IndraLab

Statements


COPS6 affects COPS5
18 3 | 24 38
COPS6 binds COPS5.
18 3 | 24 37
18 3 | 21 28

sparser
"Binding of capzimin and CSN5i-3 to monomeric CSN5 and CSN5-CSN6 heterodimer."

No evidence text available

sparser
"Interaction of the complex with a NEDDylated CRL leads to a series of conformational change events in Csn2, Csn4 and Csn7, triggering rearrangements in the Csn5Csn6 dimer, resulting in Csn5 activation by priming the Csn5 JAMM/MPN + motif for deNEDDylation [ xref , xref ]."

sparser
"In the crystal structure of CSN5-CSN6 heterodimer, initial Ins-1 loop (98–109) conformation blocks the distal ubiquitin binding site which we also observed in cryo-EM structure of Rpn11."

sparser
"The association of the 1–257 and 31–211 domains of CSN5 and CSN6, amenable to soluble bacterial expression, referred to as CSN5 ΔC and CSN6 Δ , respectively ( xref , xref ) was probed by ITC experiments."

reach
"These data suggests a hierarchy in the catalytic activity over the enzymatic system and the substrate type, with the inactive CSN5 DeltaC, WT form, CSN5 DeltaC, R106T that has basal activity, the MPN heterodimer alone that has robust isopeptidase activity on non physiological substrates and the CSN5 and CSN6 heterodimer in the context of CSN that recapitulates strong activity on both non physiological and physiological substrates."

sparser
"This may be the reason behind lower flexibility of Ins-1 loop in the monomeric CSN5 compared to the CSN6 bound CSN5."

sparser
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation xref ."

sparser
"Therefore, to characterise further this complex, we probed the association of CSN5 ΔC and CSN6 ΔC by NMR to help define the regions responsible for the interaction."

reach
"Structural and Biochemical Characterization of the Cop9 Signalosome CSN5 and CSN6 Heterodimer."
| 3

sparser
"The association of CSN5 and CSN6 MPN (for Mpr1/Pad1 N-terminal) domains activates its isopeptidase activity."

sparser
"Here we report that CSN6 N-terminal domain containing its MPN domain can form a stable heterodimer with CSN5 catalytic domain in vitro ."

sparser
"CSN5 alone is inactive due to an auto-inhibited conformation of its catalytic domain, and the association of CSN5 with the CSN6 MPN (Mpr1/Pad1 N-terminal) domain activates its isopeptidase activity xref ."
COPS6 binds COPS5 and MPN domain. 3 / 3
| 3

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation (Lingaraju et al., 2014)."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation 55."
COPS6 binds COPS5 and CSN3. 3 / 3
| 3

sparser
"Our data also demonstrate that CSNAP binds to CSN3, CSN5 and CSN6, possibly linking the MPN and PCI substructures."

sparser
"CSNAP interacts with CSN3, CSN5, and CSN6."

sparser
"We show that CSNAP binds CSN3, CSN5 and CSN6 and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
| 2

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N terminal) () subunits, CSN5 and CSN6."

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N-terminal) ( xref ; xref ; xref ) subunits, CSN5 and CSN6."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
COPS6 activates COPS5.
| 1
COPS6 activates COPS5. 1 / 2
| 1

sparser
"To gain additional insights into the molecular mechanism of CSN5 activation by CSN6, the crystal structure of the MPN − core fragment was determined by molecular replacement at 1.76 Å resolution, using the human Rpn8 ΔC orthologue as the search model (PDB code 2O95; xref )."
COPS6 is modified
| 1 23 10
COPS6 is phosphorylated.
| 1 21 10
COPS6 is phosphorylated. 10 / 20
| 1 14 5

sparser
"Treatment with calf intestinal alkaline phosphatase (CIP) reduced the EGF-induced steady-state expression of CSN6, indicating that CSN6 phosphorylation is required in this process ( xref ) and presumably acts through ERK."

sparser
"Treatment with calf intestinal alkaline phosphatase (CIP) reduced the EGF-induced steady-state expression of CSN6, indicating that CSN6 phosphorylation is required in this process (B) and presumably a[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Together, these results indicate that EGF/ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover."

rlimsp
"PI3K/Akt inhibitor L294002 reduced the S60 phosphorylation level of CSN6 and caused subsequent E6AP downregulation (Figure 6B)."

reach
"These data imply that CSN6 possibly regulates the gene expression of SGOC genes and impacts SGOC amino acid metabolism through its negative impact on FOXO4 that transcriptionally suppresses the gene expression of SGOC genes.2.6 PKB/Akt-Mediated CSN6 Phosphorylation Enhances COP1-Regulated FOXO4 Ubiquitination and Subsequent Elevation of SGOC Genes."

rlimsp
"Furthermore, we found that EGF treatment increased the S60 phosphorylation level of CSN6 (Figure 6B) with concurrent Akt phosphorylation."

sparser
"These results indicate that PKB/Akt‐mediated CSN6 phosphorylation is critical in stabilizing COP1, thereby enhancing ubiquitination level of FOXO4."

sparser
"To confirm the existence of an ERK-specific phosphorylation site in CSN6 in vivo, we used an anti-phospho-serine antibody to detect the increase of serine-phosphorylated CSN6 in EGF-treated cells (D)."

rlimsp
"ERK2-Dependent Phosphorylation of CSN6 Is Critical in Colorectal Cancer Development."

sparser
"To determine the biological significance of CSN6 phosphorylation, we transiently transfected DLD-1 cells with WT CSN6 or CSN6S 148A plasmid and measured their growth."
COPS6 is phosphorylated on S60. 8 / 8
| 4 4

rlimsp
"CSN6 S60 phosphorylation is known to increase the stability of CSN6 [21]."

sparser
"First, we have shown that S60 of CSN6 can be phosphorylated by PKB/Akt [ xref ] and that PKB/Akt enhances the steady‐state expression of CSN6. [ xref ] This S60 site is located in CSN6's MPN ( M pr1p and P ad1p N ‐terminal) domain, a domain found in the N‐terminus of yeast Mpr1 and Pad1 proteins. [ xref , xref , xref ] MPN domain contains polar residues that resemble the active site residues of metalloproteases [ xref ] and is involved in a proteasome‐associated deneddylation activity. [ xref ] Also the MPN domain is involved in heterodimerization between CSN6 and CSN5 to regulate Cullin neddylation. [ xref ] How S60 phosphorylation participates in any activity of the MPN domain remains to be identified."

sparser
"S60 of CSN6 is phosphorylated by PKB/Akt [ xref ] and is critical for CSN6 stabilization."

sparser
"Our mechanistic studies showed that EGF/Akt-mediated CSN6 S60 phosphorylation and subse quent stabilization of E6AP thereby causing p53 downregulation and promoting cell proliferation, cell transformation as well as tumorigenesis (Figure xref )."

rlimsp
"Akt is able to associate with CSN6 and phosphorylate it at Ser60, which can reduce the ubiquitin-mediated protein degradation and turnover rate of CSN6, thereby increasing steady-state expression of CSN6."

sparser
"CSN6 S60 phosphorylation is known to increase the stability of CSN6 [ xref ]."

rlimsp
"Our mechanistic studies showed that EGF/Akt-mediated CSN6 S60 phosphorylation and subse quent stabilization of E6AP thereby causing p53 downregulation and promoting cell proliferation, cell transformation as well as tumorigenesis (Figure 8)."

rlimsp
"Mechanistic studies show that Akt causes CSN6 phosphorylation at Ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of CSN6."
COPS6 is phosphorylated on S148. 4 / 4
| 3 1

rlimsp
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163/Val165 and phosphorylates CSN6 at Ser148."

sparser
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163/Val165 and phosphorylates CSN6 at Ser148."

sparser
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163/Val165 and phosphorylates CSN6 at Ser148."

sparser
"The EGF-ERK2 Axis Phosphorylates CSN6 on S148 and Enhances CSN6 Stabilization."
COPS6 is ubiquitinated.
| 2
COPS6 is ubiquitinated. 2 / 2
| 2

sparser
"Together, these results indicate that EGF/ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover."

sparser
"We assessed the ubiquitination of CSN6 in the presence of EGF and found that EGF reduced the ubiquitination level of WT CSN6 but not that of the CSN6 S148A mutant (G)."
COPS6 affects CTNNB1
| 28
COPS6 increases the amount of CTNNB1.
| 10
COPS6 increases the amount of CTNNB1. 7 / 8
| 7

reach
"In line with this finding, western blotting revealed that knockdown of CSN6 by shRNA decreased the expression of beta-catenin and increased the expression of beta-Trcp."

reach
"CSN6 positively regulates beta-catenin expression in a beta-Trcp-dependent manner and triggers the expression of several EMT related genes regulated by beta-catenin."

reach
"CSN6 increased the steady-state expression of beta-catenin in a dose dependent manner while downregulating beta-Trcp (XREF_FIG)."

reach
"CSN6 positively regulated beta-catenin expression in a beta-Trcp-dependent manner and triggered expression of several EMT related genes regulated by beta-catenin."

reach
"CSN6 positively regulates beta-catenin expression."

reach
"CSN6 increased the steady-state expression of beta-catenin in a dose dependent manner while downregulating beta-Trcp."

reach
"Together, the results suggest that CSN6 may positively regulate beta-catenin transcription, thereby mediating the EMT."
Modified COPS6 increases the amount of CTNNB1. 3 / 3
| 3

reach
"Overexpression of CSN6 could increase the expression of beta-catenin target genes (XREF_SUPPLEMENTARY)."

reach
"Overexpression of CSN6 could increase the expression of beta-catenin target genes."

reach
"Furthermore, continuous knockdown of CSN6 expression in K1 and PTC cells decreased the beta-catenin protein levels, whereas the restoration of beta-catenin expression using an expression vector (Cat-pcDNA, Cat) increased expression of both vimentin mRNA and protein to some extent."
COPS6 activates CTNNB1.
| 9
COPS6 activates CTNNB1. 9 / 9
| 9

reach
"Because KRAS is an upstream regulator of these two pathways, KRAS mutations will continue to activate both RAS-MAPK and AKT pathways to stabilize CSN6, which in turn activates beta-catenin activity to cause pathogenesis in colon cancer."

reach
"Here, we provided another example of CSN6 preserved Cullin neddylation in affecting another F-box protein -- beta-Trcp and showed how CSN6 can destabilize beta-Trcp and subsequently increase the stability of beta-catenin."

