which mediates the association of CYLD with HDAC6 (XREF_FIG), was able to inhibit HDAC6 activity and subsequent alpha-tubulin deacetylation (XREF_FIG)."

reach
"CYLD also induces the acetylation of alpha-tubulin by inhibiting HDAC6 and thus counteracts the depolymerization of microtubules leading to an overall stabilization of the microtubule network [XREF_BIBR]."

reach
"CYLD C/S increased the acetylation of alpha-tubulin to the same extent as with full-length, wild-type CYLD (XREF_FIG), indicating that the UCH domain of CYLD is not required for alpha-tubulin acetylation."

reach
"As CYLD associates with MTs and colocalizes specifically with acetylated MTs, we hypothesized that CYLD might directly regulate alpha-tubulin acetylation to control its own localization."

reach
"CYLD induces acetylation of alpha-tubulin and stabilization of MTs."
CYLD affects SPATA2L
2 | 1 2
2 | 1 2

No evidence text available

sparser
"We found that Spata2L constitutively interacts with CYLD and that the deficiency of Spata2L enhances the LPS-induced NF-κB activation and proinflammatory cytokine gene expression."

No evidence text available

reach
"In addition to SPATA2, SPATA2L also interacts with CYLD in cells (XREF_FIG E; XREF_SUPPLEMENTARY) and may regulate other aspects of CYLD function."

sparser
"In addition to SPATA2, SPATA2L also interacts with CYLD in cells ( xref ) ( xref E; xref ) and may regulate other aspects of CYLD function."
CYLD affects NFE2L2
| 2 3
| 2 3

reach
"Co-immunoprecipitation experiments (Co-IP) were used to analyse the interaction between CYLD and Nrf2 in ORN."

sparser
"Nrf2 directly bound to CYLD and was ubiquitinated in ORN cells."

reach
"Nrf2 directly bound to CYLD and was ubiquitinated in ORN cells."

sparser
"Co-immunoprecipitation experiments (Co-IP) were used to analyse the interaction between CYLD and Nrf2 in ORN."

sparser
"However, the expression of USP4 is decreased in failing human heart as well as in experimental animals with pathological hypertrophy. xref Similarly, CYLD prevents activation and recruitment of TAKl by cleaving the K63 polyubiquitin chain of TRAF2,TRAF6 and NEMO (Figure  xref ), which leads to inactivation of IKK and suppression of downstream of NF‐κB pathway. xref , xref Similarly, the ubiquitination of TRAF‐binding protein (TRIP) is required for the activation of TNFα‐induced NF‐κB. This signalling pathway is controlled by CYLD‐dependent removal of K63‐linked ubiquitination chains of TRIP, which leads to attenuation of TNFα‐dependent NF‐κB signalling. xref CYLDNrf2 axis plays a key role in the cardiac remodelling."
CYLD affects MTOR
| 1 4
CYLD activates MTOR.
| 1 2
CYLD activates MTOR. 3 / 3
| 1 2

reach
"By providing evidence that CYLD can modulate mechanistic target of rapamycin (mTOR) signaling and autophagy at the synapse, we propose that synaptic K63-linked ubiquitination processes could be fundamental in understanding the pathomechanisms underlying autism spectrum disorder."

reach
"The K63 deubiquitinase CYLD modulates autism-like behaviors and hippocampal plasticity by regulating autophagy and mTOR signaling."

eidos
"By providing evidence that CYLD can modulate mechanistic target of rapamycin ( mTOR ) signaling and autophagy at the synapse , we propose that synaptic K63-linked ubiquitination processes could be fundamental in understanding the pathomechanisms underlying autism spectrum disorder ."
CYLD inhibits MTOR.
| 2
CYLD inhibits MTOR. 2 / 2
| 2

reach
"In search of underlying molecular mechanisms, we find that CYLD knockout mice display marked overactivation of Akt and mTOR and reduced autophagic flux, and conversely, CYLD overexpression potently suppresses Akt and mTOR activity and promotes autophagy."

reach
"CYLD inactivates mechanistic target of rapamycin complex 1 (mTORC1) reactivation, upregulates Ras genes from rat brain 7 (Rab7) and enhances cardiomyocyte death in pressure overloaded hearts.."
CREB1 affects CYLD
5 |
CREB1 decreases the amount of CYLD. 5 / 5
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
BTK inhibitor affects CYLD
| 5
BTK inhibitor inhibits CYLD.
| 3
BTK inhibitor inhibits CYLD. 3 / 3
| 3

reach
"Previous researches in CLL indicated that BTK inhibitor ibrutinib could largely increase CYLD activity through increasing CYLD miRNA transcription, which could inhibit cells proliferation in CLL [XREF_BIBR]."

reach
"To sum up, these results indicated that BTK inhibitor promoted CYLD dependent apoptosis in rituximab resistant non-GCB-DLBCL cells."

reach
"BTK inhibitor PCI-32765 promoted CYLD dependent apoptosis in rituximab resistant non-GCB-DLBCL cells."
BTK inhibitor phosphorylates CYLD.
| 2
BTK inhibitor leads to the phosphorylation of CYLD. 2 / 2
| 2

reach
"But in OCI-Ly10R cells, BTK inhibitor PCI-32765 but not rituximab could reduce CYLD phosphorylation and induce apoptosis."

reach
"BTK inhibitor ibrutinib down-regulated CYLD phosphorylation and inhibited tumor growth in xeograft mice model."
MiR-362-5p affects CYLD
| 4
MiR-362-5p decreases the amount of CYLD.
| 2
MiR-362-5p decreases the amount of CYLD. 2 / 2
| 2

reach
"Because NF-kappaB has been proven to play critical roles in the regulation of NK cell activity and cytokine production XREF_BIBR XREF_BIBR XREF_BIBR XREF_BIBR, we hypothesized that miR-362-5p might inhibit CYLD expression to induce downstream NF-kappaB signaling, thereby regulating NK cell function."

reach
"Studies found that miR-362-5p reduces the expression of tumor suppressor protein CYLD, which leads to activate the NF-kB pathway to promote the proliferation, migration, and invasion of hepatocellular carcinoma cells and human breast cancer cells (Ni et al., 2015; Ni et al., 2016)."
MiR-362-5p activates CYLD.
| 2
MiR-362-5p activates CYLD. 2 / 2
| 2

reach
"Collectively, the above results suggest that miR-362-5p directly targets CYLD in human NK cells."

reach
"Ni et al. 173 demonstrated that miR-362-5p, which is frequently upregulated in HCC, promoted NF-kappaB signaling by downregulating CYLD; CYLD is a protein that binds to NF-kappaB essential modulator and functions as a negative regulator of NF-kappaB signaling 213."
MiR-19 affects CYLD
| 1 3
MiR-19 inhibits CYLD. 4 / 4
| 1 3

reach
"Furthermore, we discovered miR-19 inhibits CYLD in T-ALL for the first time."

reach
"MicroRNA and transcription factor co-regulatory network analysis reveals miR-19 inhibits CYLD in T-cell acute lymphoblastic leukemia."

reach
"For example, Ye et al. found that miR-19 inhibited CYLD in T-cell acute lymphoblastic leukemia using identified FFLs [XREF_BIBR]."

eidos
"Much efforts have been devoted to detect miRNA-TF FFLs , which were used to dissect potential regulatory mechanisms underlying human diseases.12 , 13 On the one hand , started from disease-related molecules and different regulatory relationships amongst miRNAs , genes and TFs , Ye et al14 revealed that miR-19 inhibited CYLD through the identified disrupted FFLs in T-cell acute lymphoblastic leukaemia ."
MiR-130b affects CYLD
| 4
MiR-130b decreases the amount of CYLD. 4 / 4
| 4

reach
"Thirdly, in J82 and Dox and T24 and Dox cells, western blot proved that miR-130b remarkably reduced the expression of CYLD protein (XREF_FIG)."

reach
"MiR-130b inhibited CYLD expression and activated NF-kappaB signaling."

reach
"In this study, we demonstrated that miR-130b suppressed CYLD expression at both the mRNA and protein levels."

reach
"Thus, the present study revealed that, in bladder cancer, NF-kappaB can maintain its activity by establishing a feedback loop, in which NF-kappaB induced the expression of miR-130b, which consequently inhibited the expression of CYLD, which in turn was an endogenous inhibitor of NF-kappaB activation."
4 |
Hsa-miR-362-5p decreases the amount of CYLD. 4 / 4
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
Trim14 affects RNF31
| 4
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
TUBA1A affects CYLD
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
TCR affects CYLD
| 4
TCR phosphorylates CYLD. 4 / 4
| 4

sparser
"Treatment with MRT67307, a small compound inhibitor for IKKε and TBK1, inhibited TCR-induced CYLD phosphorylation."

sparser
"Together, these results suggest that TCR-induced CYLD phosphorylation is independent of IKKε."

sparser
"These findings not only forced us to reevaluate our findings on TCR-induced CYLD phosphorylation, they also imply that one should be very cautious with the interpretation of several published findings using the phospho(Ser418)-CYLD antibody (Table xref )."

sparser
"However, the phospho(Ser418)-CYLD immunoreactive band was still present in CRISPR/Cas9 generated IKKε/TBK1 double knockout cell lines, where it could still be prevented by MRT67307, indicating that the initially observed inhibitory effect of MRT67307 on TCR-induced CYLD phosphorylation is IKKε/TBK1-independent."
TBK1 affects OPTN
| 3 1
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
Snail1 affects CYLD
| 4
Snail1 inhibits CYLD. 4 / 4
| 4

reach
"Since the expression of CYLD is transcriptionally repressed by Snail1 22, and downregulation of CYLD results in an increase in RIP1 in melanoma cells, we examined whether ERK1/2 mediated expression of RIP1 is related to suppression of CYLD by Snail1."

reach
"Clinical relevance of Snail1 induced CYLD repression."

reach
"Our findings indicate that after malignant transformation, constitutively high ERK activity and Snail1 expression allow melanoma cells to permanently exploit transcriptional repression of CYLD and activation of BCL-3 to acquire a more aggressive phenotype."

reach
"Conversely, transient transfection of a Snail1 expression construct completely repressed CYLD promoter activity (XREF_FIG)."
STAT1 affects CYLD
| 1 3
| 1 3

sparser
"To study how CYLD reduces STAT1 activation and nuclear accumulation in IFN-γ-stimulated Lm-infected BMDM, we analyzed whether CYLD might directly bind to STAT1."

sparser
"In accordance with the CYLD-independent activation of STAT1 by IFN-γ, we could not detect a direct interaction of CYLD with STAT1."

reach
"To study how CYLD reduces STAT1 activation and nuclear accumulation in IFN-gamma-stimulated Lm infected BMDM, we analyzed whether CYLD might directly bind to STAT1."

sparser
"However, immunoprecipitation experiments showed that CYLD and STAT1 did not interact with each other (data not shown)."
SPATA2 affects RNF31
| 1 3
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
SPATA2 affects PUB domain
| 4
SPATA2 binds CYLD and PUB domain. 4 / 4
| 4

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

reach
"SPATA2 interacts with CYLD through its non canonical PUB domain, which binds the catalytic CYLD USP domain in a CYLD B-box-dependent manner."

reach
"The strongest effect on CYLD binding was observed when we mutated Tyr114, which points away from the PIM pocket (XREF_FIG E and 2G), supporting that CYLD binds the SPATA2 PUB domain in a PIM independent manner."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."
SPATA2 affects OTULIN
| 4
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
SORBS1 affects CYLD
| 4
| 4

sparser
"The CAP-Gly domain of CYLD associates with the proline-rich sequence in NEMO/IKKgamma."

sparser
"From this study, we conclude that the CAP-Gly domain of CYLD associates with the proline-rich sequence of NEMO/IKKγ."

sparser
"Crystal structures show that the third CAP-Gly domain of CYLD interacts with one of the two proline-rich sequences in NEMO ."

sparser
"Here we report that the third CAP-Gly domain of CYLD specifically interacts with one of the two proline-rich sequences of NEMO/IKKgamma."
SHARPIN affects CYLD
3 | 1
3 | 1

No evidence text available

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

No evidence text available

No evidence text available
RNF31 affects Trim14
| 4
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
RNF31 affects SPATA2
| 1 3
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
PUB domain affects SPATA2
| 4
SPATA2 binds CYLD and PUB domain. 4 / 4
| 4

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

reach
"SPATA2 interacts with CYLD through its non canonical PUB domain, which binds the catalytic CYLD USP domain in a CYLD B-box-dependent manner."

reach
"The strongest effect on CYLD binding was observed when we mutated Tyr114, which points away from the PIM pocket (XREF_FIG E and 2G), supporting that CYLD binds the SPATA2 PUB domain in a PIM independent manner."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."
PLK1 affects CYLD
2 | 1 1
2 | 1 1

sparser
"CYLD physically interacts with polo-like kinase 1 (Plk1), a serine/threonine kinase with a key regulatory role in mitotic cell division. xref It was proposed that CYLD positively regulates the function of Plk1, probably by deconjugating K63-linked ubiquitin chains on Plk1 or its upstream regulators. xref However, as the role of K63 ubiquitination in Plk1 regulation has not been established, further studies are required to understand how CYLD regulates mitosis."