reach
"The TOP-FLASH TCF/LEF -1 luciferase reporter gene analyses showed that Flag-CSN6 significantly increased beta-catenin transactivation, but the activity of Flag-CSN6-S148A was compromised."

reach
"Furthermore, we demonstrate that CSN6 enhances beta-catenin stability and that the CSN6 associated protein beta-Trcp negatively regulates beta-catenin stability."

reach
"CSN6 Positively Regulates beta-Catenin Protein Stability and Facilitates the Transcriptional Activity of beta-Catenin."

reach
"Given that CSN6 positively regulates beta-catenin by regulating beta-Trcp ubiquitination, 41 CSN6 may also regulate ALDH1A1 expression through the beta-catenin pathway."

reach
"The TOP-FLASH TCF/LEF -1 luciferase reporter gene analyses showed that Flag-CSN6 significantly increased beta-catenin transactivation but the activity of Flag-CSN6-S148A was compromised (XREF_FIG)."

reach
"Downregulation of CSN6 attenuates papillary thyroid carcinoma progression by reducing Wnt and beta-catenin signaling and sensitizes cancer cells to FH535 therapy."

reach
"CSN6 positively regulates beta-catenin protein stability and facilities the EMT in PTC cells."
COPS6 inhibits CTNNB1.
| 6
COPS6 inhibits CTNNB1. 6 / 6
| 6

reach
"The CSN6 knockdown mediated beta-catenin destabilization translated into beta-catenin 's reduced transcriptional activity, as evidenced by qRT-PCR findings showing diminished expression of beta-cateni[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Furthermore, we demonstrate that CSN6 enhances beta-catenin stability and that the CSN6 associated protein beta-Trcp negatively regulates beta-catenin stability."

reach
"As expected, we found that the beta-catenin level decreased and that of beta-Trcp increased when cells were treated with CSN6-shRNA (CSN6 knockdown) (Fig XREF_FIG A and B)."

reach
"CSN6 overexpression reduced the turnover rate of beta-catenin and increased the turnover rate of beta-Trcp."

reach
"CSN6 overexpression reduced the turnover rate of beta-catenin and increased the turnover rate of beta-Trcp (XREF_FIG)."

reach
"The CSN6 knockdown mediated beta-catenin destabilization translated into beta-catenin 's reduced transcriptional activity, as evidenced by qRT-PCR findings showing diminished expression of beta-catenin target genes, including myc, cyclin D, and vascular endothelial growth factor (XREF_FIG)."
COPS6 decreases the amount of CTNNB1.
| 3
COPS6 decreases the amount of CTNNB1. 3 / 3
| 3

reach
"Furthermore, CSN6 increased the ubiquitination level of beta-Trcp and reduced the ubiquitination level of beta-catenin (XREF_FIG)."

reach
"Furthermore, CSN6 increased the ubiquitination level of beta-Trcp and reduced the ubiquitination level of beta-catenin."

reach
"Congruently, CSN6 knockdown xenograft tumors had elevated beta-Trcp and diminished beta-catenin expression and a slower growth rate."
COPS6 affects FOXO4
| 3 14 11
COPS6 binds FOXO4.
| 1 10
| 1 9

sparser
"Thus, these data suggest a link of CSN6FOXO4 axis and ser/gly metabolism."

sparser
"Together, the regulatory circuit of CSN6FOXO4 axis could be recapitulated in mouse xenograft cancer model, and level of FOXO4 deregulation plays roles in affecting the outcome of tumorigenicity."

reach
"Mechanistic studies show that CSN6 binds and regulates FOXO4 stability through enhancing the E3 ligase activity of COP1, and that COP1 directly interacts with FOXO4 through a VP motif on FOXO4 and accelerates the ubiquitin-mediated degradation of FOXO4."

sparser
"Deregulation of CSN6FOXO4 Axis Rewires Metabolic Programming via Enhancing Glucose Uptake and Promotes the Expression of SGOC Genes."

sparser
"Significantly, as the CSN6FOXO4 axis is crucial in regulating gene expression of Glut1 and SGOC genes, these genes were reduced in CSN6 knockdown tumors (Figure S17E, Supporting Information)."

sparser
"These data suggested that CSN6FOXO4 axis deregulation could exist in many types of cancer."

sparser
"As CSN6FOXO4 axis impacts on the expression of Glut1, biochemical assays that quantitates the glucose uptake (consumption) by assessing uptake of (2‐( N ‐(7‐nitrobenz‐2‐oxa‐1,3‐diazol‐4‐yl)amino)‐2‐deoxyglucose (2‐NBDG)), a green fluorescent glucose analog, additionally demonstrated that CSN6 knockdown inhibited 2‐NBDG uptake (Figure  xref ), while FOXO4 knockdown increased 2‐NBDG uptake (Figure  xref )."

sparser
"CSN6FOXO4 Axis Is Critical for Tumorigenicity in Xenograft Mouse Model."

sparser
"We further confirmed that CSN6FOXO4 link could affect cell proliferation."

sparser
"Results showed that FOXO4 bound to the C‐terminus of CSN6 (aa 185‐327 containing) but not to the N‐terminus (aa 1‐184, containing the MPN domain; Figure  xref )."
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
COPS6 inhibits FOXO4.
| 3 6
COPS6 inhibits FOXO4. 9 / 9
| 3 6

eidos
"] Our data indicates that CSN6 enhances ubiquitin-mediated degradation of FOXO4 through K48 link ubiquitination , thereby downregulating FOXO4 ."

reach
"We further investigate how CSN6 downregulates FOXO4."

eidos
"We further investigate how CSN6 downregulates FOXO4 ."

reach
"We have shown that CSN6 decreases FOXO4 stability."

eidos
"As CSN6 mitigates the expression level of FOXO4 , we showed that CSN6 overexpression leads to increased gene expression of Glut1 ( Figure 5F , Figure S15A , Supporting Information ) ."

reach
"2.1 EGF Signal and CSN6/COP1 Enhance Ubiquitin-Mediated Degradation of FOXO4."

reach
"Importantly, EGF‐mediated down regulation of FOXO4 can be reversed by the knockdown of CSN6 (Figure 1D), suggesting the involvement of CSN6 during this process."

reach
"Since MDM2 was shown as an E3 ligase for FOXO4 proteins, 33 , 34 we examined whether MDM2 is involved in CSN6‐mediated FOXO4 degradation."

reach
"39 Our studies show that constitutively active mutant FOXO4A3, 41 an PKB/Akt phosphorylation mutant of FOXO4, is still sensitive to CSN6/COP1‐mediated degradation, suggesting that CSN6/COP1‐mediated FOXO4 degradation is not similar to the action mode of Skp2 or MDM2."
COPS6 decreases the amount of FOXO4.
| 3
COPS6 decreases the amount of FOXO4. 3 / 3
| 3

reach
"In line with this finding, Western blotting showed that knockdown of CSN6 by shRNA increased the steady‐state expression of FOXO4 (Figure 1F)."

reach
"We then found that CSN6 decreased the steady‐state expression of FOXO4 in a dose‐dependent manner in several CRC cell lines (Figure 1E, Figure S2A, Supporting Information)."

reach
"In contrast, protein analysis demonstrated that CSN6 knockdown reduced the expression of Glut1 while increased the expression of FOXO4 (Figure 5F)."
COPS6 ubiquitinates FOXO4.
| 1 1
COPS6 leads to the ubiquitination of FOXO4. 2 / 2
| 1 1

reach
"As expected, wt FOXO4 ubiquitination was enhanced by CSN6."

sparser
"As expected, wt FOXO4 ubiquitination was enhanced by CSN6."
COPS6 activates FOXO4.
| 2
COPS6 activates FOXO4. 2 / 2
| 2

reach
"CSN6 overexpression increased the turnover rate of FOXO4 (Figure 2C, Figure S5C, Supporting Information)."

reach
"Interestingly, wt CSN6 increased the turnover rate of FOXO4 to destabilize FOXO4 in a dose‐dependent manner, while CSN6 S60A had lost such a capability (Figure 7C)."
COPS6 increases the amount of FOXO4.
| 1
COPS6 increases the amount of FOXO4. 1 / 1
| 1

reach
"We then found that CSN6 knockdown reduced the ubiquitination level of FOXO4 (Figure 2E), whereas overexpression of CSN6 increased the ubiquitination level of FOXO4 in a dose‐dependent manner (Figure 2E)."
COPS6 affects CARD16
| 10 17
COPS6 binds CARD16.
| 5 17
| 5 16

sparser
"Given that CSN6 associates with COP1 and that COP1 co-elutes with 14-3-3σ in gel filtration assays ( xref ), we reasoned that COP1 could be involved in CSN6-mediated 14-3-3σ ubiquitination."

reach
"Recently, CSN6 's interaction with COP1 is characterized in mammalian cells, and CSN6-COP1 axis is involved in 14-3-3sigma degradation [XREF_BIBR]."

sparser
"These observations led us to investigate the functional relevance of the interaction of CSN6 and COP1. xref shows that CSN6 associates with COP1 endogenously as assayed by co-ip and an In vitro binding assay confirms that CSN6 directly binds to COP1."

reach
"XREF_FIG shows that CSN6 associates with COP1 endogenously as assayed by co-ip and an In vitro binding assay confirms that CSN6 directly binds to COP1."

reach
"CSN6 can bind COP1, but the significance of this interaction is largely unknown.In this study, we characterize the upstream regulators of the FOXO4 in tumorigenesis including EGF, PKB/Akt, CSN6 and COP1."

sparser
"Importantly, CSN6 not only associates with COP1 but also prevents COP1’s self-ubiquitination, adding yet another layer of regulation."

sparser
"To address the significance of the CSN6 and COP1 interaction, we examined the impact of CSN6 on COP1 levels and noted that the steady-state level of COP1 increased when CSN6 was overexpressed ( xref )."

sparser
"To demonstrate the impact of CSN6COP1 axis in regulating FOXO4 and subsequent gene expression of SGOC genes in vivo, we performed mouse xenograft cancer studies and demonstrated that CSN6 knockdown suppressed tumor growth (Figure S17C, Supporting Information)."

sparser
"To further confirm the CSN6COP1 axis is involved in regulating FOXO4 ubiquitination, we investigate the ubiquitination level of FOXO4 (428VP→AA) mutant in the presence of CSN6."

sparser
"CSN6 can bind COP1, but the significance of this interaction is largely unknown."
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
COPS6 activates CARD16.
| 4
COPS6 activates CARD16. 3 / 3
| 3

reach
"Mechanistic studies show that CSN6 binds and regulates FOXO4 stability through enhancing the E3 ligase activity of COP1, and that COP1 directly interacts with FOXO4 through a VP motif on FOXO4 and accelerates the ubiquitin-mediated degradation of FOXO4."

reach
"These data imply that CSN6 possibly regulates the gene expression of SGOC genes and impacts SGOC amino acid metabolism through its negative impact on FOXO4 that transcriptionally suppresses the gene expression of SGOC genes.2.6 PKB/Akt-Mediated CSN6 Phosphorylation Enhances COP1-Regulated FOXO4 Ubiquitination and Subsequent Elevation of SGOC Genes."

reach
"The mRNA levels of COP1 were not affected by CSN6 expression in a real-time quantitative PCR analysis (XREF_SUPPLEMENTARY), suggesting that CSN6 up-regulates COP1 at the post-transcriptional level."
COPS6 bound to FOXO4 activates CARD16. 1 / 1
| 1

reach
"Mechanistic studies show that CSN6 binds and regulates FOXO4 stability through enhancing the E3 ligase activity of COP1, and that COP1 directly interacts with FOXO4 through a VP motif on FOXO4 and accelerates the ubiquitin-mediated degradation of FOXO4."
COPS6 inhibits CARD16.
| 1
COPS6 inhibits CARD16. 1 / 1
| 1

reach
"CSN6 deregulation impairs genome integrity in a COP1 dependent pathway."
COPS6 affects COPS4
14 4 | 1 6
14 4 | 1 5

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

reach
"Using yeast-two-hybrid assay, a strong interaction between mouse Csn4 and Csn6 was detected (XREF_SUPPLEMENTARY), in agreement with previous published data."

sparser
"Removal of the CSN6 Ins-2 loop has been shown in CSN–CRL1~N8 to disrupt the CSN4CSN6 interface, leading to sustained enzymatic activity of the CSN xref ."

No evidence text available

No evidence text available

No evidence text available

sparser
"The core of the subcomplex is based on a stable heterotrimeric association of CSN7, CSN4, and CSN6, requiring coexpression in a bacterial reconstitution system."

reach
"COP9 signalosome subunit 6 mediates PDGF -induced pulmonary arterial smooth muscle cells proliferation."

reach
"Thus, loss of CSN6 expression inhibits PTC proliferation and migration."

reach
"MTT and BrdU assays revealed that recovery of CSN6 expression rescued cell growth and proliferation."

reach
"In human breast cancer MCF-7 cells, COPS6 overexpression stimulated p-AKT expression as well as the proliferation and malignant transformation of tumor cells, whereas knockdown of COPS6 caused opposite effects."

reach
"Second, functional assays showed that CSN6 inhibition significantly reduced both the motility and the proliferation of PTC cells."

eidos
"In summary , these findings demonstrated that downregulation of CSN6 expression could inhibit cell proliferation , migration and invasion ."

reach
"Loss of CSN6 attenuates tumor proliferation and migration."

reach
"Through combinatorial effects on the MDM2-p53 signaling axis and now SKP2 mediated p57 Kip2 degradation, it is hypothesized that CSN6 overexpression can effectively promote cell proliferation by simultaneously relieving cell cycle restraints, apoptosis, senescence, and presumably p53 functions in DNA damage repair and cell metabolism, among other important tumor suppressive mechanisms."

reach
"CSN6 recovery rescued the cell proliferation, migration, and invasion of CSN6-knockdown melanoma cells."

reach
"In vitro and in vivo data showed that loss of CSN6 attenuated cell proliferation, migration, and invasion of PTC cells, confirming the vital function of CSN6 in PTC."

reach
"Because 14-3-3sigma suppresses CSN6 mediated cell proliferation and anchorage independent growth, we next examined the impact of 14-3-3sigma on CSN6 mediated tumor promotion."

reach
"In summary, these findings demonstrated that downregulation of CSN6 expression could inhibit cell proliferation, migration and invasion."
COPS6 affects MYC
| 21
COPS6 activates MYC.
| 8
COPS6 activates MYC. 8 / 9
| 8

reach
"We have shown that CSN6 increases Myc stability."

reach
"Furthermore, Fbxw7 deficiency compromised CSN6 shRNA enhanced Myc ubiquitination (XREF_FIG), suggesting that CSN6 mediated Myc stabilization is dependent on Fbxw7."

reach
"CSN6 mediated Myc stabilization translated to increased Myc transcriptional activity, as evidenced by increasing Myc luciferase reporter gene activity (XREF_FIG) and qRT-PCR for expression of Myc target genes, including CdC25A, Adm-1, and Odc-1 (XREF_FIG)."

reach
"CSN6 increase Myc stability by reducing Myc ubiquitination."

reach
"While CSN6 expression increased Myc transcriptional activity, CSN6 knockdown by shRNA reduced Myc transcriptional activity (XREF_FIG)."

reach
"Noticeably, reduced expression of Csn6 in Emicro-Myc background can also contribute to p53 stabilization in 33% of Emicro-Myc and Csn6 +/- lymphomas when compared with Emicro-Myc and Csn6 +/+, suggesting that both CSN6 mediated p53 downregulation and CSN6 mediated Myc elevation contribute to lymphomagenesis of this system (XREF_FIG)."

reach
"Thus our study has provided a novel mechanistic answer to how CSN6 can destabilize Fbxw7 and subsequently increase the stability of Myc."

reach
"Accordingly, CSN6 mediated Myc increases occurred only in HCT116 Fbxw7 +/+ cells (XREF_FIG)."
COPS6 inhibits MYC.
| 3
COPS6 inhibits MYC. 3 / 3
| 3

reach
"While CSN6 expression increased Myc transcriptional activity, CSN6 knockdown by shRNA reduced Myc transcriptional activity (XREF_FIG)."

reach
"Knockdown of CSN6 decreased the steady-state expression of Myc protein in HCT116 Fbxw7 +/+ but not in HCT116 Fbxw7 -/- cells (XREF_FIG)."

reach
"Compared with empty vector transfected control cells, cells transfected with CSN6 had a decelerated endogenous Myc turnover rate (XREF_FIG); the pulse chase analyses of over expressed Myc with CSN6 or with shRNA mediated CSN6 knockdown indicated that over expression of CSN6 stabilized Myc while shRNA-CSN6 increased Myc degradation (XREF_FIG)."
COPS6 increases the amount of MYC.
| 3
Modified COPS6 increases the amount of MYC. 2 / 2
| 2

reach
"Overexpression of CSN6 increased the mRNA levels of Myc transcriptional targets (CDC25A, cyclin D1, and Tert) and decreased the mRNA levels of Myc transcriptionally repressed genes (p27Kip1, CDKN2B, and p21Cip1), while loss of CSN6 reversed the expression of these Myc target genes."

reach
"Overexpression of CSN6 reduced the protein levels of Fbxw7alpha and increased Myc protein levels; while CSN6 knockdown by shRNA resulted in increased protein levels of Fbxw7alpha and decreased protein levels of Myc in two cell lines HCT116 and U2OS cells (XREF_FIG)."
COPS6 increases the amount of MYC. 1 / 1
| 1

reach
"Compared with wt CSN6, which clearly decreased Fbxw7 expression and increased Myc expression in U2OS cells, the MPN-KQV CSN6 mutant lost these functions (XREF_SUPPLEMENTARY)."
COPS6 ubiquitinates MYC.
| 2
COPS6 leads to the ubiquitination of MYC. 2 / 2
| 2

reach
"Because Myc is degraded through the ubiquitin pathway 38, we examined whether ubiquitination is involved and found that CSN6 overexpression inhibited Myc ubiquitination while shRNA-CSN6 increased Myc ubiquitination (XREF_FIG)."

reach
"Furthermore, Fbxw7 deficiency compromised CSN6 shRNA enhanced Myc ubiquitination (XREF_FIG), suggesting that CSN6 mediated Myc stabilization is dependent on Fbxw7."
COPS6 decreases the amount of MYC.
| 2
Modified COPS6 decreases the amount of MYC. 2 / 2
| 2

reach
"Overexpression of CSN6 increased the mRNA levels of Myc transcriptional targets (CDC25A, cyclin D1, and Tert) and decreased the mRNA levels of Myc transcriptionally repressed genes (p27Kip1, CDKN2B, and p21Cip1), while loss of CSN6 reversed the expression of these Myc target genes."

reach
"Overexpression of CSN6 reduced the protein levels of Fbxw7alpha and increased Myc protein levels; while CSN6 knockdown by shRNA resulted in increased protein levels of Fbxw7alpha and decreased protein levels of Myc in two cell lines HCT116 and U2OS cells (XREF_FIG)."
COPS6 binds MYC.
| 2
| 2

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."

reach
"These data show that the association between CSN6 and Myc is present in many types of human cancer, suggesting that the positive regulation of Myc by CSN6 may be a clinically relevant regulatory pathway in human cancers (XREF_FIG)."
COPS6 deubiquitinates MYC.
| 1
Modified COPS6 leads to the deubiquitination of MYC. 1 / 1
| 1

reach
"Because Myc is degraded through the ubiquitin pathway 38, we examined whether ubiquitination is involved and found that CSN6 overexpression inhibited Myc ubiquitination while shRNA-CSN6 increased Myc ubiquitination (XREF_FIG)."
CARD16 affects COPS6
| 5 17
| 5 16

sparser
"Given that CSN6 associates with COP1 and that COP1 co-elutes with 14-3-3σ in gel filtration assays ( xref ), we reasoned that COP1 could be involved in CSN6-mediated 14-3-3σ ubiquitination."

reach
"Recently, CSN6 's interaction with COP1 is characterized in mammalian cells, and CSN6-COP1 axis is involved in 14-3-3sigma degradation [XREF_BIBR]."

sparser
"These observations led us to investigate the functional relevance of the interaction of CSN6 and COP1. xref shows that CSN6 associates with COP1 endogenously as assayed by co-ip and an In vitro binding assay confirms that CSN6 directly binds to COP1."

reach
"XREF_FIG shows that CSN6 associates with COP1 endogenously as assayed by co-ip and an In vitro binding assay confirms that CSN6 directly binds to COP1."