No evidence text available

reach
"CYLD physically interacts with polo like kinase 1 (Plk1), a serine/threonine kinase with a key regulatory role in mitotic cell division."

No evidence text available
OTULIN affects SPATA2
| 4
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
OPTN affects TBK1
| 3 1
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
N-methyl-D-aspartic acid phosphorylates CYLD.
| 1 1
N-methyl-D-aspartic acid leads to the phosphorylation of CYLD. 2 / 2
| 1 1

reach
"NMDA treatment further promoted phosphorylation of CYLD at the PSD, but IKK16 failed to block the NMDA induced effect."

sparser
"Interestingly, pre-incubation of hippocampal cultures with IKK16 neither reduced NMDA-induced CYLD phosphorylation ( xref ) nor prevented recruitment of more CYLD to the PSD ( xref )."

reach
"It had previously been shown that NMDA also causes a net increase in CYLD labeling at the PSD [XREF_BIBR]."

reach
"Previous work indicated that activation and or accumulation of CaMKII at the PSD is necessary for NMDA induced redistribution of two other PSD components, SynGAP [XREF_BIBR], a small G protein regulator, and CYLD [XREF_BIBR], a deubiquitinase."

reach
"Here we could show that 5 muM MRT67307 completely prevented CYLD phosphorylation, while 1 or 2 muM reduced the phospho (Ser418)-CYLD signal only partially."

reach
"Moreover, CYLD phosphorylation was still inhibited by MRT67307 in IKKepsilon deficient cells."

reach
"Our observation that MRT67307 inhibits CYLD phosphorylation in IKKepsilon and TBK1 deficient cells indicates a role for other MRT67307 sensitive kinases in TCR signaling."

reach
"MRT67307 significantly decreased CYLD phosphorylation in wild-type cells."
MYC affects CYLD
| 4
| 4

sparser
"To confirm our MS findings, we transfected 293T cells with MycCyld and Flag—NLRP6 expression constructs."

sparser
"Anti-Myc immunoprecipitated Flag—NLRP6 and anti-Flag immunoprecipitated MycCyld, suggesting that Cyld and NLRP6 physically interact ( xref )."

sparser
"To test whether Cyld cleaves K48- or K63-linked ubiquitination, we coexpressed Flag—NLRP6, MycCyld and HA—UbK48 (in which all of the lysine residues within Ub except K48 were mutated to arginine) or HA—UbK63 (in which all of the lysine residues within Ub except K63 were mutated to arginine)."

sparser
"To investigate whether Cyld regulates NLRP6 via deubiquitination, we transfected 293T cells with Flag—NLRP6, MycCyld and hemagglutinin (HA)—Ub."
MRLN affects CYLD
| 4
| 4

reach
"These data reveal a direct, LUBAC-independent but OTULIN-dependent binding of M1-Ub to CYLD."

reach
"We identified no Gly-Gly ubiquitination signature sites on CYLD by proteomic approaches, suggesting that the posttranslational modification is not ubiquitination itself and that the binding of CYLD to M1-Ub is non-covalent."

reach
"The detection of CYLD bound to M1-Ub reveals another, LUBAC-independent, layer of crosstalk between the two deubiquitinases."

reach
"We confirmed the specific binding of CYLD to M1-Ub in an OTULIN gene-dosage dependent manner (Figure 5D, S5I)."
Cyclin affects CYLD
| 4
Cyclin activates CYLD. 4 / 4
| 4

reach
"Interestingly, TPA also triggered the recruitment of p50 or p52, but not p65, to the cyclin D1 promoter in Cyld -/- keratinocytes."

reach
"TNF-alpha treatment failed to activate the cyclin D1 promoter in Cyld +/+ as well as Cyld -/- keratinocytes, consistent with the inability of TNF-alpha to stimulate keratinocyte proliferation."

reach
"Importantly, the increased cyclin D1 promoter activity in Cyld -/- keratinocytes was normalized after re-expression of Cyld and completely abolished in the absence of a functional NF-kappaB binding si[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"The increased cyclin D1 activation in Cyld -/- keratinocytes was normalized upon reintroduction of the Cyld protein."
CYLD affects production
| 4
CYLD inhibits production. 4 / 4
| 4

sparser
"Here, we also demonstrate that CYLD also inhibits ERK1/2-dependent ROS production."

sparser
"Before, we have shown that CYLD inhibits protective fibrin production by hepatocytes in listeriosis ( xref )."

sparser
"The study results showed that 1) EAC inhibited the macrophage NO production in vivo and reprogrammed macrophages towards the M2 phenotype; 2) ascitic fluid of mice with EAC inhibited the macrophage NO production in vitro and reprogrammed macrophages towards the M2 phenotype; and 3) injection of in vitro reprogrammed M1 macrophages into mice with EAC significantly increased the lifespan of mice."

sparser
"Previously, we have shown that CYLD inhibits IL-6 production by macrophages, which in turn induces STAT3-dependent protective fibrin production by hepatocytes in listeriosis ( xref )."
CYLD affects polyubiquitination
| 3
CYLD inhibits polyubiquitination. 3 / 4
| 3

sparser
"Importantly, the Lys-63-linked polyubiquitination of transfected Smad7 was effectively inhibited by wild type CYLD, but not by mutant CYLD lacking enzyme activity ( xref C )."

sparser
"CYLD does not inhibit TAK1/TAB1 co-overexpression-induced TAK1 polyubiquitination."

sparser
"Conversely, the PB1 domain of p62 also interacts with CYLD, a deubiquitinase, which inhibits TRAF6 polyubiquitination and serves as a negative regulator for RANK-mediated NF-κB activation and osteoclastogenesis xref ."
CYLD affects miR-362-5p
| 4
CYLD activates miR-362-5p. 4 / 4
| 4

reach
"Mechanistic investigations confirmed that the tumor suppressor gene CYLD is a direct target of miR-362-5p."

reach
"CYLD, a negative regulator of NF-kappaB signaling, is a target of miR-362-5p in NK cells."

reach
"We also demonstrated that CYLD, a negative regulator of NF-kappaB signaling, was a target of miR-362-5p in NK cells."

reach
"Because NF-kappaB signaling is important in NK cell function XREF_BIBR XREF_BIBR XREF_BIBR and because CYLD is a direct target of miR-362-5p, we hypothesized that miR-362-5p likely regulates human NK cell function through the CYLD-NF-kappaB pathway."
CYLD affects function
| 4
CYLD inhibits function. 4 / 4
| 4

sparser
"CYLD binds to RIG-I and inhibits the ubiquitination and signaling function of RIG-I xref , xref ."

sparser
"Thus, CYLD inhibits RANK-mediated signaling function by deubiquitinating TRAF6 or its downstream targets involved in NF- κ B activation."

sparser
"CYLD binds to RIP1 and inhibits its ubiquitination and signaling function."

sparser
"In the present study, we have shown that Tax forms a complex with CYLD, in which CYLD strongly inhibits the ubiquitination and signaling function of Tax."
CYLD affects cell
| 4
CYLD inhibits cell. 4 / 4
| 4

eidos
"Our knockout and overexpression results consistently show the CYLD expression inhibits NPC cell proliferation and delays cell transition from early S to G2 phase in the cell cycle in vitro ."

eidos
"Consistent with this , CYLD deficiency causes constitutive activation of TBK1 and IKKepsilon in dendritic cells ."

eidos
"Functional assays revealed CYLD inhibits NPC cell proliferation and migration in vitro and suppresses NPC tumorigenicity and metastasis in vivo by negatively regulating the NF-kB signaling pathway ."

eidos
"Moreover , since CYLD can act as a negative regulator of NF-kappaB pathways [ 48 ] , depressed CYLD expression resulted in aberrant activation of NF-kappaB , thereby inducing HCC cells to express abundantly a neutrophilic chemokine , CXCL5 , which can attract a large number of neutrophils [ 47 ] ."
CYLD affects cell growth
| 4
| 4

reach
"Exogenous expression of CYLD inhibited melanoma cell growth and migration in vitro."

reach
"In the present study, CYLD overexpression inhibited cell growth and promoted cell apoptosis in colon cancer cells, while the expression levels of p-p65 and p65 were decreased and those of p-IkappaBalpha and IkappaBalpha were increased."

reach
"miR-362 targeted cylindromatosis (CYLD) activation of the NF-kappaB pathway induced cell growth and apoptosis tolerance in gastric cancer."

reach
"Loss of CYLD in HMCLs was found to enhance β-catenin stabilization and localization to the nucleus, increase β-catenin-LEF/TCF reporter activity, and enhance MM cell growth and survival."
CYLD affects bsk
| 4
CYLD inhibits bsk. 4 / 4
| 4

reach
"beta1-integrin and pJNK are downregulated by CYLD and display crosstalk."

reach
"At the molecular level, CYLD decreased beta1-integrin and inhibited pJNK induction by tumor necrosis factor-alpha or cell attachment to collagen IV."

reach
"At the molecular level, CYLD decreased beta1-integrin and inhibited pJNK induction by TNFalpha or cell-attachment to collagen IV."

reach
"Further in line with these data, CYLD inhibited pJNK induction not only by TNFalpha but also by cell adhesion to collagen IV, a natural substrate and activator of beta1-integrin (XREF_FIG)."
CYLD affects TUBA1A
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CYLD affects SPATA2, and USP
| 4
SPATA2 binds CYLD and USP. 4 / 4
| 4

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PIM in SPATA2 associates with the PUB domain of HOIP ( xref ) [ xref , xref , xref , xref ]."

sparser
"Importantly, the USP domain of CYLD binds to the PUB domain of SPATA2, and the PUB-interacting motif (PIM) in SPATA2 associates with the PUB domain of HOIP ( xref , xref – xref )."

sparser
"The N Terminus of SPATA2 Interacts with the USP Domain of CYLD, whereas Its C Terminus Binds to the PUB Domain of HOIP."

sparser
"Together, these results show that SPATA2 contains two distinct domains that are responsible for mediating the interaction with CYLD and HOIP, respectively; while the N terminus of SPATA2 binds to the USP domain of CYLD, the interaction with HOIP is mediated via a highly conserved PIM located in the central portion of SPATA2, which is recognized by the PUB domain of HOIP."
CYLD affects SORBS1
| 4
| 4

sparser
"The CAP-Gly domain of CYLD associates with the proline-rich sequence in NEMO/IKKgamma."

sparser
"From this study, we conclude that the CAP-Gly domain of CYLD associates with the proline-rich sequence of NEMO/IKKγ."

sparser
"Crystal structures show that the third CAP-Gly domain of CYLD interacts with one of the two proline-rich sequences in NEMO ."

sparser
"Here we report that the third CAP-Gly domain of CYLD specifically interacts with one of the two proline-rich sequences of NEMO/IKKgamma."
CYLD affects SHARPIN
3 | 1
3 | 1

No evidence text available

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

No evidence text available

No evidence text available
CYLD affects RNF31, and SPATA2
| 1 3
| 1 3

sparser
"Importantly, the HOIP-SPATA2-CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [ xref , xref , xref ]."

reach
"Importantly, the HOIP, SPATA2, and CYLD complex is formed at the TNFR complex, whereas OTULIN does not translocate with LUBAC to the TNFR complex [XREF_BIBR, XREF_BIBR, XREF_BIBR]."

sparser
"To characterize the interaction of SPATA2 with CYLD and HOIP further, we expressed various deletion mutants of SPATA2 with a GFP tag."

sparser
"Strikingly, the extended SPATA2 fragment formed a trimeric complex with CYLD and HOIP that eluted with an MW of 170 kDa, indicative of a stable 2:2:2 complex ( xref G, red, green, and orange curves; see xref for details on stoichiometry calculation)."
CYLD affects RIPK3
| 4
CYLD phosphorylates RIPK3.
| 2
CYLD phosphorylates RIPK3. 2 / 2
| 2

reach
"CYLD deficiency led to hyper-ubiquitinated RIP1 in the necrosome and impaired phosphorylation of RIP1 and RIP3."