reach
"CSN6 can bind COP1, but the significance of this interaction is largely unknown.In this study, we characterize the upstream regulators of the FOXO4 in tumorigenesis including EGF, PKB/Akt, CSN6 and COP1."

sparser
"Importantly, CSN6 not only associates with COP1 but also prevents COP1’s self-ubiquitination, adding yet another layer of regulation."

sparser
"To address the significance of the CSN6 and COP1 interaction, we examined the impact of CSN6 on COP1 levels and noted that the steady-state level of COP1 increased when CSN6 was overexpressed ( xref )."

sparser
"To demonstrate the impact of CSN6COP1 axis in regulating FOXO4 and subsequent gene expression of SGOC genes in vivo, we performed mouse xenograft cancer studies and demonstrated that CSN6 knockdown suppressed tumor growth (Figure S17C, Supporting Information)."

sparser
"To further confirm the CSN6COP1 axis is involved in regulating FOXO4 ubiquitination, we investigate the ubiquitination level of FOXO4 (428VP→AA) mutant in the presence of CSN6."

sparser
"CSN6 can bind COP1, but the significance of this interaction is largely unknown."
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
AKT affects COPS6
2 | 16 2 1
AKT phosphorylates COPS6.
1 | 8 1 1
AKT phosphorylates COPS6 on S60. 7 / 7
1 | 5 1

reach
"XREF_BIBR They demonstrate that Akt directly interacts with and phosphorylates CSN6 at Ser60, which inhibits the degradation of CSN6 by reducing its ubiquitination."

reach
"XREF_BIBR Interestingly, CSN6 can be phosphorylated by Akt at Ser60, which renders CSN6 more stabilized."

"Mechanistic studies show that akt causes csn6 phosphorylation at ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of csn6."

rlimsp
"They demonstrate that Akt directly interacts with and phosphorylates CSN6 at Ser60, which inhibits the degradation of CSN6 by reducing its ubiquitination."

reach
"First, we have shown that S60 of CSN6 can be phosphorylated by PKB/Akt 16 and that PKB/Akt enhances the steady‐state expression of CSN6."

reach
"S60 of CSN6 is phosphorylated by PKB/Akt 16 and is critical for CSN6 stabilization."

reach
"Mechanistic studies show that Akt causes CSN6 phosphorylation at Ser 60, which, in turn, reduces ubiquitin mediated protein degradation of CSN6."
AKT phosphorylates COPS6. 4 / 4
| 3 1

sparser
"As for the phosphorylation event, Akt can phosphorylate CSN6 and MDM2."

reach
"As for the phosphorylation event, Akt can phosphorylate CSN6 and MDM2."

reach
"These results indicate that PKB/Akt‐mediated CSN6 phosphorylation is critical in stabilizing COP1, thereby enhancing ubiquitination level of FOXO4."

reach
"To determine whether the PKB/Akt‐mediated CSN6 phosphorylation affects FOXO4 stability, we examined the steady‐state expression of FOXO4 and COP1 in the presence of CSN6S60A, a construct with no PKB/Akt phosphorylation site."
AKT activates COPS6.
1 | 4
AKT activates COPS6. 5 / 6
1 | 4

reach
"We previously showed that S60 of CSN6 has an Akt phosphorylation site [XREF_BIBR] and that Akt increases the steady-state expression of CSN6 [XREF_BIBR], which in turn will be translating into E6AP stabilization."

reach
"Our mechanistic studies showed that EGF and Akt mediated CSN6 S60 phosphorylation and subse quent stabilization of E6AP thereby causing p53 downregulation and promoting cell proliferation, cell transformation as well as tumorigenesis."

reach
"For instance, Akt can positively regulate CSN6 by phosphorylation."

"Mechanistic studies show that akt causes csn6 phosphorylation at ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of csn6."

reach
"Hence, this study has further strengthened the significance of the MDM2-p53 pathway on tumorigenesis through a novel link of Akt mediated CSN6 activation."
AKT increases the amount of COPS6.
| 4
AKT increases the amount of COPS6. 3 / 3
| 3

reach
"We previously showed that S60 of CSN6 has an Akt phosphorylation site (Xue et al., 2012) and that Akt increases the steady-state expression of CSN6 (Xue et al., 2012)."

reach
"First, we have shown that S60 of CSN6 can be phosphorylated by PKB/Akt 16 and that PKB/Akt enhances the steady‐state expression of CSN6."

reach
"We previously showed that S60 of CSN6 has an Akt phosphorylation site and that Akt increases the steady-state expression of CSN6."
Modified AKT increases the amount of COPS6. 1 / 1
| 1

reach
"Ectopic expression of Akt can increase the expression of CSN6; accordingly, Akt inhibition leads to CSN6 destabilization."
AKT binds COPS6.
| 1
| 1

sparser
"Akt is able to associate with CSN6 and phosphorylate it at Ser60, which can reduce the ubiquitin-mediated protein degradation and turnover rate of CSN6, thereby increasing steady-state expression of CSN6."
COPS6 affects TRIM21
| 11 9
COPS6 binds TRIM21.
| 4 8
| 4 8

sparser
"Our results provide insight into the consequence of CSN6TRIM21 signalling on OCT1/ALDH1A1 expression during carcinogenesis and cancer progression."

sparser
"TRIM21 binding with CSN6 is enhanced by the presence of CUL1 (Fig.  xref )."

sparser
"In conclusion, we validate a pathway for cancer stemness regulation involving ALDH1A1 levels through the CSN6TRIM21 axis, which may be utilised as CRC molecular markers and be targeted for therapeutic intervention in cancers."

reach
"Then we confirmed that CSN6 could interact with TRIM21 in HCT116 cells by Co-IP."

reach
"Collectively, the above results consistently suggest that CSN6 interacts with TRIM21, which in turn impacts Aldh1a1 mRNA expression."

sparser
"Collectively, the above results consistently suggest that CSN6 interacts with TRIM21, which in turn impacts Aldh1a1 mRNA expression."

sparser
"In addition, TRIM21’s function is associated with autoimmune diseases, such as systemic lupus erythematosus (SLE) and Sjögren’s syndrome. xref , xref Notably, patients with SLE or Sjögren’s syndrome have an increased risk for developing certain cancers, including non-Hodgkin’s lymphoma. xref In addition, TRIM21 interacts with endoglin, xref which is a prognostic marker in CRC xref and also act as a CSC marker in renal cell carcinoma. xref Future studies will need to address how the CSN6TRIM21 axis may impact these signalling pathways to promote tumorigenesis."

reach
"To verify Cullin 's involvement, we first showed that TRIM21 interacted with CUL1 and CSN6 by Co-IP."

sparser
"Then we confirmed that CSN6 could interact with TRIM21 in HCT116 cells by Co-IP (Fig.  xref )."

sparser
"Correction: CSN6-TRIM21 axis instigates cancer stemness during tumorigenesis."
COPS6 decreases the amount of TRIM21.
| 4
COPS6 decreases the amount of TRIM21. 4 / 4
| 4

reach
"In HCT116 cells, CSN6 reduced the steady-state level of TRIM21, and MLN4924 treatment reversed this effect."

reach
"We first identified that overexpression of CSN6 reduced the steady-state expression of TRIM21 in a dose dependent manner in the DLD-1 cell line."

reach
"In addition, knockdown of CSN6 increased TRIM21 protein levels."

reach
"45 Interestingly, CSN6 is able to decrease the steady-state expression of TRIM21 by enhancing TRIM21 ubiquitination, thereby promoting cancer stemness."
COPS6 deubiquitinates TRIM21.
| 2
COPS6 leads to the deubiquitination of TRIM21. 2 / 2
| 2

reach
"Moreover, MLN4924 treatment abrogated TRIM21 ubiquitination promoted by CSN6."

reach
"45 Interestingly, CSN6 is able to decrease the steady-state expression of TRIM21 by enhancing TRIM21 ubiquitination, thereby promoting cancer stemness."
COPS6 ubiquitinates TRIM21.
| 1
COPS6 ubiquitinates TRIM21. 1 / 1
| 1

sparser
"In summary, we performed mechanistic studies illustrating the role of CSN6-facilitated TRIM21 ubiquitination in enhancing ALDH1A1 expression via the OCT1 transcription factor, lending support to the means by which CSN6 activity can lead to the initiation of cancer stemness."
COPS6 inhibits TRIM21.
| 1
COPS6 inhibits TRIM21. 1 / 1
| 1

reach
"Together, these results indicate that CSN6 promoted TRIM21 degradation is dependent on TRIM21 self ubiquitination via K48 ubiquitin linkage."
COPS6 affects fbxw1
| 16 3
COPS6 binds fbxw1.
| 3 3
| 3 3

sparser
"We found that CSN6 associated with β-Trcp in vivo ( xref ), suggesting that CSN6 interacts with F-box protein β-Trcp and regulates it, thereby stabilizing β-catenin."

sparser
"We found that CSN6 associated with β-Trcp in vivo (F), suggesting that CSN6 interacts with F-box protein β-Trcp and regulates it, thereby stabilizing β-catenin."

reach
"We found that CSN6 also associates with beta-Trcp and facilitates its degradation."

reach
"We found that CSN6 associated with beta-Trcp in vivo, suggesting that CSN6 interacts with F-box protein beta-Trcp and regulates it, thereby stabilizing beta-catenin."

reach
"We found that CSN6 associated with beta-Trcp in vivo (XREF_FIG), suggesting that CSN6 interacts with F-box protein beta-Trcp and regulates it, thereby stabilizing beta-catenin."

sparser
"We found that CSN6 also associates with β-Trcp and facilitates its degradation."
COPS6 activates fbxw1.
| 5
COPS6 activates fbxw1. 5 / 5
| 5

reach
"Western blotting revealed that the CSN6 mediated beta-Trcp downregulation in K1 cells could be rescued by the proteasome inhibitor MG132."

reach
"qRT-PCR analysis revealed that the mRNA levels of beta-Trcp and beta-catenin were not affected by CSN6 overexpression, and western blotting revealed that CSN6 mediated beta-Trcp downregulation could b[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"CSN6 overexpression reduced the turnover rate of beta-catenin and increased the turnover rate of beta-Trcp (XREF_FIG)."

reach
"CSN6 overexpression reduced the turnover rate of beta-catenin and increased the turnover rate of beta-Trcp."