reach
"Upon TNF stimulation, CYLD can trigger necroptosis by promoting necrosome formation, phosphorylation and activation of RIPK3 51, but caspase-8 can cleave CYLD to suppress necroptosis 50."
CYLD activates RIPK3.
| 2
CYLD activates RIPK3. 2 / 2
| 2

reach
"Mouse RIP3, RIP1, MLKL, and CYLD siRNAs were synthesized by GenePharma : RIP3-1 (cccgacgaugucuucugucaa), RIP3-2 (cuccuuaaagucaauaaacau), RIP1-1 (ccacuagucugacugauga), RIP1-2 (ucaccaauguugcaggaua), CYLD-1 (uccauugaggauguaaauaaa), CYLD-2 (aaggguugaaccauuguuaaa), MLKL-1 (gagauccaguucaacgaua), and MLKL-2 (uaccaucaaaguauucaacaa)."

reach
"Then, we found that RIP3 accounts for shikonin induced activation of MLKL, and activated MLKL reversely up-regulates the protein level of CYLD and promotes the activation of RIP1 and RIP3."
CYLD affects RAC1
| 1 1 1
CYLD activates RAC1. 3 / 4
| 1 1 1

reach
"Our findings provide new insight into the role of CYLD induced RAC1 activation in melanoma cell migration."

trips
"Our findings provide new insight into the role of CYLD-induced RAC1 activation in melanoma cell migration."

sparser
"Our findings provide new insight into the role of CYLD-induced RAC1 activation in melanoma cell migration."
CYLD affects PUB domain, and SPATA2
| 4
SPATA2 binds CYLD and PUB domain. 4 / 4
| 4

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."

reach
"SPATA2 interacts with CYLD through its non canonical PUB domain, which binds the catalytic CYLD USP domain in a CYLD B-box-dependent manner."

reach
"The strongest effect on CYLD binding was observed when we mutated Tyr114, which points away from the PIM pocket (XREF_FIG E and 2G), supporting that CYLD binds the SPATA2 PUB domain in a PIM independent manner."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."
CYLD affects PLK1
2 | 1 1
2 | 1 1

sparser
"CYLD physically interacts with polo-like kinase 1 (Plk1), a serine/threonine kinase with a key regulatory role in mitotic cell division. xref It was proposed that CYLD positively regulates the function of Plk1, probably by deconjugating K63-linked ubiquitin chains on Plk1 or its upstream regulators. xref However, as the role of K63 ubiquitination in Plk1 regulation has not been established, further studies are required to understand how CYLD regulates mitosis."

No evidence text available

reach
"CYLD physically interacts with polo like kinase 1 (Plk1), a serine/threonine kinase with a key regulatory role in mitotic cell division."

No evidence text available
CYLD affects PD-L1
| 4
CYLD increases the amount of PD-L1. 4 / 4
| 4

isi
"Our findings provide insight into the mechanism of regulation of PD-L1 expression by CYLD in TET cells."

isi
"Therefore, we wanted to explore the role and mechanism of CYLD in regulating PD-L1 expression in TETs."

isi
"Moreover, the clinical correlation between low CYLD and high PD-L1 expression, and the clinical impact of CYLD expression were evaluated in tissue microarrays of 105 TET cases."

isi
"The role of CYLD in PD-L1 expression was assessed by knockdown of CYLD in TET cells upon stimulation with interferon gamma (IFN-gamma), tumor necrosis factor-alpha (TNF-alpha) or polyinosinic-polycytidylic acid (poly I:C)."
CYLD affects OTULIN, and SPATA2
| 4
| 4

sparser
"LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"Fig. 2: LUBAC exists in distinct complexes with the DUBs OTULIN (1) and CYLD-SPATA2 (2)."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [32]."

sparser
"The mechanisms regulating the interaction of LUBAC with OTULIN and SPATA2-CYLD in cells are not well-understood but in vitro studies show that phosphorylation of the tyrosine (Y56) in the OTULIN PIM abrogates its interaction with HOIP, suggesting that this may be a mechanism to regulate the LUBAC–OTULIN complex [ xref ]."
CYLD affects OPTN, and TBK1
| 3 1
TBK1 binds OPTN and CYLD. 4 / 4
| 3 1

reach
"Interestingly, our results indicate that the TBK1, Optn, and CYLD complex is disrupted during G2/M phase as a consequence of Optn and CYLD accumulation to the nucleus, leading to enhancement of TBK1 activity and relocalization of its active form to the mitochondria."

sparser
"Our results led us to propose a model for the regulation of TBK1 activity by Optn: In uninfected cells, the complex formed by TBK1, Optn and CYLD would allow constitutive deubiquitination and inhibition of TBK1, thereby limiting its activity in the absence of upstream signaling."

reach
"Formation of the TBK1, Optn, and CYLD complex is disrupted during the G2/M transition."

reach
"We then hypothesized that the accumulation of Optn and CYLD to the nucleus during G2/M phase should disrupt the TBK1, Optn, and CYLD complex formation."
| 4

reach
"Loss of the deubiquitinating enzyme CYLD, which acts as a negative regulator of nuclear factor kappa-light-chain-enhancer of activated B cells (NFkappaB) and Wnt Signaling, increases the aggressiveness of MM [XREF_BIBR]."

reach
"Functional assays revealed that CYLD represses MM cell proliferation and survival."

reach
"Loss of the deubiquitinating enzyme CYLD has been shown to enhance MM aggressiveness via Wnt pathway activation [XREF_BIBR]."

reach
"Altogether, our findings identify CYLD as a negative regulator of NF-kappaB and Wnt and beta-catenin signaling in MM and indicate that loss of CYLD enhances MM aggressiveness through Wnt pathway activation."
CYLD affects Melanoma
| 1
| 1

reach
"These results suggest that TRIM15 promotes, while CYLD inhibits, proliferation of melanoma cells."
CYLD affects MRLN
| 4
| 4

reach
"These data reveal a direct, LUBAC-independent but OTULIN-dependent binding of M1-Ub to CYLD."

reach
"We identified no Gly-Gly ubiquitination signature sites on CYLD by proteomic approaches, suggesting that the posttranslational modification is not ubiquitination itself and that the binding of CYLD to M1-Ub is non-covalent."

reach
"The detection of CYLD bound to M1-Ub reveals another, LUBAC-independent, layer of crosstalk between the two deubiquitinases."

reach
"We confirmed the specific binding of CYLD to M1-Ub in an OTULIN gene-dosage dependent manner (Figure 5D, S5I)."
CYLD affects Fibroblasts
| 4
CYLD inhibits Fibroblasts.
| 2
| 2

eidos
"These findings suggest that CYLD inhibits NPC development and provides strong evidence supporting a role for CYLD inhibiting fibroblast and endothelial stromal cell infiltration into NPC via suppressing the NF-kB pathway ."

eidos
"Additionally , CYLD was able to inhibit fibroblast and endothelial stromal cell infiltration into the NPC tumor microenvironment ."
CYLD activates Fibroblasts.
| 2
| 2

eidos
"Cylindromatosis Lysine 63 Deubiquitinase ( CYLD ) Regulates NF-kB Signaling Pathway and Modulates Fibroblast and Endothelial Cells Recruitment in Nasopharyngeal Carcinoma Nasopharyngeal carcinoma ( NPC ) is a malignant epithelial carcinoma of the nasopharynx ."

eidos
"Cylindromatosis Lysine 63 Deubiquitinase ( CYLD ) Regulates NF-kB Signaling Pathway and Modulates Fibroblast and Endothelial Cells Recruitment in Nasopharyngeal Carcinoma ."
CYLD affects CTNNB1
| 4
CYLD inhibits CTNNB1. 4 / 4
| 4

reach
"In the Wnt signal transduction pathway, CYLD inhibits beta-catenin signaling by removing Lysine 63 linked ubiquitination from Dishevelled."

reach
"In human cylindroma, CYLD negatively regulates Wnt and beta-catenin signaling via deubiquitination of Dishevelled, which is a key component in Wnt mediated beta-catenin nuclear translocation."

reach
"Increased CYLD expression may likewise diminish Wnt pathway activation and beta-catenin accumulation (XREF_FIG) via K63 linked deubiquitination of Dvl."

reach
"Loss of CYLD in HMCLs was found to enhance β-catenin stabilization and localization to the nucleus, increase β-catenin-LEF/TCF reporter activity, and enhance MM cell growth and survival."
| 4

reach
"Potential association between CYLD and CaMKII was examined by immunoprecipitation."

reach
"The association between CYLD and CaMKII may not require CaMKII kinase activity because CYLD appears to colocalize with CaMKII in tatCN21 induced polyribosome aggregates, despite the inhibition of CaMKII activity by tatCN21."

reach
"Although CaMKII and CYLD co-immunoprecipitate from solubilized PSDs, the association between CYLD and CaMKII may require additional factors such as posttranslational modifications or adaptor proteins."

reach
"Co-immunoprecipitation of the two proteins from solubilized PSD fractions confirmed an association between CYLD and CaMKII."
CNTN2 affects CYLD
| 4
CNTN2 leads to the phosphorylation of CYLD. 4 / 4
| 4

reach
"Based on these prior reports and the data obtained thus far with the MT4 cells, we hypothesized that TAX activation of IKK family of kinases induces the phosphorylation of CYLD to suppress its deubiquitinating activity."

reach
"We reasoned that since TAX is known to activate IKK and can associate with CYLD , the TAX protein may be sufficient to induce CYLD phosphorylation."

reach
"Our observations suggest that in cells transformed by HTLV-1, TAX induces the phosphorylation of CYLD to keep it inactive in order to prevent RIPK1 from inducing cell death."

reach
"Transfection of a TAX-encoding plasmid into HEK293 EBNA cells confirmed that TAX by itself is sufficient to induce CYLD phosphorylation (Fig. 1c)."
| 2
| 2

reach
"TSA was shown to raise CYLD mRNA and protein levels in Huh7 and HepG2 cells [XREF_BIBR]."

reach
"However, TSA treatment or HDAC6 depletion alone did not induce interaction of CYLD with Bcl-3 (XREF_FIG)."
Selenite(2-) affects CYLD
| 3
| 3

reach
"We found that selenite triggered cIAP degradation, and CYLD upregulation via the transcription factor lymphoid enhancer factor-1 (LEF1)."

reach
"These data prompted us to investigate the role of LEF1 in selenite triggered CYLD upregulation."

reach
"Collectively, our findings demonstrate that selenite caused CYLD upregulation via LEF1 and cIAP downregulation, both of which contribute to the degradation of ubiquitin chains on RIP1 and subsequent caspase-8 activation and apoptosis."
Protein phosphatase affects TNFAIP3
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
Ply affects CYLD
| 3
Ply activates CYLD. 3 / 3
| 3

reach
"CYLD was highly induced by PLY and it inhibited MKK3-p38 induced expression of PAI-1 in the lung potentiating ALI [XREF_BIBR, XREF_BIBR]."
| PMC

reach
"CYLD was highly induced by PLY, and it inhibited MKK3-p38 kinase dependent expression of plasminogen activator inhibitor-1 (PAI-1) in lung, thereby potentiating ALI and mortality."

reach
"CYLD is also highly induced by pneumolysin (PLY)."
Oncogene IKKepsilon affects CYLD
| 3
Oncogene IKKepsilon phosphorylates CYLD. 3 / 3
| 3

reach
"Phosphorylation of the tumor suppressor CYLD by the breast cancer oncogene IKKepsilon promotes cell transformation."

reach
"Phosphorylation of the tumor suppressor CYLD by the breast cancer oncogene IKKepsilon promoted cell transformation."

reach
"This mechanism of CYLD inactivation has been subverted by the breast cancer oncogene IKKepsilon, which phosphorylates CYLD and inactivates its DUB function [XREF_BIBR]."
MiR-99b-3p affects CYLD
| 3
MiR-99b-3p activates CYLD. 3 / 3
| 3

reach
"To test whether miR-99b-3p targets the CYLD mRNA in melanoma cells, we introduced luciferase reporter plasmids of the 3 '-UTR of CYLD into Mel-CV, ME1007, ME4405, and Mel-FH cells (XREF_FIG)."

reach
"Therefore, miR-99b-3p targets the 3 '-UTR of the CYLD mRNA in Mel-CV and ME1007 cells."

reach
"Taken together, these results indicate that miR-99b-3p selectively targets the 3 '-UTR of CYLD mRNA in melanoma cells in a cell line dependent manner."
MiR-454 affects CYLD
| 3
MiR-454 inhibits CYLD. 3 / 3
| 3

reach
"The results demonstrated that miR-454 downregulated CYLD mRNA and protein expression which increased the apoptosis rate of cancer cells."

reach
"Liang et al. revealed that ectopic expression of miR-454 promoted CRC cell proliferation by repressing CYLD [12]."

reach
"CYLD was directly downregulated by miR-454 thus increasing the survival rate of the SGC-7901 cells."
Fbxw1 affects CYLD
| 1 2
| 1 2

reach
"Notably, among the four reported IKK phosphorylation sites [XREF_BIBR] (S418, S422, S432 and S436) that may create two putative beta-TRCP binding motifs, mutating both phospho-degrons of CYLD abolished the interaction between CYLD and beta-TRCP."