reach
"qRT-PCR analysis revealed that the mRNA levels of beta-Trcp and beta-catenin were not affected by CSN6 overexpression (XREF_SUPPLEMENTARY), and western blotting revealed that CSN6 mediated beta-Trcp downregulation could be rescued by the proteasome inhibitor MG132 (XREF_FIG)."
COPS6 inhibits fbxw1.
| 4
COPS6 inhibits fbxw1. 4 / 4
| 4

reach
"Because Cullin neddylation, a process controlled by CSN, decreases the steady-state expression levels of F-box proteins (Wee et al., 2005), we rationalized that CSN6 may be involved in Cullin neddylat[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"As expected, we found that the beta-catenin level decreased and that of beta-Trcp increased when cells were treated with CSN6-shRNA (CSN6 knockdown) (Fig XREF_FIG A and B)."

reach
"Because Cullin neddylation, a process controlled by CSN, decreases the steady-state expression levels of F-box proteins, we rationalized that CSN6 may be involved in Cullin neddylation, thereby increasing the autocatalytic degradation of beta-Trcp."

reach
"In the xenografted colon cancer samples, CSN6 depletion inhibited tumor growth by increasing beta-Trcp while downregulating beta-catenin."
COPS6 increases the amount of fbxw1.
| 2
COPS6 increases the amount of fbxw1. 2 / 2
| 2

reach
"Furthermore, CSN6 increased the ubiquitination level of beta-Trcp and reduced the ubiquitination level of beta-catenin."

reach
"Furthermore, CSN6 increased the ubiquitination level of beta-Trcp and reduced the ubiquitination level of beta-catenin (XREF_FIG)."
COPS6 decreases the amount of fbxw1.
| 2
COPS6 decreases the amount of fbxw1. 2 / 2
| 2

reach
"Thus, we explored whether CSN6 negatively regulated beta-Trcp expression to stabilize beta-catenin in PTC cells."

reach
"In line with this finding, western blotting revealed that knockdown of CSN6 by shRNA decreased the expression of beta-catenin and increased the expression of beta-Trcp."
COPS6 affects CDK9
| 1 13 5
COPS6 binds CDK9.
| 5 5
| 4 5

sparser
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells (Fig. xref )."

reach
"In summary, these results indicate that CSN6 interacts with CDK9 and regulates CDK9 stability by reducing CDK9 ubiquitination and degradation."

reach
"This study demonstrates that CSN6 interacts with CDK9 and increases the stability of CDK9 by controlling the expression of the E3 ligase UBR5."

sparser
"In summary, these results indicate that CSN6 interacts with CDK9 and regulates CDK9 stability by reducing CDK9 ubiquitination and degradation."

reach
"Furthermore, we revealed that CSN6 interacted with CDK9 by co-IP."

sparser
"Furthermore, we revealed that CSN6 interacted with CDK9 by co-IP."

reach
"CSN6 interacts with CDK9 and regulates CDK9 stability."

sparser
"CSN6 interacts with CDK9 and regulates CDK9 stability."

sparser
"This study demonstrates that CSN6 interacts with CDK9 and increases the stability of CDK9 by controlling the expression of the E3 ligase UBR5."
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."
COPS6 activates CDK9.
| 1 2
COPS6 activates CDK9. 3 / 3
| 1 2

reach
"Furthermore, in CSN6-knockdown melanoma cells, UBR5 knockdown abrogated the effects caused by CSN6 silencing, suggesting that CSN6 activates the UBR5 and CDK9 pathway to promote melanoma cell proliferation and metastasis."

eidos
"Next , western blot analysis demonstrated that CSN6 increased CDK9 expression and decreased UBR5 expression in a dose-dependent manner in 293FT cells ( Fig. 5B ) ."

reach
"We also found that CSN6 overexpression in melanoma cells could prolong the half-life of CDK9 and that the decrease in CDK9 protein expression in CSN6-knockdown cells could be obviously rescued in the presence of MG132, indicating that CSN6 regulates CDK9 stability by reducing CDK9 ubiquitination."
COPS6 increases the amount of CDK9.
| 2
COPS6 increases the amount of CDK9. 2 / 2
| 2

reach
"Our study revealed that CSN6 positively regulated the CDK9 protein level, while the CDK9 mRNA level remained unchanged, indicating that CSN6 may regulate CDK9 expression through posttranscriptional regulation."

reach
"Next, western blot analysis demonstrated that CSN6 increased CDK9 expression and decreased UBR5 expression in a dose dependent manner in 293FT cells."
COPS6 deubiquitinates CDK9.
| 2
COPS6 leads to the deubiquitination of CDK9. 2 / 2
| 2

reach
"In addition, to investigate whether CSN6 controls the ubiquitination and degradation of the E3 ligase UBR5 to stabilize CDK9, in vivo ubiquitination assays were performed and found that CSN6 increased UBR5 ubiquitination levels and decreased CDK9 ubiquitination levels in melanoma cells and 293FT cells."

reach
"CSN6 promotes melanoma proliferation and metastasis by controlling the UBR5 mediated ubiquitination and degradation of CDK9."
COPS6 inhibits CDK9.
| 1
COPS6 inhibits CDK9. 1 / 1
| 1

reach
"Then, we explored how CSN6 affects the stability of CDK9 and found that overexpression of CSN6 decreased the turnover rate of CDK9 in melanoma cells by using the de novo protein synthesis inhibitor cycloheximide (CHX, Sigma, USA)."
COPS6 decreases the amount of CDK9.
| 1
COPS6 decreases the amount of CDK9. 1 / 1
| 1

reach
"In addition, to investigate whether CSN6 controls the ubiquitination and degradation of the E3 ligase UBR5 to stabilize CDK9, in vivo ubiquitination assays were performed and found that CSN6 increased UBR5 ubiquitination levels and decreased CDK9 ubiquitination levels in melanoma cells and 293FT cells."
EGF affects COPS6
| 18
EGF increases the amount of COPS6.
| 6
EGF increases the amount of COPS6. 6 / 6
| 6

reach
"Immunoblot analysis showed that EGF treatment increased the steady-state expression of CSN6 in DLD-1 colon cancer cells, whereas inhibition of MEK and ERK by the MEK1 inhibitor PD98059 diminished the EGF induced increase of CSN6 expression (XREF_FIG)."

reach
"Immunoblot analysis showed that EGF treatment increased the steady-state expression of CSN6 in DLD-1 colon cancer cells, whereas inhibition of MEK and ERK by the MEK1 inhibitor PD98059 diminished the [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Furthermore, we found that EGF treatment increased the S60 phosphorylation level of CSN6 with concurrent Akt phosphorylation."

reach
"Treatment with calf intestinal alkaline phosphatase (CIP) reduced the EGF induced steady-state expression of CSN6, indicating that CSN6 phosphorylation is required in this process (XREF_FIG) and presumably acts through ERK."

reach
"Treatment with calf intestinal alkaline phosphatase (CIP) reduced the EGF induced steady-state expression of CSN6, indicating that CSN6 phosphorylation is required in this process and presumably acts [MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Immunoblotting analysis showed that EGF treatment decreased the steady‐state expression of FOXO4 within 45 min (Figure  1A, Figure S1A, Supporting Information) and accelerated turnover rate of FOXO4 (Figure S1B, Supporting Information) in several CRC cell lines, whereas the EGF induced the expression of CSN6 and COP1, an E3 ligase, within that period of time (Figure 1A, Figure S1A, Supporting Information)."
EGF decreases the amount of COPS6.
| 4
EGF decreases the amount of COPS6. 4 / 4
| 4

reach
"We assessed the ubiquitination of CSN6 in the presence of EGF and found that EGF reduced the ubiquitination level of WT CSN6 but not that of the CSN6 S148A mutant."

reach
"We assessed the ubiquitination of CSN6 in the presence of EGF and found that EGF reduced the ubiquitination level of WT CSN6 but not that of the CSN6 S148A mutant (XREF_FIG)."

reach
"Furthermore, we found that EGF treatment or ERK2 activation decreases the ubiquitination level of CSN6 (XREF_FIG)."

reach
"Furthermore, we found that EGF treatment or ERK2 activation decreases the ubiquitination level of CSN6."
EGF phosphorylates COPS6.
| 2
EGF leads to the phosphorylation of COPS6. 2 / 2
| 2

reach
"Together, these results indicate that EGF and ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover."

reach
"Together, these results indicate that EGF and ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover.To determine the biological significance of CSN6 phosphorylation, we tra[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
EGF inhibits COPS6.
| 2
EGF inhibits COPS6. 2 / 2
| 2

reach
"Congruently, PD98059 increased the turnover rate of CSN6 in the presence of the de novo protein synthesis inhibitor cycloheximide (XREF_FIG), whereas EGF, which induced ERK activation, reduced CSN6 turnover (XREF_FIG)."

reach
"Congruently, PD98059 increased the turnover rate of CSN6 in the presence of the de novo protein synthesis inhibitor cycloheximide, whereas EGF, which induced ERK activation, reduced CSN6 turnover."
EGF activates COPS6.
| 2
EGF activates COPS6. 2 / 2
| 2

reach
"Importantly, EGF‐mediated down regulation of FOXO4 can be reversed by the knockdown of CSN6 (Figure 1D), suggesting the involvement of CSN6 during this process."

reach
"The CSN6 S148A mutant did not respond to EGF induced upregulation, whereas the WT CSN6 was upregulated by EGF."
EGF deubiquitinates COPS6.
| 1
EGF leads to the deubiquitination of COPS6. 1 / 1
| 1

reach
"Together, these results indicate that EGF and ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover."
EGF dephosphorylates COPS6.
| 1
EGF leads to the dephosphorylation of COPS6. 1 / 1
| 1

reach
"Together, these results indicate that EGF and ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover.To determine the biological significance of CSN6 phosphorylation, we tra[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
MAPK1 affects COPS6
1 2 | 10 2
MAPK1 binds COPS6.
2 | 4
COPS6 binds MAPK1 and Leu163. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
2 |

No evidence text available

No evidence text available
MAPK1 phosphorylates COPS6.
1 | 3
MAPK1 phosphorylates COPS6 on S148. 3 / 4
1 | 2

No evidence text available

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
MAPK1 phosphorylates COPS6. 1 / 1
| 1

reach
"ERK2 Dependent Phosphorylation of CSN6 Is Critical in Colorectal Cancer Development."
MAPK1 activates COPS6.
| 1 2
MAPK1 activates COPS6. 3 / 4
| 1 2

reach
"Taken together, our study 's findings indicate that the deregulation of beta-catenin by ERK2 activated CSN6 is important for CRC development."

sparser
"Taken together, our study’s findings indicate that the deregulation of β-catenin by ERK2-activated CSN6 is important for CRC development."

sparser
"Fang et al. reported that ERK2-activated CSN6 regulates β-Trcp and stabilized β-catenin expression by blocking the ubiquitin-proteasome pathway, thereby promoting CRC development xref ."
MAPK1 decreases the amount of COPS6.
| 2
MAPK1 decreases the amount of COPS6. 2 / 2
| 2

reach
"Furthermore, we found that EGF treatment or ERK2 activation decreases the ubiquitination level of CSN6."

reach
"Furthermore, we found that EGF treatment or ERK2 activation decreases the ubiquitination level of CSN6 (XREF_FIG)."
COPS6 affects CUL1
6 1 | 9 1
COPS6 binds CUL1.
6 1 | 2 1
6 1 | 2 1

No evidence text available

No evidence text available

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."