sparser
"Notably, among the four reported IKK phosphorylation sites [ xref ] (S418, S422, S432 and S436) that may create two putative β-TRCP binding motifs (Figure xref ), mutating both phospho-degrons of CYLD abolished the interaction between CYLD and β-TRCP (Figures xref )."

sparser
"To demonstrate that CYLD is a bona-fide substrate of SCF β-TRCP , we next examined whether the interaction of β-TRCP with CYLD is through the substrate recognition domain of β-TRCP."
Doxorubicin affects CYLD
| 2
Doxorubicin increases the amount of CYLD. 2 / 3
| 2

reach
"Doxorubicin, which is a common agent used for transarterial chemoembolization procedures in HCC, induced CYLD expression in various subcellular compartments, including nucleoli."

reach
"Induction of CYLD expression by doxorubicin treatment led to increased cytoplasmic and nuclear expression of CYLD."
CooH affects TRAIP
| 3
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
Cadmium atom affects CYLD
| 1 2
| 1 2

reach
"These results indicate that Cd reduced CYLD availability and likely its K63 DUB function."
| PMC

reach
"We found that Cd lowered the cytosolic levels of soluble CYLD proteins and led to its accumulation in detergent-insoluble fractions (XREF_FIG A, left)."
| PMC

eidos
"In addition to aggregation , Cd induced CYLD inactivation , as shown by an increase in high molecular weight ( likely ubiquitinated ) forms of CYLD and the cleavage of CYLD into several inactive fragments of ~ 72 , 50 , and 40 kDa [ 67 ] , two events that were not recapitulated by proteasomal inhibition ( data not shown , Chargui A. IRCAN , Nice , France , 2021 ) ."
| PMC
USP affects Trim14
| 3
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
USP domain affects SPATA2
| 3
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
UBD affects CYLD
| 1 2
| 1 2

sparser
"Recent structural characterization of CYLD bound to Lys63-linked diubiquitin in the catalytic state and Met1-linked diubiquitin in both the pre-catalytic and catalytic states revealed that the His side chain is arranged in a catalytically competent orientation with either diubiquitin xref ."

reach
"Thus, the current structures of CYLD bound to diubiquitin do not provide an explanation of how phosphorylation controls Ub linkage cleavage."

sparser
"Structural comparison with the USP7-ubiquitin complex (PDB 5JTJ) and with the CYLD-diubiquitin K63 complex (PDB 3WXG) xref indicates that the IL-loop and the “distal” ubiquitin share a similar binding surface (Fig.  xref and Supplementary Figure  xref ), thus preventing substrate binding in the tetramer assembly."
UBC affects CYLD
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
Trim14 affects USP
| 3
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
TRAIP affects cooH
| 3
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
TRAF2 affects IKBKG
| 3
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
TNFSF11 affects CYLD
| 3
TNFSF11 increases the amount of CYLD. 3 / 3
| 3

reach
"32 In mouse bone marrow derived macrophages, CYLD expression is strongly induced by RANKL, but not by TNF-alpha or LPS."

reach
"40 RANKL stimulated osteoclastogenesis potently induces the expression of CYLD, and the accumulated CYLD targets TRAF6 by interacting with the adaptor protein, p62."

reach
"Furthermore, MG132 treatment extended the half-life of endogenous CYLD protein following RANKL stimulation in RAW264.7 mouse macrophage cells, as RANKL stimulation induces CYLD mRNA expression, thereby bypassing the down-regulation of CYLD mRNA expression by MG132."
TNFAIP3 affects protein phosphatase
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
TNFAIP3 affects ITCH
| 3
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
TCF3 affects CYLD
3 |
TCF3 decreases the amount of CYLD. 3 / 3
3 |

No evidence text available

No evidence text available

No evidence text available
SPATA2 affects USP domain
| 3
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
SPATA2 affects Trim14
| 3
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
SNAIL1 affects CYLD
| 3
SNAIL1 inhibits CYLD. 3 / 3
| 3

reach
"CYLD is suppressed in human melanoma cells, by the transcription factor SNAIL1."
| PMC

reach
"CYLD is suppressed in human melanoma cells by the transcriptional repressor SNAIL1 leading to an increase of their proliferative, invasive and migratory potential."

reach
"The repression of CYLD by SNAIL1 allows degeneration of melanocytes."
SLC25A32 affects CYLD
| 3
| 3

sparser
"We describe a single family with affected members exhibiting either the FC or the MFT phenotypes associated with a mutation in the CYLD gene."

sparser
"MFT has been associated with mutations in the CYLD gene on a chromosome.[ xref ] Mutations in this gene have also been linked to familial cylindromatosis and Brooke–Spiegler syndrome, in which the patients develop trichoepitheliomas and cylindromas.[ xref ] CYLD gene has tumor suppressor properties and influences cell survival and proliferation."

sparser
"In this report, we describe three families with BSS, one with FC, and two with MFT phenotypes associated with novel and recurrent mutations in CYLD."
Proteasome affects CYLD
| 3
| 3

reach
"CYLD may be functionally inactivated through its phosphorylation, degraded by the ubiquitination and proteasome pathway, or repressed at the level of transcription."

reach
"The HPV encoded oncogenic protein E6 promotes hypoxia induced NF-kappaB activation by triggering the ubiquitination and proteasome mediated degradation of CYLD [XREF_BIBR]."

reach
"HeLa and SiHa cells were exposed to MG132 (10 microM) for one hour prior to harvesting protein in order to prevent E6 mediated, proteasome dependent degradation of CYLD."
PSDs affects CYLD
| 3
PSDs leads to the phosphorylation of CYLD. 3 / 3
| 3

reach
"These observations indicate that endogenous IKK activity in isolated PSDs mediates CYLD phosphorylation in the absence of Ca 2+."

reach
"Activation of CaMKII in isolated PSDs promotes phosphorylation of CYLD on the same residues and also enhances endogenous deubiquitinase activity specific for K63 linked polyubiquitins."

reach
"Activation of endogenous CaMKII in isolated PSDs promotes phosphorylation of CYLD."
PPP2 affects protein phosphatase
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
PMS1 affects CYLD
1 | 1 1
1 | 1 1

No evidence text available

sparser
"A co-immunoprecipitation experiment in HeLa cell lines showed that in humans PMS1 binds with CYLD protein ( xref )."

reach
"A co-immunoprecipitation experiment in HeLa cell lines showed that in humans PMS1 binds with CYLD protein."
PDE4 affects CYLD
| 3
PDE4 inhibits CYLD. 3 / 3
| 3

reach
"As shown in XREF_FIG and XREF_SUPPLEMENTARY, inhibition of PDE4 using Rolipram still enhanced NTHi induced upregulation of CYLD in JNK1 depleted cells but not in JNK2 depleted cells, confirming the selective requirement of JNK2 in mediating PDE4B-depenent negative regulation of CYLD expression."

reach
"Having demonstrated that inhibition of PDE4 enhanced upregulation of CYLD and suppressed NTHi induced inflammation, it is still unclear whether inhibition of PDE4 suppresses inflammation via upregulating the expression of CYLD, a key negative regulator of inflammation, or via inhibiting key positive regulators of inflammation, for example, IKKbeta."

reach
"Interestingly, PDE4 inhibition using Rolipram no longer enhanced NTHi induced upregulation of CYLD and suppressed inflammation in HMEEC cells that had been already pretreated with SP600125 (XREF_FIG)."
MAVS affects CYLD
| 1 2
| 1 2

sparser
"CYLD also interacted with IPS-1 to negatively regulate it, but did not deubiquitinate it [ xref ]."

reach
"CYLD physically interacts with both RIG-I and MAVS and preferentially inhibits the ubiquitination of RIG-I [XREF_BIBR] along with TBK1 and IKKepsilon, upregulating several IFN stimulating genes."

sparser
"CYLD also interacted with IPS-1 to negatively regulate it, but did not deubiquitinate it [27]."
MAPK3 affects CYLD
| 1 2
| 1 2

sparser
"In vitro , Flag-CYLD was pulled down by GST-ERK1, but not GST ( xref ), indicating that a direct interaction between CYLD and ERK1."

sparser
"Moreover, an increase in the TRIM15-ERK1 association upon IGF1 stimulation was accompanied by a decline in the CYLD-ERK1 association ( xref )."

reach
"In vitro, Flag-CYLD was pulled down by GST-ERK1, but not GST (Fig. 6b), indicating that a direct interaction between CYLD and ERK1."
LUBAC affects CYLD
| 3
CYLD binds LUBAC. 3 / 3
| 3

reach
"The p97 PIM is unable to outcompete OTULIN 71, but it is possible that separate pools of p97-, OTULIN- and CYLD bound LUBAC complexes coexist."

reach
"As CYLD interaction with LUBAC was responsible for TNF-RSC recruitment, we wondered whether LUBAC might also be responsible for recruitment of CYLD to other SCs."

reach
"Importantly, whereas CYLD bound LUBAC is recruited to the TNF-RSC and the NOD2-SC, OTULIN associated LUBAC is not."
KITLG affects CYLD
| 3
KITLG inhibits CYLD. 3 / 3
| 3

reach
"Altogether, these results support the model that CYLD degradation by SCF beta-TRCP plays a critical role in governing the timely activation of the NF-kappaB signaling pathway to control the osteoclast differentiation process (XREF_SUPPLEMENTARY)."

reach
"Taken together, these results indicated that SCF beta-TRCP might negatively regulate the protein stability of CYLD."

reach
"As IKK mediated phosphorylation of CYLD has been reported to negatively regulate CYLD enzymatic activity [XREF_BIBR], we further explored whether IKK is also involved in regulating the degradation of CYLD by SCF beta-TRCP."
ITCH affects TNFAIP3
| 3
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
ITCH affects E3_Ub_ligase
| 3
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
IKBKG affects TRAF2
| 3
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
HDAC7 affects CYLD
| 2 1
| 2 1

sparser
"CYLD can interact with HDAC7 in the cytoplasm of HSC, which enhances removal of HDAC7 from the HGF promoter to increase HGF gene transcription."

reach
"CYLD can interact with HDAC7 in the cytoplasm of HSC, which enhances removal of HDAC7 from the HGF promoter to increase HGF gene transcription."

reach
"Accordingly, CYLD interacts with and removes HDAC7 from the HGF promoter, hence enabling HGF induction, which subsequently is secreted and protects against hepatocellular injury and fibrosis."
GSK3B affects CYLD
| 1 1
| 1 1

sparser
"We further performed co-immunoprecipitation experiments to determine whether GSK3β directly interacts with CYLD."

reach
"We further performed co-immunoprecipitation experiments to determine whether GSK3beta directly interacts with CYLD."
E3_Ub_ligase affects ITCH
| 3
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
DIABLO affects CYLD
| 3
DIABLO leads to the dephosphorylation of CYLD. 3 / 3
| 3

reach
"Disruption in RIPK1 ubiquitination is also known to disrupt IKK activity , and therefore we hypothesized that SMAC mimetics could also reduce IKK activity and CYLD phosphorylation."

reach
"We provide evidence to show that SMAC mimetics, which are being evaluated as antitumor agents, function similarly to the IKK inhibitors to disrupt CYLD phosphorylation."

reach
"SMAC mimetics can similarly disrupt CYLD phosphorylation and lead to ATLL cell death through reduction of RIPK1 ubiquitination, which is CYLD dependent."
CYLD affects sub
| 3
CYLD inhibits sub. 3 / 3
| 3

reach
"We also checked in both lines of transgenic mice, that, as expected, the CYLD C/S mutant was catalytically inactive and inhibited the DUB function of the endogenous CYLD, as we previously described that occurred in the epidermal HaCaT-CYLD C/S and PDVC57-CYLD C/S cells [XREF_BIBR, XREF_BIBR] (XREF_SUPPLEMENTARY)."

reach
"Similarly, CYLD Ser418 phosphorylation upon co-expression of IKKepsilon was found to decrease its DUB activity."

reach
"Interestingly, phosphorylation of CYLD has been shown to inhibit its DUB activity XREF_BIBR - XREF_BIBR."
CYLD affects protein phosphatase
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."

eidos
"Inhibition of cIAPs or deubiquitination of RIPK1 by cylindromatosis ( CYLD ) can block the activation of NF-kappaB pathway , leading to the dissociation of RIPK1 and TRADD from the plasma membrane-associated complex28 ."

eidos
"SUMO2 and SUMO3 bind to Lysine residue 277 of NEMO and prevent its deubiquitination by CYLD ( a deubiquitinase ) and thus , causing stronger activation of IKK upon stimulation of cells with TLR4 , TLR3 , and TLR7-specific agonists [ 263 ] ."
| DOI

eidos
"SUMO2 and SUMO3 bind to Lysine residue 277 of NEMO and prevent its deubiquitination by CYLD ( a deubiquitinase ) and thus , causing stronger activation of IKK upon stimulation of cells with TLR4 , TLR3 , and TLR7-specific agonists [ 263 ] ."
| PMC
CYLD affects pathway
| 3
CYLD inhibits pathway. 3 / 3
| 3

sparser
"Similarly, in HBE cells transformed with 2% cigarette smoke extract (CSE), increased levels of m 6 A and upregulated expression of METTL3 were observed after 48 hours of treatment. xref In particular, METTL3-mediated increases of m 6 A on the 3’ UTR of the tumor suppressor Zbtb4 resulted in decreased ZBTB4 expression through YTHDF2-mediated mRNA decay. xref As a result, decreased ZBTB4 expression promoted cigarette smoke (CS)-induced EMT and carcinogenesis. xref In another study, human bronchial epithelial (BEAS-2B) cells exposed to CS had downregulated expression of YTHDC2. xref Mechanistically, YTHDC2 was found to bind m 6 A sites on the transcript of the tumor suppressor Cyld and promoted Cyld mRNA stability. xref As CYLD normally inhibits the NF- κ B pathway, decreased YTHDC2 expression after CS exposure can promote cancer cell proliferation by modulating the CYLD/NF- κ B axis in CS-induced lung cancer. xref "

sparser
"CYLD inhibits the NF-κB pathway by deubiquitinating key factors, including NF-κB essential modulators IKKg and TRAF2 ( xref )."

sparser
"Previous studies report that CYLD negatively regulates NF-κB signaling by removing K63- and M1-linked polyubiquitin chains from key signaling molecules, including NF-κB essential modulator, tumor necrosis factor (TNF)-associated factor (TRAF) 2, TRAF6, and Receptor-interacting serine/threonine-protein kinase 1, in familial cylindromatosis tumors. xref – xref Additionally, Tauriello et al xref demonstrated that CYLD inhibits the Wnt pathway by deubiquitinating disheveled in familial cylindromatosis tumors."
CYLD affects miR-500
| 3
CYLD activates miR-500. 3 / 3
| 3

reach
"Taken together, our results demonstrate that CYLD, TAX1BP1, and OTUD7B are bona fide targets of miR-500."

reach
"Importantly, the repressive effect of antagomiR-500 on NF-kappaB activity and BCL2L1, CCND1 expression were potently antagonised by individual silencing of CYLD, TAX1BP1, or OTUD7B (XREF_SUPPLEMENTARY), indicating that CYLD, TAX1BP1, and OTUD7B are functionally relevant effectors of miR-500 in NF-kappaB activation."

reach
"Using the TargetScan program, we found that CYLD, OTUD7B, and the A20 complex component TAX1BP1, which function as critical negative regulatory genes by deconjugating K63-polyubiquitin chains from RIP1 [XREF_BIBR, XREF_BIBR], might be potential targets of miR-500."
CYLD affects induction
| 3
CYLD inhibits induction. 3 / 3
| 3

sparser
"As shown in xref , IL-8 induction is markedly inhibited by CYLD WT."

sparser
"CYLD also inhibits viral induction of type-I interferons by removing K63 polyubiquitin chains from RIG-I xref , xref ."

sparser
"Further in line with these data, CYLD inhibited pJNK induction not only by TNFα but also by cell adhesion to collagen IV, a natural substrate and activator of β1-integrin ( xref )."
| 3

reach
"We further show increased anti-parasite immunity driven by dysregulation of Treg by CYLD deletion."

reach
"The inhibition of CYLD and/or A20 could enhance the inflammatory or immune response, but the prolonged consequences are unclear and await assessment in animal models and in early clinical trials."

reach
"In E. coli induced pneumonia, CYLD has been shown to negatively regulate the immune response by blocking PAMP (Pathogen Associated Molecular Pattern)-induced NF-kB activation [XREF_BIBR]."

reach
"These findings suggest that CYLD can both positively and negatively regulate signal transduction and homeostasis of B cells in vivo, depending on the expression of CYLD splice variants."

reach
"At a genomic level, we established that neither TRKB and TRKC amplification, nor that of BDNF and NT3/4 was demonstrated to account for the overexpression seen in cylindroma tumours, suggesting that CYLD dysfunction perturbs normal TRK homeostasis."

reach
"Our data demonstrate that alterations in CYLD expression in keratinocytes disrupt normal epidermal homeostasis : the forced expression of CYLD WT in human HaCaT keratinocytes and the skin equivalents enhance keratinocyte differentiation."
CYLD affects growth
| 3
CYLD inhibits growth. 3 / 3
| 3

sparser
"Compared to transfection with an empty vector control, wild-type CYLD transfection reduced hypoxia-induced colony formation, whereas as the C/S-CYLD mutant did not ( xref ), findings which indicates that CYLD inhibits hypoxia-induced anchorage-independent growth."

sparser
"Consistently, CYLD but not its catalytically deficient mutant inhibited subcutaneous melanoma growth in immunodeficient mice, which is accompanied by the downregulation of cyclin D1 and N-cadherin and the upregulation of E-cadherin and p53."

sparser
"In order to explore how CYLD inhibits invasive tumor growth, we examined the expression status of β1-integrin which is a member of the heterodimeric transmembrane receptors involved in melanoma migration and chemotaxis ( xref ; xref )."
CYLD affects fbxw1
| 1 2
| 1 2

reach
"Notably, among the four reported IKK phosphorylation sites [XREF_BIBR] (S418, S422, S432 and S436) that may create two putative beta-TRCP binding motifs, mutating both phospho-degrons of CYLD abolished the interaction between CYLD and beta-TRCP."

sparser
"Notably, among the four reported IKK phosphorylation sites [ xref ] (S418, S422, S432 and S436) that may create two putative β-TRCP binding motifs (Figure xref ), mutating both phospho-degrons of CYLD abolished the interaction between CYLD and β-TRCP (Figures xref )."

sparser
"To demonstrate that CYLD is a bona-fide substrate of SCF β-TRCP , we next examined whether the interaction of β-TRCP with CYLD is through the substrate recognition domain of β-TRCP."

reach
"The Tumor Suppressor CYLD Inhibits Mammary Epithelial to Mesenchymal Transition by the Coordinated Inhibition of YAP and TAZ and TGF Signaling."

eidos
"We found that downregulation of either YAP or TAZ prevented the EMT that is induced by CYLD downregulation ( Figure 5d ) ."

reach
"CYLD downregulation or inactivation induced an epithelial to mesenchymal transition of mammary epithelial cells that was dependent on the concomitant activation of the transcription factors Yes associated protein (YAP)/transcriptional coactivator with PDZ binding motif (TAZ) and transforming growth factor beta (TGF) signaling."
CYLD affects cooH
| 3
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
| 3
| 3

reach
"These findings suggest that age related attenuation of CYLD expression in endothelial cells (ECs) and macrophages triggers the initiation of age related atherogenesis by exacerbating monocyte adhesion on the endothelium and foam cell formation."

reach
"siRNA mediated CYLD silencing led to enhanced monocyte adhesion along with increased adhesion molecules in HAECs treated with TNFalpha."

reach
"Furthermore, adhesion of fluorescein isothiocyanate labeled THP-1 cells to BAECs was also inhibited by CYLD overexpression."
CYLD affects angiogenesis
| 3
| 3

reach
"We have also showed that CYLD C/S expression enhances angiogenesis in mouse skin carcinomas, 21 what constitutes a prominent feature of skin tumor progression."

reach
"Based on a previous study showing that CYLD regulates vascular endothelial cell migration and angiogenesis in HUVECs [XREF_BIBR], we hypothesized that CYLD may also promote angiogenesis in a CNV model."

reach
"We find that knockdown of CYLD expression significantly impairs angiogenesis in vitro in both matrigel based tube formation assay and collagen based 3-dimensional capillary sprouting assay."
CYLD affects USP domain
| 3
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
CYLD affects UBD
| 1 2
| 1 2

sparser
"Recent structural characterization of CYLD bound to Lys63-linked diubiquitin in the catalytic state and Met1-linked diubiquitin in both the pre-catalytic and catalytic states revealed that the His side chain is arranged in a catalytically competent orientation with either diubiquitin xref ."

reach
"Thus, the current structures of CYLD bound to diubiquitin do not provide an explanation of how phosphorylation controls Ub linkage cleavage."

sparser
"Structural comparison with the USP7-ubiquitin complex (PDB 5JTJ) and with the CYLD-diubiquitin K63 complex (PDB 3WXG) xref indicates that the IL-loop and the “distal” ubiquitin share a similar binding surface (Fig.  xref and Supplementary Figure  xref ), thus preventing substrate binding in the tetramer assembly."
CYLD affects UBC
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
CYLD affects TRAIP, and cooH
| 3
CYLD binds TRAIP and cooH. 3 / 3
| 3

sparser
"CYLD Interacts with the COOH-terminal Domain of TRIP."

sparser
"The COOH-terminal domain of TRIP interacts with CYLD, whereas the NH 2 -terminal region binds to TRAF2 ( xref )."

sparser
"Far Western analysis and coimmunoprecipitations in mammalian cells confirmed that full-length CYLD binds to the COOH-terminal domain of TRIP."
CYLD affects TOPFlash reporter
| 3
CYLD inhibits TOPFlash reporter. 3 / 3
| 3

reach
"CYLD knockdown did not enhance basal levels of TOPFlash reporter activity in HEK293T cells, but strongly increased the response to Wnt3a."

reach
"Furthermore, overexpression of CYLD reduced TOPFlash reporter activity."

reach
"TOPFlash reporter activity initiated by enhanced expression of the upstream components, Fz5 or Dvl1, was substantially increased by CYLD knockdown, whereas signaling induced by ectopically enhanced ex[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CYLD affects TLR4
| 3
CYLD inhibits TLR4. 3 / 3
| 3

reach
"TLR4 engagement in the presence of zVAD-fmk did not lead to MLKL oligomerization in CYLD deficient cells (XREF_FIG), demonstrating that removal of CYLD prevents TLR4 from inducing necroptosis."

reach
"CYLD also negatively regulates NF-kappaB activation in IL-1R and TLR4 signaling through its DUB activity (Sun, 2010b)."

reach
"However, the specific CYLD target modulating TLR3 and TLR4 responses remains to be determined XREF_BIBR (Sidebar A)."
CYLD affects TARDBP
| 3
CYLD activates TARDBP. 3 / 3
| 3

reach
"In turn, expression of CYLD -GFP (Fig. 4m–p) caused a further 1.3-fold increase in cytoplasmic/nuclear TDP-43 relative to CYLD -GFP (0.121 ± 0.002; p < 0.0001; Fig. 4q–s)."

reach
"Pharmacological intervention with the apoptosis inducer staurosporine and mutation in a secondary gene (CYLD) also induced measurable cytoplasmic mislocalisation of endogenous FUS and TDP-43, respectively."

reach
"Moreover, this M719V variant of CYLD impairs autophagosome maturation and increases the cytosolic localization of TDP-43."
CYLD affects SPATA2, and USP domain
| 3
SPATA2 binds CYLD and USP domain. 3 / 3
| 3

reach
"Consistently, other studies reveal CYLD interacts with SPATA2 via the USP domain, supporting the notion that USP domain might also be a critical element for protein protein interactions [XREF_BIBR, XREF_BIBR]."

reach
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM independent manner."

reach
"It has been shown that the USP domain of CYLD binds the PUB domain of spermatogenesis associated protein 2 (Spata2), leading to recruitment of CYLD to the centrosome and de-ubiquitination of Plk4."
CYLD affects SPATA2, Trim14, and USP
| 3
SPATA2 binds CYLD, Trim14, and USP. 3 / 3
| 3

sparser
"Instead, SPATA2-PUB binds the USP domain of CYLD, which dimerizes via its B-box and does not contain a PIM sequence [ xref ]."

sparser
"Instead, the SPATA2 PUB domain binds strongly ( K D  10 nM) to the CYLD USP domain and the interaction is strengthened through dimerisation of CYLD, mediated via its B-box domain [ xref ]."

sparser
"SPATA2 binds the USP domain of CYLD via its PUB domain, but in a PIM-independent manner."
CYLD affects SLC25A32
| 3
| 3

sparser
"We describe a single family with affected members exhibiting either the FC or the MFT phenotypes associated with a mutation in the CYLD gene."

sparser
"MFT has been associated with mutations in the CYLD gene on a chromosome.[ xref ] Mutations in this gene have also been linked to familial cylindromatosis and Brooke–Spiegler syndrome, in which the patients develop trichoepitheliomas and cylindromas.[ xref ] CYLD gene has tumor suppressor properties and influences cell survival and proliferation."