No evidence text available

reach
"We found that both CSN6 and CSN5 associated with Cullin-1 and that CSN6 and CSN5 competed with each other for Cullin-1 binding in a dose dependent manner (XREF_FIG)."

No evidence text available

No evidence text available

No evidence text available

sparser
"These findings highlight the complexity of TRIM21 regulation and indicate that CSN6-CUL1 regulation is involved in TRIM21 ubiquitination."

No evidence text available
COPS6 activates CUL1.
| 7
COPS6 activates CUL1. 7 / 7
| 7

reach
"CSN6 knockdown reduced the neddylated form of Cullin-1, leading to accumulation of Fbxw7, which in turn caused downregulation of Myc (XREF_FIG)."

reach
"We further showed that overexpression of dominant negative Ubc12 (dnUbc12-HA) XREF_BIBR, XREF_BIBR, which antagonized CSN6 mediated increase of Cullin-1 neddylation, compromised CSN6 mediated Fbxw7alpha downregulation (XREF_FIG)."

reach
"35 Interestingly, CSN6 can increase CUL1 neddylation."

reach
"We then found that increasing amounts of CSN6 enhanced neddylation of wild type Cullin-1 but not the Cullin-1 mutant 41 in which the Nedd-8-conjugating site lysine (K) 720 was mutated to arginine (R) (XREF_SUPPLEMENTARY)."

reach
"On the other hand, mono-allelic deletion of CSN6 decreases Cullin1 neddylation, stabilizes FBXW7, and compromises lymphomagenesis in an Emu-Myc mouse model [XREF_BIBR]."

reach
"Together, these data suggest that CSN6 increases Cullin-1 neddylation by competing with CSN5 for binding to Cullin-1 through the MPN domain, thereby facilitating Cullin-1-enhanced Fbxw7 degradation."

reach
"CSN6 enhanced neddylation of Cullin-1 and facilitated auto-ubiquitination and degradation of Fbxw7, a component of CRL involved in Myc ubiquitination, thereby stabilizing Myc."
| 4 12

eidos
"CSN6 promotes GBM proliferation , migration , invasion , and tumorigenesis through upregulation of EGFR by blocking its ubiquitination ; this happens as a result of interactions with CHIP that cause its degradation , although CHIP auto-ubiquitination occurs through an unknown mechanism [ 91 ] ."

reach
"CSN6 recovery rescued the cell proliferation, migration, and invasion of CSN6-knockdown melanoma cells."

reach
"Here, we report that GBM tumors overexpressed CSN6 compared with normal brain tissues and that CSN6 promoted GBM cell proliferation, migration, invasion and tumorigenesis."

reach
"Here, we identified that CSN6 promoted melanoma cell migration and invasion in vivo."

reach
"In this study, we show that CSN6 promotes the growth, migration and invasion of melanoma cells via CDK9 mediated signaling pathways."

reach
"Also, WT CSN6 increased cell migration and invasion in a wound healing assay (p < 0.001, XREF_FIG) and in transwell migration and invasion assays (XREF_FIG), whereas CSN6 S148A lost such capability, demonstrating that the CSN6 promoted migration and invasion of colon cancer cells requires a phosphorylation event."

eidos
"Here , we identified that CSN6 promoted melanoma cell migration and invasion in vivo ."

reach
"CSN6 Promotes the Migration and Invasion of Cervical Cancer Cells by Inhibiting Autophagic Degradation of Cathepsin L."

reach
"In vitro and in vivo data showed that loss of CSN6 attenuated cell proliferation, migration, and invasion of PTC cells, confirming the vital function of CSN6 in PTC."

reach
"These results suggest that CSN6 robustly modulates PTC migration and invasiveness."

reach
"We conclude that COPS6 promotes breast cancer progression by reducing CD8 + T cell infiltration and function via the regulation of IL-6 secretion."
COPS7A affects COPS6
15 |
15 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects Snail1
| 14
COPS6 activates Snail1.
| 7
COPS6 activates Snail1. 7 / 7
| 7

reach
"The above results suggest that CSN6 promotes Snail1 stability via impeding ubiquitination of Snail1."

reach
"We then validated whether ubiquitination is involved in CSN6 mediated Snail1 regulation."

reach
"CSN6 promotes the cell migration of breast cancer cells by positively regulating Snail1 stability."

reach
"Taken together, these results indicated that CSN6 promotes Snail1 stability through reducing ubiquitination."

reach
"Ubiquitination assay was performed to validate whether ubiquitination is involved in the upregulation of Snail1 by CSN6."

reach
"Our study showed that CSN6 prevented Snail1 degradation via proteasomal degradation."

reach
"On the basis of our data, it is possible that CSN6 mediated Snail1 stabilization may be a common feature of various types of cancer."
COPS6 binds Snail1.
| 3
COPS6 binds Snail1. 3 / 3
| 3

reach
"We next investigated how CSN6 interacted with Snail1 to regulate the protein level of Snail1."

reach
"Western Blot analysis showed that CSN6 could up-regulate the expression of Snail1 protein in a dose dependent manner, and CO-IP analysis showed that CSN6 could bind with Snail1."

reach
"Co-immunoprecipitation study was used to show the interaction between the protein CSN6 and Snail1."
COPS6 deubiquitinates Snail1.
| 2
COPS6 leads to the deubiquitination of Snail1. 2 / 2
| 2

reach
"CSN6 probably functions to inhibit Snail1 ubiquitination and then switches the E3 ligase target from Snail1 itself to other proteins."

reach
"CSN6 induces EMT and enhances metastasis of breast cancer cells by reducing Snail1 ubiquitination."
COPS6 decreases the amount of Snail1.
| 2
Modified COPS6 decreases the amount of Snail1. 2 / 2
| 2

reach
"Ubiquitination assay was performed and revealed that CSN6 overexpression decreased the ubiquitination level of Snail1."

reach
"Then we performed ubiquitination assay and found that CSN6 overexpression decreased the ubiquitination level of Snail1."
CUL4A affects COPS6
12 | 1
12 | 1

No evidence text available

No evidence text available

No evidence text available

trips
"CUL4A regulates endometrial cancer cell proliferation, invasion and migration by interacting with CSN6."

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS8 affects COPS6
10 2 |
10 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CUL4A
12 | 1
12 | 1

No evidence text available

No evidence text available

No evidence text available

trips
"CUL4A regulates endometrial cancer cell proliferation, invasion and migration by interacting with CSN6."

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects COPS8
10 2 |
10 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects COPS3
11 2 |
11 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects COPS2
11 2 |
11 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CDKN1B
1 | 1 7 3
COPS6 binds CDKN1B.
1 | 1 2 3
1 | 1 2 3

reach
"Mechanistic studies show that CSN6 interacts with p27 (Kip1) and facilitates ubiquitin mediated degradation of p27 (Kip1)."

reach
"Mechanistic studies show that CSN6 interacts with p27 and facilitates ubiquitin mediated degradation of p27."

sparser
"Mechanistic studies show that CSN6 interacts with p27(Kip1) and facilitates ubiquitin-mediated degradation of p27(Kip1)."

No evidence text available

trips
"Mechanistic studies show that CSN6 interacts with p27(Kip1) and facilitates ubiquitin-mediated degradation of p27(Kip1)."

sparser
"Mechanistic studies show that CSN6 interacts with p27 and facilitates ubiquitin-mediated degradation of p27."

sparser
"Mechanistic studies showed that CSN6 interacts with p27 and enhances ubiquitin-mediated degradation of p27."
COPS6 inhibits CDKN1B.
| 3
COPS6 inhibits CDKN1B. 3 / 3
| 3

reach
"CSN6 mediated p27 degradation depends on the nuclear export of p27, which is regulated through COP1 's nuclear exporting signal."

reach
"CSN6 mediated p27 degradation depends on the nuclear export of p27 (Kip1), which is regulated through COP1 nuclear exporting signal."

reach
"Ectopic expression of CSN6 can decrease the expression of p27 (Kip1), while CSN6 knockdown leads to p27 (Kip1) stabilization."
COPS6 decreases the amount of CDKN1B.
| 2
Modified COPS6 decreases the amount of CDKN1B. 2 / 2
| 2

reach
"Ectopic expression of CSN6 decreases the expression of p27 while CSN6 knockdown leads to p27 stabilization."

reach
"Ectopic expression of CSN6 can decrease the expression of p27 (Kip1), while CSN6 knockdown leads to p27 (Kip1) stabilization."
COPS3 affects COPS6
11 2 |
11 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS2 affects COPS6
11 2 |
11 2 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
TRIM21 affects COPS6
| 4 8
| 4 8

sparser
"Our results provide insight into the consequence of CSN6TRIM21 signalling on OCT1/ALDH1A1 expression during carcinogenesis and cancer progression."

sparser
"TRIM21 binding with CSN6 is enhanced by the presence of CUL1 (Fig.  xref )."

sparser
"In conclusion, we validate a pathway for cancer stemness regulation involving ALDH1A1 levels through the CSN6TRIM21 axis, which may be utilised as CRC molecular markers and be targeted for therapeutic intervention in cancers."

reach
"Then we confirmed that CSN6 could interact with TRIM21 in HCT116 cells by Co-IP."

reach
"Collectively, the above results consistently suggest that CSN6 interacts with TRIM21, which in turn impacts Aldh1a1 mRNA expression."