sparser
"In this report, we describe three families with BSS, one with FC, and two with MFT phenotypes associated with novel and recurrent mutations in CYLD."
CYLD affects SCIN
| 3
CYLD decreases the amount of SCIN. 3 / 3
| 3

reach
"As our preliminary data shows that CYLD knockdown is able to upregulate IL-4 and Scinderin expression in human Treg cells (data not shown), this indicates that CYLD may play an important role in Treg cells in humans."

reach
"In line with this notion, Scinderin expression was upregulated by the CYLD deficiency, leading to an enhancement of the MAPK signaling pathway that induces IL-4 expression."

reach
"Collectively, the data suggest that CYLD deficiency induces Scinderin expression, which is critical in regulating IL-4 production in Treg cells."
CYLD affects PSMD4
| 2 1
CYLD activates PSMD4. 3 / 3
| 2 1

reach
"The silencing of CYLD significantly inhibited AF transdifferentiation and activation as evidenced by the expression of contractile proteins, the production of the proinflammatory cytokines MCP-1 (monocyte chemotactic protein 1) and IL-6 (interleukin-6), the deposition of extracellular matrix, and cell migration."

reach
"We further asked whether CYLD mediates AF activation via the regulation of nicotinamide adenine dinucleotide phosphate oxidase 4 (Nox4) as it is an essential factor during AF transdifferentiation."

sparser
"Indeed, the silencing of CYLD repressed transforming growth factor-β1-induced and homocysteine-induced Nox4 upregulation and reactive oxygen species production, whereas Nox4 overexpression greatly rescued the inhibitory effect on AF activation by CYLD silencing."
CYLD affects PP2C, PPP2, TNFAIP3, and protein phosphatase
| 3
PPP2 binds TNFAIP3, CYLD, PP2C, and protein phosphatase. 3 / 3
| 3

sparser
"Furthermore, IKKc has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012) ."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, xref ; Liu et al ., xref )."

sparser
"Furthermore, IKKγ has been implicated in interactions with protein phosphatases PP2A and PP2C as well as deubiquitinases A20 and CYLD (Solt & May, 2008; Liu et al., 2012)."
CYLD affects PMS1
1 | 1 1
1 | 1 1

No evidence text available

sparser
"A co-immunoprecipitation experiment in HeLa cell lines showed that in humans PMS1 binds with CYLD protein ( xref )."

reach
"A co-immunoprecipitation experiment in HeLa cell lines showed that in humans PMS1 binds with CYLD protein."
CYLD affects NTRK1
1 | 2
CYLD deubiquitinates NTRK1. 3 / 3
1 | 2

reach
"In the internalization of the nerve growth factor receptor TrkA, siRNA mediated suppression of CYLD causes sustained TrkA ubiquitination with Lys63 chains (Geetha et al., 2005)."

reach
"Geetha and collaborators saw that the polyubiquitination of TrkA increases when CYLD is depleted, but no direct evidence of TrkA deubiquitination by CYLD was provided [XREF_BIBR]."

"Moreover, additional studies showed that CYLD specifically deubiquitinates polyubiquitin chains at K63 of different substrates (e.g., TRAF2 and TRAF6), or tyrosine kinase receptors such as TrkA."
CYLD affects Mice
| 3
CYLD activates Mice. 3 / 3
| 3

reach
"- Cyld knockout impairs amygdala-dependent tone-cued fear memory in mice.- Cyld mice display aberrant neuronal activation in BLA in response to tone-cued fear test.- Cyld mice show decreased excitability of BLA principal neurons.- CYLD is critical for both excitatory and inhibitory synaptic neurotransmission in mouse BLA."

reach
"Our TFC test revealed that Cyld knockout impairs fear memory in mice."

reach
"Taken together, these results suggest that CYLD deficiency disrupts the neuronal activity and synaptic transmission in the BLA of mice which may contribute to the impaired fear memory observed in Cyld -/- mice."
CYLD affects MYD88
| 2 1
CYLD inhibits MYD88. 3 / 3
| 2 1

reach
"Thus, CYLD inhibits MyD88, RIP1 (receptor interacting serine/threonine protein kinase 1), TRAF2, TRAF6, TRAF7 and NEMO downstream to TLR signaling and regulates exaggerated inflammation which can lead to the development of severe infection causing sepsis and associated organ damage."
| DOI

sparser
"Thus, CYLD inhibits MyD88, RIP1 (receptor-interacting serine/threonine-protein kinase 1), TRAF2, TRAF6, TRAF7 and NEMO downstream to TLR signaling and regulates exaggerated inflammation which can lead to the development of severe infection causing sepsis and associated organ damage."
| DOI

reach
"Deubiquitinase CYLD negatively regulates MyD88 mediated signaling by directly interacting with MyD88 and deubiquitinating nontypeable Haemophilus influenzae (NTHi)-induced K63 linked polyubiquitination of MyD88 at lysine 231."
CYLD affects MTs
| 3
CYLD acetylates MTs. 3 / 3
| 3

reach
"The finding that CYLD colocalizes with HDAC6 in the midbody between bundles of acetylated MTs in both keratinocytes and melanoma cells, prompted us to investigate the rate of cytokinesis in these cells."

reach
"CYLD induces acetylation of alpha-tubulin and stabilization of MTs."

reach
"These results suggest that CYLD colocalizes mainly with acetylated MTs in the perinuclear region, and this localization is constitutive in CYLD transduced melanoma cells, whereas in primary mouse keratinocytes or primary human melanocytes (XREF_SUPPLEMENTARY) it is induced after TPA treatment or exposure to UV light."
CYLD affects MAVS
| 1 2
| 1 2

sparser
"CYLD also interacted with IPS-1 to negatively regulate it, but did not deubiquitinate it [ xref ]."

reach
"CYLD physically interacts with both RIG-I and MAVS and preferentially inhibits the ubiquitination of RIG-I [XREF_BIBR] along with TBK1 and IKKepsilon, upregulating several IFN stimulating genes."

sparser
"CYLD also interacted with IPS-1 to negatively regulate it, but did not deubiquitinate it [27]."
CYLD affects MAPK8
| 2
CYLD inhibits MAPK8. 2 / 3
| 2

reach
"The increased proliferation was thought to be mediated by MAPK8 signalling, which is negatively regulated by CYLD."

reach
"As shown in XREF_FIG, PDE4B knockdown selectively inhibited activation of JNK2 but not JNK1, thereby confirming that PDE4B negatively regulates NTHi induced CYLD expression and mediates inflammation via specific activation of JNK2 but not JNK1."
CYLD affects Leu-Met
| 3
CYLD inhibits Leu-Met. 3 / 3
| 3

reach
"CYLD reduced IL-6, ROS production and killing of Lm in Listeria infected macrophages by impairing NF-kappaB activation."

reach
"We could show previously that CYLD inhibited protective hepatocytic and macrophage responses and impaired the control of Lm."

reach
"To study how CYLD reduces STAT1 activation and nuclear accumulation in IFN-gamma-stimulated Lm infected BMDM, we analyzed whether CYLD might directly bind to STAT1."
CYLD affects LUBAC
| 3
CYLD binds LUBAC. 3 / 3
| 3

reach
"The p97 PIM is unable to outcompete OTULIN 71, but it is possible that separate pools of p97-, OTULIN- and CYLD bound LUBAC complexes coexist."

reach
"As CYLD interaction with LUBAC was responsible for TNF-RSC recruitment, we wondered whether LUBAC might also be responsible for recruitment of CYLD to other SCs."

reach
"Importantly, whereas CYLD bound LUBAC is recruited to the TNF-RSC and the NOD2-SC, OTULIN associated LUBAC is not."
CYLD affects LEF1
| 1 2
| 1 2

sparser
"In addition, LEF1 silencing sensitised CRC cells to selenite-induced apoptosis, which provides a new avenue for enhancing chemotherapy by targeting the efficiency of LEF1 binding to the CYLD promoter."

sparser
"Our study showed that LEF1 binds the CYLD promoter and suppresses endogenous CYLD levels, whereas selenite caused LEF1 to dissociate from the CYLD promoter."

reach
"Our study showed that LEF1 binds the CYLD promoter and suppresses endogenous CYLD levels, whereas selenite caused LEF1 to dissociate from the CYLD promoter."
CYLD affects ITCH, and TNFAIP3
| 3
| 3

sparser
"A20 and Cyld can form independent complexes with Itch to disassemble K63 chains and to add K48 polyubiquitination ( xref , xref )."

sparser
"Both A20 and Cyld can independently associate with Itch and Cyld interacts with Cbl-b to facilitate the removal of K63 polyubiquitin chains and to add K48 polyubiquitination ( xref , xref , xref )."

sparser
"DUB-E3 interactions are used for mutual ubiquitin-dependent regulation (e.g., to control each other’s stability, see above) or for editing ubiquitin chain architecture on particular substrates (as shown for the hybrid DUB/E3 enzyme A20 and CYLD-ITCH complexes during inflammatory signaling [ xref , xref ])."
CYLD affects IRF3
| 3
CYLD inhibits IRF3. 3 / 3
| 3

reach
"Interestingly, CYLD is a negative regulator of the RIG-I and MAVS pathway as silencing of CYLD enhances the IRF3 response to sendai virus."

reach
"Ectopic expression of CYLD inhibits the IRF3 signalling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances the response."

reach
"For example, CYLD removes polyubiquitin chains from TBK1 and RIG-I and thus inhibits the IRF3 signaling pathway and IFN production triggered by RIG-I; conversely, CYLD knockdown enhances this response (58)."
CYLD affects IKBKG, and TRAF2
| 3
TRAF2 binds CYLD and IKBKG. 3 / 3
| 3

sparser
"Mechanistically, CYLD binds to NEMO and TRAF2 and reverses non-K48-linked polyubiquitination of TRAF2, thereby blocking TRAF2-mediated activation of the IKK complex [ xref - xref ] ( xref )."

sparser
"The direct interaction of CYLD with both TRAF2 and NEMO is facilitated by N-terminal protein-protein interaction domains and contributes to its activity toward these substrates ( Kovalenko et al., 200[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Interestingly, CYLD interacts with NEMO (IKKγ; references xref – xref ) and TRAF2 ( xref , xref ), both of which are recruited to the TNF receptor upon ligand binding."
CYLD affects HDAC7
| 2 1
| 2 1

sparser
"CYLD can interact with HDAC7 in the cytoplasm of HSC, which enhances removal of HDAC7 from the HGF promoter to increase HGF gene transcription."

reach
"CYLD can interact with HDAC7 in the cytoplasm of HSC, which enhances removal of HDAC7 from the HGF promoter to increase HGF gene transcription."

reach
"Accordingly, CYLD interacts with and removes HDAC7 from the HGF promoter, hence enabling HGF induction, which subsequently is secreted and protects against hepatocellular injury and fibrosis."
CYLD affects GSK3B
| 1 1
| 1 1

sparser
"We further performed co-immunoprecipitation experiments to determine whether GSK3β directly interacts with CYLD."

reach
"We further performed co-immunoprecipitation experiments to determine whether GSK3beta directly interacts with CYLD."
CYLD affects E3_Ub_ligase, and ITCH
| 3
| 3

sparser
"Here we demonstrate that E3 ligase Itch and deubiquitinase Cyld form a complex via the interaction through ‘WW-PPXY’ motifs."

sparser
"E3 ligase Itch and deubiquitinase CYLD form a complex that cleaves lysine (Lys) 63-linked ubiquitin chains and catalyze Lys48-linked ubiquitination on the kinase Tak1, which is a common substrate for these two proteins, thereby contributing to decreased inflammatory signalling [ xref ]."

sparser
"Recently, it has been demonstrated that E3 ligase ITCH and CYLD formed a complex which can sequentially cleave K63-linked ubiquitin-chain and catalyzes K48-linked ubiquitination to deactivate TAK1 and terminate NF-κB signaling (Ahmed et al., xref ), providing an example of how K48 and K63-linked ubiquitinations are closely linked and can be differentially utilized to control kinase activation and deactivation."
| 3

reach
"Considering that ubiquitination is critical for both proteasomal and autophagic degradation [7, 20], we postulated that CYLD via its DUB activity interferes cardiac PQC, thereby contributing to PO-induced cardiomyopathy."

reach
"CYLD exaggerates pressure overload-induced cardiomyopathy via suppressing autolysosome efflux in cardiomyocytes."

reach
"To gain pathological insights into the CYLD-mediated cardiomyopathy towards heart failure, a larger cohort of mixed male and female littermates of adult NG and TG mice were subject to sham and TAC operations for 2 weeks."
CYLD affects AURKB
2 |
2 |

No evidence text available

No evidence text available
CAMK2B affects CYLD
3 |
CAMK2B activates CYLD. 3 / 3
3 |

"Purified camkii phosphorylates cyld on at least three residues (s-362, s-418, and s-772 on the human cyld protein q9nqc7-1) and promotes its deubiquitinase activity."