sparser
"Collectively, the above results consistently suggest that CSN6 interacts with TRIM21, which in turn impacts Aldh1a1 mRNA expression."

sparser
"In addition, TRIM21’s function is associated with autoimmune diseases, such as systemic lupus erythematosus (SLE) and Sjögren’s syndrome. xref , xref Notably, patients with SLE or Sjögren’s syndrome have an increased risk for developing certain cancers, including non-Hodgkin’s lymphoma. xref In addition, TRIM21 interacts with endoglin, xref which is a prognostic marker in CRC xref and also act as a CSC marker in renal cell carcinoma. xref Future studies will need to address how the CSN6TRIM21 axis may impact these signalling pathways to promote tumorigenesis."

reach
"To verify Cullin 's involvement, we first showed that TRIM21 interacted with CUL1 and CSN6 by Co-IP."

sparser
"Then we confirmed that CSN6 could interact with TRIM21 in HCT116 cells by Co-IP (Fig.  xref )."

sparser
"Correction: CSN6-TRIM21 axis instigates cancer stemness during tumorigenesis."
FOXO4 affects COPS6
| 2 10
FOXO4 binds COPS6.
| 1 10
| 1 9

sparser
"Thus, these data suggest a link of CSN6FOXO4 axis and ser/gly metabolism."

sparser
"Together, the regulatory circuit of CSN6FOXO4 axis could be recapitulated in mouse xenograft cancer model, and level of FOXO4 deregulation plays roles in affecting the outcome of tumorigenicity."

reach
"Mechanistic studies show that CSN6 binds and regulates FOXO4 stability through enhancing the E3 ligase activity of COP1, and that COP1 directly interacts with FOXO4 through a VP motif on FOXO4 and accelerates the ubiquitin-mediated degradation of FOXO4."

sparser
"Deregulation of CSN6FOXO4 Axis Rewires Metabolic Programming via Enhancing Glucose Uptake and Promotes the Expression of SGOC Genes."

sparser
"Significantly, as the CSN6FOXO4 axis is crucial in regulating gene expression of Glut1 and SGOC genes, these genes were reduced in CSN6 knockdown tumors (Figure S17E, Supporting Information)."

sparser
"These data suggested that CSN6FOXO4 axis deregulation could exist in many types of cancer."

sparser
"As CSN6FOXO4 axis impacts on the expression of Glut1, biochemical assays that quantitates the glucose uptake (consumption) by assessing uptake of (2‐( N ‐(7‐nitrobenz‐2‐oxa‐1,3‐diazol‐4‐yl)amino)‐2‐deoxyglucose (2‐NBDG)), a green fluorescent glucose analog, additionally demonstrated that CSN6 knockdown inhibited 2‐NBDG uptake (Figure  xref ), while FOXO4 knockdown increased 2‐NBDG uptake (Figure  xref )."

sparser
"CSN6FOXO4 Axis Is Critical for Tumorigenicity in Xenograft Mouse Model."

sparser
"We further confirmed that CSN6FOXO4 link could affect cell proliferation."

sparser
"Results showed that FOXO4 bound to the C‐terminus of CSN6 (aa 185‐327 containing) but not to the N‐terminus (aa 1‐184, containing the MPN domain; Figure  xref )."
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
FOXO4 inhibits COPS6.
| 1
FOXO4 inhibits COPS6. 1 / 1
| 1

reach
"Importantly, EGF‐mediated down regulation of FOXO4 can be reversed by the knockdown of CSN6 (Figure 1D), suggesting the involvement of CSN6 during this process."
ERK affects COPS6
| 6 6
ERK phosphorylates COPS6.
| 4 2
ERK phosphorylates COPS6. 6 / 6
| 4 2

reach
"Accordingly, CSN6 S148A was resistant to phosphorylation by recombinant ERK, whereas WT CSN6 was highly phosphorylated by ERK, in an in vitro kinase assay."

sparser
"Recently, phosphorylation of CSN6 by ERK was found to stabilize β-catenin for colon cancer cell proliferation ( xref )."

sparser
"Accordingly, CSN6 S148A was resistant to phosphorylation by recombinant ERK, whereas WT CSN6 was highly phosphorylated by ERK, in an in vitro kinase assay (E)."

reach
"Recently, phosphorylation of CSN6 by ERK was found to stabilize beta-catenin for colon cancer cell proliferation."

reach
"Accordingly, CSN6 S148A was resistant to phosphorylation by recombinant ERK, whereas WT CSN6 was highly phosphorylated by ERK, in an in vitro kinase assay (XREF_FIG)."

reach
"Together, these results indicate that EGF and ERK mediated CSN6 phosphorylation and diminished CSN6 ubiquitination and turnover.To determine the biological significance of CSN6 phosphorylation, we tra[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
ERK binds COPS6.
| 2 4
| 2 4

sparser
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 ( xref )."

sparser
"Model of CSN6-ERK Interaction."

sparser
"In the present study, replacing some conserved residues on the D- site compromised CSN6’s capacity to interact with ERK, suggesting that these residues are involved in ERK-CSN6 protein-protein interaction."

reach
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 (XREF_FIG)."

sparser
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 (B)."

reach
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6."
| 4 8

reach
"CSN6 inhibition suppresses pancreatic adenocarcinoma metastasis via destabilizing the c-Fos protein."

reach
"Re-expression of FOXA1 rescued the decreased invasion and metastasis caused by CSN6 knockdown, whereas inhibition of FOXA1 alleviated the pro metastasis effect induced by CSN6 overexpression."

reach
"CSN6 has the capability to promote the formation of spheres enriched in CSCs, suggesting that CSN6 overexpression may promote distant metastasis and confer resistance after chemotherapy."

reach
"Furthermore, we identified that CSN6 enhancement leads to Snail1 stabilization and promotes metastasis of breast cancer cells through inhibiting Snail1 ubiquitination."

reach
"Furthermore, in CSN6-knockdown melanoma cells, UBR5 knockdown abrogated the effects caused by CSN6 silencing, suggesting that CSN6 activates the UBR5 and CDK9 pathway to promote melanoma cell proliferation and metastasis."

eidos
"CSN6 promotes melanoma proliferation and metastasis by controlling the UBR5-mediated ubiquitination and degradation of CDK9 As a critical subunit of the constitutive photomorphogenesis 9 ( COP9 ) signalosome ( CSN ) , CSN6 is upregulated in some human cancers and plays critical roles in tumorigenesis and progression , but its biological functions and molecular mechanisms in melanoma remain unknown ."

reach
"Our study reveals that CSN6 promotes the migration and metastasis of breast cancer cells, indicating that CSN6 functions as an oncogene in breast cancer cells."

reach
"Moreover, we demonstrated that CSN6 promoted invasion and metastasis through regulating forkhead box protein A1 (FOXA1) in PAAD cells."

reach
"CSN6 promotes tumor metastasis via up-regulating snail1 in xenograft model."

eidos
"CSN6 promotes melanoma proliferation and metastasis by controlling the UBR5-mediated ubiquitination and degradation of CDK9 ."
COPS6 affects UBR5
| 1 9 1
COPS6 inhibits UBR5.
| 1 3
COPS6 inhibits UBR5. 4 / 4
| 1 3

eidos
"Next , western blot analysis demonstrated that CSN6 increased CDK9 expression and decreased UBR5 expression in a dose-dependent manner in 293FT cells ( Fig. 5B ) ."

reach
"In addition, our study described a novel CSN6 interacting E3 ligase UBR5, which was negatively regulated by CSN6 and could regulate the ubiquitination and degradation of CDK9 in melanoma cells."

reach
"This study demonstrated that UBR5, a novel E3 ubiquitin ligase interacting with CSN6, was negatively regulated by CSN6 and was responsible for CDK9 ubiquitination and degradation in melanoma cells."

reach
"Indeed, we revealed that CSN6 reduces the stability of UBR5 by regulating the ubiquitin mediated degradation of UBR5, furtherly stabilizing CDK9 expression, suggesting that UBR5 may be a downstream factor of CSN6 in melanoma cells."
COPS6 decreases the amount of UBR5.
| 2
COPS6 decreases the amount of UBR5. 2 / 2
| 2

reach
"Furthermore, we found that UBR5 knockdown rescued all the effects induced by CSN6 silencing, indicating that CSN6 activates the CDK9 pathway to promote melanoma growth and metastasis by reducing the UBR5 level."

reach
"Next, western blot analysis demonstrated that CSN6 increased CDK9 expression and decreased UBR5 expression in a dose dependent manner in 293FT cells."
COPS6 binds UBR5.
| 1 1
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
| 1

sparser
"A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells (Fig. xref )."
COPS6 activates UBR5.
| 2
COPS6 activates UBR5. 2 / 2
| 2

reach
"Furthermore, in CSN6-knockdown melanoma cells, UBR5 knockdown abrogated the effects caused by CSN6 silencing, suggesting that CSN6 activates the UBR5 and CDK9 pathway to promote melanoma cell proliferation and metastasis."

reach
"Then, western blot analysis showed that the proteasome inhibitor MG132 could rescue CSN6 mediated UBR5 downregulation."
COPS6 increases the amount of UBR5.
| 1
COPS6 increases the amount of UBR5. 1 / 1
| 1

reach
"In addition, to investigate whether CSN6 controls the ubiquitination and degradation of the E3 ligase UBR5 to stabilize CDK9, in vivo ubiquitination assays were performed and found that CSN6 increased UBR5 ubiquitination levels and decreased CDK9 ubiquitination levels in melanoma cells and 293FT cells."
UBE3A affects COPS6
2 | 5
2 | 5

sparser
"We characterized that CSN6 associated with E6AP and stabilized E6AP expression by reducing E6AP poly-ubiquitination, thereby regulating p53 activity in cell proliferation and apoptosis."

No evidence text available

sparser
"CSN6 interacts with E6AP in vivo and causes E6AP stabilization."

sparser
"Our data show that N-terminal CSN6 is interacting with E6AP."

No evidence text available

sparser
"These results indicate that CSN6 associates with E6AP and that E6AP can positively affect the steady-state expression of CE6AP."

sparser
"We found that CSN6 associates with E6AP and reduces E6AP autoubiquitination, thereby stabilizing E6AP."
GPS1 affects COPS6
7 2 | 1
7 2 | 1

sparser
"It has been shown that the complex is composed of two symmetrical modules, CSN1/2/3/8 and CSN4/5/6/7, connected by interactions between CSN1 and CSN6 [ xref ]."