"Purified camkii phosphorylates cyld on at least three residues (s-362, s-418, and s-772 on the human cyld protein q9nqc7-1) and promotes its deubiquitinase activity."

"Purified camkii phosphorylates cyld on at least three residues (s-362, s-418, and s-772 on the human cyld protein q9nqc7-1) and promotes its deubiquitinase activity."
AURKB affects CYLD
2 |
2 |

No evidence text available

No evidence text available
ATF3 affects CYLD
3 |
ATF3 decreases the amount of CYLD. 3 / 3
3 |

No evidence text available

No evidence text available

No evidence text available
ARHGEF12 affects CYLD
1 | 1 1
1 | 1 1

sparser
"In addition, we found that endogenous CYLD associated with endogenous LARG, but not with endogenous p115RhoGEF or PDZ-RhoGEF ( xref ), demonstrating a specific interaction between CYLD and LARG."

reach
"In addition, we found that endogenous CYLD associated with endogenous LARG, but not with endogenous p115RhoGEF or PDZ-RhoGEF (XREF_FIG), demonstrating a specific interaction between CYLD and LARG."

No evidence text available
Salicylate affects CYLD
| 2
| 2

reach
"Sal A pretreatment inhibited OX-LDL-induced CYLD upregulation."

reach
"Furthermore, the downregulation of CYLD by Sal A may be dependent on PI3K/Akt/mTOR, but not ERK."
Multikinase inhibitor affects CYLD
| 2
Multikinase inhibitor decreases the amount of CYLD. 2 / 2
| 2

reach
"We have already shown that CYLD expression in HCC cells can be triggered by the multikinase inhibitor sorafenib, by inhibition of Raf-1, as well as by blockage of the pro survival kinases MEK and EGFR and identified the recovery of CYLD expression as an interesting approach for overcoming HCC resistance XREF_BIBR."

reach
"Finally, we found that CYLD expression was triggered by the multikinase inhibitor, sorafenib, by the inhibition of Raf-1, as well as by the blockage of the pro survival kinases, MEK (U0126) and the epidermal growth factor receptor (AG1478)."
MiR-526a affects CYLD
| 2
MiR-526a inhibits CYLD. 2 / 2
| 2

eidos
"The expression of CYLD is suppressed by miR-526a ."

eidos
"For example , miR-526a is induced in monocytes upon vesicular stomatitis virus ( VSV ) infection and directly suppresses the expression of CYLD , thereby enhancing K63-linked ubiquitination of RIG-I and its activation [ 31 ] ."
MiR-500 affects CYLD
| 2
MiR-500 inhibits CYLD. 2 / 2
| 2

reach
"In gastric cancer cell lines, miR-500 directly repressed CYLD, OTUD7B, and the A20 complex component TAX1BP1 which led to sustained NF-kappaB activation [XREF_BIBR]."

reach
"Taken together, our results suggest that miR-500 overexpression activates the NF-kappaB signalling pathway by repressing CYLD, TAX1BP1, and OTUD7B, and consequently results in gastric cancer aggressiveness and poor clinical outcomes."
MTORC1 affects CYLD
| 1 1
| 1 1

sparser
"The adverse phenotypes observed in 2-week TAC-CR-CYLD mice were reminiscent of those in CR-mTOR KO mice, including inhibited p-p70S6K, accumulated autophagic vacuoles with undegraded contents, cardiomyocyte death, and cardiac dysfunction [ xref ], supporting the axis of CYLDmTORC1 inactivation–autolysosome efflux inhibition–cardiomyocyte death in PO-hearts."

reach
"Thus, except aforementioned K63 deubiquitination of mTOR and Rab7, the potential of TRIM28 or TRIMP37 and CYLD interaction in mTORC1 reactivation and suppressing autolysosome efflux in the heart deserves further investigation."
Ibrutinib affects CYLD
| 2
| 2

reach
"BTK inhibitor PCI-32765 promoted CYLD dependent apoptosis in rituximab resistant non-GCB-DLBCL cells."

reach
"Previous researches in CLL indicated that BTK inhibitor ibrutinib could largely increase CYLD activity through increasing CYLD miRNA transcription, which could inhibit cells proliferation in CLL [XREF_BIBR]."
2 |
Hsa-miR-181b-5p decreases the amount of CYLD. 2 / 2
2 |

No evidence text available

No evidence text available
Factor 2 affects CYLD
| 2
CYLD binds factor 2. 2 / 2
| 2

sparser
"CYLD also interacts directly with tumor-necrosis factor receptor (TNFR)-associated factor 2 (TRAF2), an adaptor molecule involved in signaling by members of the family of TNF/nerve growth factor receptors [ xref ]."

sparser
"CYLD also interacts directly with tumour-necrosis factor receptor (TNFR)-associated factor 2 (TRAF2), an adaptor molecule involved in signalling by members of the family of TNF/nerve growth factor receptors."
YWHAB affects CYLD
2 |
2 |

No evidence text available

No evidence text available
Trim14 affects OTULIN
| 2
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
TUBA4A affects CYLD
1 | 1
1 | 1

sparser
"This increase was accompanied by enhanced association of CYLD with acetylated α-tubulin ( xref )."

No evidence text available
TRAF7 affects CYLD
1 | 1
1 | 1

reach
"Later work studying signaling through the toll like receptor 2 (TLR2) performed cell based experiments to demonstrate that CYLD binds to TRAF6 and TRAF7 and that depletion of CYLD increases the ability of transfected TRAF6 or TRAF7 to activate an NFkappaB dependent reporter gene [XREF_BIBR]."

No evidence text available
TNFAIP3 affects NMRAL1
| 1 1
| 1 1

sparser
"Several DUBs, including A20, CYLD and USP7, have been reported to downregulate NF- κ B. Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 ( xref , xref )."

reach
"Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 (XREF_FIG, XREF_SUPPLEMENTARY)."
TNF-RSC affects CYLD
| 2
CYLD binds TNF-RSC. 2 / 2
| 2

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

reach
"CYLD Recruitment to the TNF-RSC Requires LUBAC, but Not M1-Ubiquitin."
STUB1 affects CYLD
| 1 1
| 1 1

sparser
"We next examined whether CYLD directly interacts with CHIP by performing co-immunoprecipitation experiments."

reach
"We next examined whether CYLD directly interacts with CHIP by performing co-immunoprecipitation experiments."
SRF affects CYLD
| 2
SRF decreases the amount of CYLD. 2 / 2
| 2

reach
"Knockdown of SRF by siRNA significantly reduced levels of CYLD, indicating that CYLD expression is regulated by SRF."

reach
"Elimination of SRF by siRNA or inhibition of p38 MAPK reduced the expression level of CYLD and increased cell proliferation."
SPTAN1 affects CYLD
1 | 1
1 | 1

No evidence text available

sparser
"The PUB domain of HOIP reportedly binds p97 and DUBs, such as OTULIN and CYLD-SPTA2 ( xref , xref ), and here we determined that it also binds to the death domain of MALT1."
SOX2 affects CYLD
| 2
SOX2 increases the amount of CYLD. 2 / 2
| 2

reach
"In conclusion, SOX2, CCAT1 and EGFR proved to be upstream of miR-222-5p such that SOX2 downregulation repressed HCC cell progression and increased CYLD expression through downregulating CCAT1, EGFR, and miR-222-5p."

reach
"SOX2 silencing decreased CCAT1, EGFR, and miR-222-5p expression but increased CYLD expression."
Radiation, Ionizing phosphorylates CYLD on S418. 2 / 2
| 2

sparser
"This revealed that IR-induced CYLD Ser-418 phosphorylation peaked ~1 hour after IR treatment and remained detectable at least 6 hours afterwards ( xref )."

sparser
"This revealed that IR-induced CYLD Ser-418 phosphorylation peaked ∼1 hr after IR treatment and remained detectable at least 6 hr afterwards ( Figure 4 B)."
RIPK1 affects MIB2
| 2
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
RHOA affects CYLD
| 1
| 1

sparser
"Mechanistically, CYLD does not interact with RhoA; instead, it interacts with and deubiquitinates leukemia-associated RhoGEF (LARG)."
OTULIN affects Trim14
| 2
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
NMRAL1 affects TNFAIP3
| 1 1
| 1 1

sparser
"Several DUBs, including A20, CYLD and USP7, have been reported to downregulate NF- κ B. Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 ( xref , xref )."

reach
"Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 (XREF_FIG, XREF_SUPPLEMENTARY)."
MicroRNA-301b affects CYLD
| 2
MicroRNA-301b inhibits CYLD. 2 / 2
| 2

reach
"MicroRNA-301b promotes cell proliferation in TNBC by targeting CYLD."

reach
"MicroRNA-301b promotes cell proliferation and apoptosis resistance in triple negative breast cancer by targeting CYLD."
MIB2 affects RIPK1
| 2
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
MAPK affects CYLD
| 2
MAPK increases the amount of CYLD. 2 / 2
| 2

reach
"Interestingly, we found that pharmacological inhibition of the ERK and mitogen activated protein kinase (MAPK) cascade induced an almost complete loss of Snail1 mRNA expression and significantly increased CYLD mRNA levels in melanoma cells (XREF_FIG)."

reach
"Interestingly, we found that pharmacological inhibition of the ERK and mitogen activated protein kinase (MAPK) cascade induced an almost complete loss of Snail1 mRNA expression and significantly increased CYLD mRNA levels in melanoma cells (XREF_FIG)."
K63 affects DDX58
| 2
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
IL6 affects CYLD
| 2
IL6 activates CYLD. 2 / 2
| 2

reach
"In addition to pathogen control, the production of listericidal ROS and NO as well as the cytokines IL-6 and IL-12 were significantly increased in IFN-gamma-treated Lm infected Cyld -/- BMDM."

reach
"In good agreement, we also observed that increased IL-6 production of Cyld -/- mice upon high-dose Lm infection correlated with an augmented recruitment of neutrophils causing an improved control of Lm in the liver."
IL1B affects CYLD
| 2
IL1B activates CYLD. 2 / 2
| 2

reach
"In detail, both SPATA2 and CYLD were induced by TNF-alpha and IL-1beta (but not FSH) after 3hours."

reach
"On the other hand, CYLD also acts as a mediator of immune activation and inflammation.38, 39 We found that both SPATA2 and CYLD are induced by TNF-alpha and IL-1beta in vitro, indicating a similar regulation in OC."
Gram affects CYLD
| 2
Gram increases the amount of CYLD. 2 / 2
| 2

reach
"Such a function of CYLD was suggested by the finding that the expression of CYLD is induced by proinflammatory cytokines, TNF-alpha and IL-1beta, and the Gram negative bacterium Haemophilus influenzae."

reach
"Indeed, both TNF-alpha and non typeable Haemophilus influenzae (NTHi), a common Gram negative bacterial pathogen that causes respiratory infections, can upregulate CYLD expression, suggesting that CYL[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
GST affects CYLD
| 2
| 2

sparser
"GSTCyld but not GST alone precipitated His—NLRP6, confirming a direct Cyld—NLRP6 interaction ( xref )."

sparser
"To test whether the Cyld—NLRP6 interaction was direct, we performed pulldown assays using GSTCyld and His—NLRP6."
FGL2 affects CYLD
2 |
2 |

No evidence text available

No evidence text available
DDX58 affects K63
| 2
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
CYLD affects recovery
| 2
CYLD inhibits recovery. 2 / 2
| 2

eidos
"For patients who are expected to slower recovery due to high CYLD expression , additional treatment may be considered ."

eidos
"Furthermore , as mentioned above , low CYLD expression may promote cell proliferation and accelerate recovery ."
CYLD affects polyubiquitin chains
| 2
CYLD deubiquitinates polyubiquitin chains on K63. 2 / 2
| 2

reach
"The tumor suppressor cylindromatosis (CYLD) inhibits NFkappaB activation by deubiquitinating K63 polyubiquitin chains on TRAF2, TRAF6, and NEMO [15-17]."

reach
"Moreover, additional studies showed that CYLD specifically deubiquitinates polyubiquitin chains at K63 of different substrates (e.g., TRAF2 and TRAF6), or tyrosine kinase receptors such as TrkA."
CYLD affects p38 mitogen-activated protein kinase
| 2
CYLD activates p38 mitogen-activated protein kinase. 2 / 2
| 2

reach
"By using CYLD knock-out mice, a recent study shows that in TGF-beta-treated T cells, CYLD deficiency causes enhanced TAK1 and p38 mitogen activated protein kinase activities."

reach
"In an analysis of the mechanism of this finding, we noted first that TGF-beta-stimulated T cells lacking CYLD exhibit increased TAK1 and p38 mitogen activated protein kinase (MAP kinase) activity."
CYLD affects mTORC1
| 1 1
| 1 1

sparser
"The adverse phenotypes observed in 2-week TAC-CR-CYLD mice were reminiscent of those in CR-mTOR KO mice, including inhibited p-p70S6K, accumulated autophagic vacuoles with undegraded contents, cardiomyocyte death, and cardiac dysfunction [ xref ], supporting the axis of CYLDmTORC1 inactivation–autolysosome efflux inhibition–cardiomyocyte death in PO-hearts."

reach
"Thus, except aforementioned K63 deubiquitination of mTOR and Rab7, the potential of TRIM28 or TRIMP37 and CYLD interaction in mTORC1 reactivation and suppressing autolysosome efflux in the heart deserves further investigation."
CYLD affects initiation necroptosis
| 2
CYLD inhibits initiation necroptosis. 2 / 2
| 2

eidos
"FLIPL and caspase-8 form a heterodimer to cleave RIPK1 , RIPK3 and CYLD , which inhibit the initiation of necroptosis ."

eidos
"In general , when the activity of caspase-8 is present , FLIPL and caspase-8 combine with each other to form a heterodimer to cleave RIPK1 , RIPK3 and CYLD , which prevents the initiation of necroptosis ( 51 ) ."
CYLD affects factor 2
| 2
CYLD binds factor 2. 2 / 2
| 2

sparser
"CYLD also interacts directly with tumor-necrosis factor receptor (TNFR)-associated factor 2 (TRAF2), an adaptor molecule involved in signaling by members of the family of TNF/nerve growth factor receptors [ xref ]."

sparser
"CYLD also interacts directly with tumour-necrosis factor receptor (TNFR)-associated factor 2 (TRAF2), an adaptor molecule involved in signalling by members of the family of TNF/nerve growth factor receptors."
CYLD affects dioxygen
| 2
| 2

reach
"Upon in vitro infection with Lm, CYLD reduced NF-kappaB-dependent production of reactive oxygen species, interleukin (IL) -6 secretion, and control of bacteria in macrophages."

reach
"The CYLD deficiency induced suppression of reactive oxygen species (ROS) formation, death and hypertrophy in cardiomyocytes was blocked by additional knockdown of Nrf2."
CYLD affects YWHAB
2 |
2 |

No evidence text available

No evidence text available
CYLD affects TUBA4A
1 | 1
1 | 1

sparser
"This increase was accompanied by enhanced association of CYLD with acetylated α-tubulin ( xref )."

No evidence text available
CYLD affects TNF-RSC
| 2
CYLD binds TNF-RSC. 2 / 2
| 2

reach
"Recruitment of CYLD, HOIP and Sharpin to TNF-RSC in response to TNFalpha was not affected in RIPK1 S321A (A/A) MEFs."

reach
"CYLD Recruitment to the TNF-RSC Requires LUBAC, but Not M1-Ubiquitin."
CYLD affects TLR3
| 2
CYLD inhibits TLR3. 2 / 2
| 2

reach
"However, the specific CYLD target modulating TLR3 and TLR4 responses remains to be determined XREF_BIBR (Sidebar A)."

reach
"Cylindromatosis (CYLD), a Deubiquitinase, Attenuates Inflammatory Signaling Pathways by Activating Toll Like Receptor 3 in Human Mesangial Cells."
CYLD affects STUB1
| 1 1
| 1 1

sparser
"We next examined whether CYLD directly interacts with CHIP by performing co-immunoprecipitation experiments."

reach
"We next examined whether CYLD directly interacts with CHIP by performing co-immunoprecipitation experiments."
CYLD affects SPTAN1
1 | 1
1 | 1

No evidence text available

sparser
"The PUB domain of HOIP reportedly binds p97 and DUBs, such as OTULIN and CYLD-SPTA2 ( xref , xref ), and here we determined that it also binds to the death domain of MALT1."
CYLD affects RNF31, and Trim14
| 2
| 2

sparser
"CYLD‐deficient mice have less pronounced phenotypes as compared to A20 xref , xref , and the gene is not substantially induced by NF‐κB. Interestingly, CYLD also binds the HOIP PUB and B‐box domains despite lacking a discernible PIM."

sparser
"It was striking that while CYLD was unable to form a stable complex with the PUB domain of HOIP, it instead interacted with the PUB domain in SPATA2 ( xref D, 1K, and xref B)."
CYLD affects Proteasome
| 1
| 1

reach
"Consequently, CYLD actively prevented the proteasome-mediated degradation of STING and sustained antiviral responses in innate immunity.Notably, the STING signaling pathway plays a crucial role in dampening cancer development."
CYLD affects OTULIN, RNF31, and Trim14
| 2
| 2

sparser
"A HOIP PUB mutant, which cannot interact with CYLD or OTULIN, activates NF-κB more prominently than HOIP wild type, confirming a critical role of CYLD and OTULIN as negative regulators."

sparser
"Our analysis of LUBAC obtained from non-stimulated cells confirmed previous reports that CYLD and OTULIN bind to the PUB domain of HOIP ( xref )."
CYLD affects NPC
| 2
CYLD inhibits NPC. 2 / 2
| 2

reach
"It has been confirmed by functional analysis that both NFKBIA and CYLD inhibited the growth of NPC cells and that mutations in these genes resulted in NF‐kB activation."

reach
"CYLD overexpression strongly suppressed the growth, proliferation, metastasis, and migration of NPC cells [135]."
CYLD affects NMRAL1, and TNFAIP3
| 1 1
| 1 1

sparser
"Several DUBs, including A20, CYLD and USP7, have been reported to downregulate NF- κ B. Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 ( xref , xref )."

reach
"Co-IP assays were thus carried out to examine the interactions between these enzymes and HSCARG, and the results showed that HSCARG interacts weakly with A20 or CYLD but strongly interacts with USP7 (XREF_FIG, XREF_SUPPLEMENTARY)."
CYLD affects NFASC
| 2
CYLD activates NFASC. 2 / 2
| 2

reach
"MiR-30a potentially was contributed to cisplatin resistance in GC through down regulating CYLD which leads to NFκB activation and up regulation of the downstream targets such as BIRC5 and Livin [23]."

reach
"For example, CYLD is a DUB, which specifically cleaves K63 polyubiquitin chains.29, 84 CYLD has the capability to inhibit IL‐1, TNF and bacterial lipid polysaccharide‐induced activation of NF‐κB."
CYLD affects MIB2, and RIPK1
| 2
RIPK1 binds CYLD and MIB2. 2 / 2
| 2

sparser
"Indeed, MIB2 constitutively bound RIPK1 and CYLD before and after TNF stimulation."

sparser
"Consistent with the result in Supplementary Fig.  xref , cFLIP L was released from MIB2, but RIPK1 and CYLD still bound MIB2 8 h after TNF stimulation (Fig.  xref )."
CYLD affects K63-
| 2
CYLD inhibits K63-. 2 / 2
| 2

reach
"CYLD, another DUB, is reported to limit NF-kappaB activation by removing K63- and M1 linked poly-ubiquitin chains on several complex I components (including TRAF2, NEMO and RIPK1), thereby disrupting the ubiquitin scaffold required for the recruitment and activation of the TAB2/3-TAK 1 and NEMO-IKKalpha-IKKbeta complexes [XREF_BIBR, XREF_BIBR - XREF_BIBR]."

reach
"Previous studies report that CYLD negatively regulates NF-kappaB signaling by removing K63- and M1 linked polyubiquitin chains from key signaling molecules, including NF-kappaB essential modulator, tumor necrosis factor (TNF)-associated factor (TRAF) 2, TRAF6, and Receptor interacting serine/threonine protein kinase 1, in familial cylindromatosis tumors."
CYLD affects K63
| 2
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
CYLD affects IL18
| 2
CYLD inhibits IL18. 2 / 2
| 2

eidos
"Further , the abundance of IL-18 in the colonic mucosa negatively correlates with CYLD expression in patients with IBD , suggesting that reduced CYLD expression results in elevated IL-18 and contributes to the pathogenesis of IBDs ."

eidos
"For the regulation of the NLRP6 inflammasome , Mukherjee et al. [ 107 ] found that the assembly of this inflammasome was regulated by deubiquitinase Cyld , which mediates deubiquitination of NLRP6 ; as a consequence , Cyld inhibits NLRP6-ASC assembly and IL-18 production ."
CYLD affects HES1
| 2
CYLD binds HES1. 2 / 2
| 2

sparser
"Using a conventional ChIP assay in human Hes1 + T-ALL cells and a Hes1 antibody followed by PCR with specific primers flanking the identified putative N-box sites, we were able to show that endogenous Hes1 binds to the predicted PRO2 site in the CYLD 5’UTR ( xref ) and this association was lost following Hes1 knock-down ( xref ) as measured by qPCR."

sparser
"Endogenous Hes1 protein could bind the CYLD promoter in T-ALL cells, and the CYLD expression levels were found to be significantly decreased in most human primary T-ALL samples analyzed."
CYLD affects GST
| 2
| 2

sparser
"GSTCyld but not GST alone precipitated His—NLRP6, confirming a direct Cyld—NLRP6 interaction ( xref )."

sparser
"To test whether the Cyld—NLRP6 interaction was direct, we performed pulldown assays using GSTCyld and His—NLRP6."
CYLD affects FOS
| 1
CYLD decreases the amount of FOS. 1 / 2
| 1

reach
"More recent studies have further confirmed that CYLD knockdown significantly increased c-Fos expression in cells transduced to express both wild-type and mutant p62, without necessitating RANKL stimulation."
CYLD affects FGL2
2 |
2 |

No evidence text available

No evidence text available
CYLD affects ELF4
| 2
CYLD inhibits ELF4. 2 / 2
| 2

reach
"Moreover, an increase in CYLD levels reduces the proliferation rate of MEF cells."

reach
"These results suggest that loss of CYLD mediates proliferation and not survival in MEF cells."
CYLD affects EDA2R
| 1
CYLD inhibits EDA2R. 1 / 2
| 1

reach
"CYLD inhibits activation of NF-kappaB by the TNFR family members CD40, XEDAR and EDAR in a manner that depends on the deubiquitinating activity of CYLD."
CYLD affects DDX58, and K63
| 2
DDX58 binds CYLD and K63. 2 / 2
| 2

reach
"Ubiquitin carboxyl-terminal hydrolase CYLD, a de-ubiquitination enzyme, physically interacts with RIG-I and removes its K63 linked polyubiquitin chains to attenuate antiviral activity XREF_BIBR."

reach
"In a yeast two-hybrid screen, SDC4 was identified as a RIG-I interacting protein that promotes the binding of RIG-I with CYLD in order to decrease K63-linked ubiquitination (Lin et al., 2016)."
CYLD affects CD274
| 2
CYLD decreases the amount of CD274. 2 / 2
| 2

reach
"CYLD knockdown upregulated IFN-gamma mediated activation of the STAT1 and IRF1 axis, which in turn induced PD-L1 expression."

reach
"CYLD knockdown significantly enhanced the expression of PD-L1 in presence of IFN-gamma stimulation in most TET cell lines."
CYLD affects CC2D1A
| 1
CYLD inhibits CC2D1A. 1 / 2
| 1

reach
"Deubiquitination Enzyme CYLD Negatively Regulates CC2D1A."
CXXC1 affects CYLD
| 2
CXXC1 methylates CYLD. 2 / 2
| 2

sparser
"Second, to explore the role of CpG methylation in down-regulation PSMA in EAC, we evaluated PSMA CpG island methylation using methylation-specific PCR in cells lines and in a subset of patients' samples."

sparser
"In total, 52590 CpG sites were differentially methylated in EAC compared with NSE; 35045 sites were associated with genes."
CD8 affects CYLD
| 2
CD8 inhibits CYLD. 2 / 2
| 2

reach
"However, the parasite load in the CD8 + T cell depleted Cyld -/- mice was always lower compared to CD8 + T cell depleted WT mice, indicating that in addition to the contribution of CD8 + T cells the enhanced parasite control in the Cyld -/- mice is also mediated by other cell types, likely Cyld -/- macrophages and granulocytes."

reach
"Although our CD8 + T cell depletion experiments show the importance of CD8 + T cells in the control of PbA blood parasites, CD8 + T cell depleted Cyld -/- mice harbored lower parasite loads compared to CD8 + T cell depleted WT mice, indicating that the enhanced parasite control in the Cyld -/- mice is also mediated by other immune cells in addition to CD8 + T cells."
BTK inhibitors affects CYLD
| 2
BTK inhibitors inhibits CYLD. 2 / 2
| 2

reach
"BTK inhibitors induced CYLD dependent apoptosis in non-GCB-DLBCL cell lines."

reach
"In addition, we found that knocking down CYLD in rituximab resistant non-GCB-DLBCL cells would attenuate this BTK inhibitors induced apoptosis, consequently, further confirmed that this BTK inhibitors induced CYLD dependent apoptosis in rituximab resistant non-GCB-DLBCL."