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CUL1 affects COPS6
6 1 | 2 1
6 1 | 2 1

No evidence text available

No evidence text available

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."

No evidence text available

reach
"We found that both CSN6 and CSN5 associated with Cullin-1 and that CSN6 and CSN5 competed with each other for Cullin-1 binding in a dose dependent manner (XREF_FIG)."

No evidence text available

No evidence text available

No evidence text available

sparser
"These findings highlight the complexity of TRIM21 regulation and indicate that CSN6-CUL1 regulation is involved in TRIM21 ubiquitination."

No evidence text available
COPS6 affects UBE3A
2 | 5
2 | 5

sparser
"We characterized that CSN6 associated with E6AP and stabilized E6AP expression by reducing E6AP poly-ubiquitination, thereby regulating p53 activity in cell proliferation and apoptosis."

No evidence text available

sparser
"CSN6 interacts with E6AP in vivo and causes E6AP stabilization."

sparser
"Our data show that N-terminal CSN6 is interacting with E6AP."

No evidence text available

sparser
"These results indicate that CSN6 associates with E6AP and that E6AP can positively affect the steady-state expression of CE6AP."

sparser
"We found that CSN6 associates with E6AP and reduces E6AP autoubiquitination, thereby stabilizing E6AP."
COPS6 affects GPS1
7 2 | 1
7 2 | 1

sparser
"It has been shown that the complex is composed of two symmetrical modules, CSN1/2/3/8 and CSN4/5/6/7, connected by interactions between CSN1 and CSN6 [ xref ]."

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects AKT
| 6 3
COPS6 activates AKT.
| 5 2
COPS6 activates AKT. 7 / 8
| 5 2

reach
"Our mechanistic studies of CSN6 mediated 14-3-3sigma downregulation explains how CSN6 can activate Akt in our proposed model (XREF_FIG)."

sparser
"Our mechanistic studies of CSN6-mediated 14-3-3σ downregulation explains how CSN6 can activate Akt in our proposed model ( xref )."

reach
"The observation that CSN6 increases the activity of Akt (XREF_FIG) is very intriguing."

reach
"Consistent with this, we found that CSN6 can downregulate the expression of 14-3-3sigma and lead to Akt activation."

sparser
"In addition to demonstrating amplification of the CSN6 gene locus at 7q22.1 in human mammary tumors, xref they report that AKT phosphorylation at Ser60 stabilizes CSN6. xref Interestingly, by promoting 14–3-3σ degradation through stabilization of its E3-ligase COP1, CSN6 can activate AKT to create a self-propelling positive feedback loop xref ( xref )."

reach
"Because 14-3-3sigma suppresses Akt activity, we first examined whether knockdown of CSN6 could suppress Akt activity and inhibit Akt mediated cell survival."

reach
"XREF_BIBR Interestingly, by promoting 14-3-3sigma degradation through stabilization of its E3-ligase COP1, CSN6 can activate AKT to create a self propelling positive feedback loop XREF_BIBR (XREF_FIG)."
COPS6 increases the amount of AKT.
| 1
COPS6 increases the amount of phosphorylated AKT. 1 / 1
| 1

reach
"In human breast cancer MCF-7 cells, COPS6 overexpression stimulated p-AKT expression as well as the proliferation and malignant transformation of tumor cells, whereas knockdown of COPS6 caused opposite effects."
COPS6 binds AKT.
| 1
| 1

sparser
"Akt is able to associate with CSN6 and phosphorylate it at Ser60, which can reduce the ubiquitin-mediated protein degradation and turnover rate of CSN6, thereby increasing steady-state expression of CSN6."
CDK9 affects COPS6
| 5 5
| 4 5

sparser
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells (Fig. xref )."

reach
"In summary, these results indicate that CSN6 interacts with CDK9 and regulates CDK9 stability by reducing CDK9 ubiquitination and degradation."

reach
"This study demonstrates that CSN6 interacts with CDK9 and increases the stability of CDK9 by controlling the expression of the E3 ligase UBR5."

sparser
"In summary, these results indicate that CSN6 interacts with CDK9 and regulates CDK9 stability by reducing CDK9 ubiquitination and degradation."

reach
"Furthermore, we revealed that CSN6 interacted with CDK9 by co-IP."

sparser
"Furthermore, we revealed that CSN6 interacted with CDK9 by co-IP."

reach
"CSN6 interacts with CDK9 and regulates CDK9 stability."

sparser
"CSN6 interacts with CDK9 and regulates CDK9 stability."

sparser
"This study demonstrates that CSN6 interacts with CDK9 and increases the stability of CDK9 by controlling the expression of the E3 ligase UBR5."
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."
DDB2 affects COPS6
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CUL4B affects COPS6
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS7B affects COPS6
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects Neoplasms
| 2 6
COPS6 activates Neoplasms.
| 2 5
| 2 5

reach
"To demonstrate the impact of CSN6‐COP1 axis in regulating FOXO4 and subsequent gene expression of SGOC genes in vivo, we performed mouse xenograft cancer studies and demonstrated that CSN6 knockdown suppressed tumor growth (Figure S17C, Supporting Information)."

eidos
"COPS6 promotes tumor progression and reduces CD8 + T cell infiltration by repressing IL-6 production to facilitate tumor immune evasion in breast cancer ."

reach
"These data suggested that CSN6‐FOXO4 axis deregulation could exist in many types of cancer.In our cancer model study, CSN6 overexpression promoted cancer growth while CSN6 knockdown inhibited tumor growth in xenograft colon cancer model."

reach
"A colitis-associated colorectal cancer model established that Csn6 intestinal conditional deletion decreased tumor development and altered nucleotide metabolism."

reach
"COPS6 promotes tumor progression and reduces CD8+ T cell infiltration by repressing IL-6 production to facilitate tumor immune evasion in breast cancer."

reach
"CSN6 mediates nucleotide metabolism to promote tumor development and chemoresistance in colorectal cancer."

eidos
"It has been reported that CSN6 can promote some degree of tumor progression by regulating the stability of several E3 ligases6-8 ,21 ."
COPS6 inhibits Neoplasms.
| 1
| 1

reach
"In C57BL6 mice bearing EMT6 xenografts, COPS6 knockdown in the EMT6 cells increased the number of tumor-infiltrating CD8 + T cells, while knockdown of IL-6 in COPS6KD EMT6 cells diminished tumor infiltrating CD8 + T cells."
COPS6 affects FBXW7
| 7 2
COPS6 ubiquitinates FBXW7.
| 2 1
COPS6 leads to the ubiquitination of FBXW7. 3 / 3
| 2 1

sparser
"In vitro ubiquitination assays also showed that CSN6 enhanced Fbxw7 ubiquitination and diminished Fbxw7-mediated ubiquitinations of Fbxw7’s targets, Myc and cyclin E ( xref )."

reach
"COP9 signalosome complex subunit 6 promotes FBXW7 autoubiquitination and proteasome-mediated degradation."

reach
"In vitro ubiquitination assays also showed that CSN6 enhanced Fbxw7 ubiquitination and diminished Fbxw7 mediated ubiquitinations of Fbxw7 's targets, Myc and cyclin E (XREF_SUPPLEMENTARY)."
COPS6 decreases the amount of FBXW7.
| 2
COPS6 decreases the amount of FBXW7. 2 / 2
| 2

reach
"Compared with wt CSN6, which clearly decreased Fbxw7 expression and increased Myc expression in U2OS cells, the MPN-KQV CSN6 mutant lost these functions (XREF_SUPPLEMENTARY)."

reach
"It is important to point out that CSN6 interacted with all the three isoforms of Fbxw7 XREF_BIBR, XREF_BIBR and reduced the steady-state expression of Fbxw7 in a dose dependent manner (XREF_SUPPLEMENTARY)."
COPS6 binds FBXW7.
| 1 1
| 1 1

sparser
"CSN6’s association with Fbxw7 facilitates its degradation."

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."
COPS6 activates FBXW7.
| 2
COPS6 activates FBXW7. 2 / 2
| 2

reach
"Consistently, CSN6 knockdown decreased turnover rate of Fbxw7 (XREF_FIG and XREF_SUPPLEMENTARY)."

reach
"We next addressed whether Cullin-1 is involved in CSN6 mediated Fbxw7 downregulation."
COPS6 affects DDB2
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CUL4B
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects COPS7B
9 |
9 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
2 2 1 | 2 1
COPS6 translocates.
| 2 1
COPS6 translocates to the nucleus. 2 / 2
| 1 1

sparser
"Human Vpr interacting protein (hVIP/Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [ xref ]."

reach
"Human Vpr interacting protein (hVIP and Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [XREF_BIBR]."
COPS6 translocates from the cytoplasm to the nucleus. 1 / 1
| 1

reach
"XREF_BIBR Overexpression of Akt translocates CSN6 from the cytoplasm to the nucleus, which could facilitate its effects on MDM2."
COPS6 binds.
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
COPS6 is active.
2 |
COPS6 phosphorylated on S60 is active. 2 / 2
2 |

"Mechanistic studies show that akt causes csn6 phosphorylation at ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of csn6."

"Mechanistic studies show that akt causes csn6 phosphorylation at ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of csn6."
COPS6 affects TP53
| 7 1
COPS6 inhibits TP53.
| 5
COPS6 inhibits TP53. 5 / 5
| 5

reach
"Moreover, CSN6 promotes p53 degradation through a mechanism that stabilizes MDM2 protein by limiting its auto-ubiquitylation."

reach
"Similarly, it was found that over-expression of CSN6 can promote p53 degradation through inhibiting autoubiquitylation of MDM2, and mice that were heterozygous for CSN6 were more susceptible to DNA damage [XREF_BIBR]."

reach
"Moreover, CSN6 could n't induce p53 degradation in Mdm2-null mouse embryonic fibroblasts, suggesting that CSN6 mediated degradation of p53 is MDM2 dependent."

reach
"These results suggest that loss of CSN6 enhances p53 mediated tumor suppression in vivo and that CSN6 plays an important role in regulating DNA damage associated apoptosis and tumorigenesis through control of the MDM2-p53 signaling pathway."

reach
"Through combinatorial effects on the MDM2-p53 signaling axis and now SKP2 mediated p57 Kip2 degradation, it is hypothesized that CSN6 overexpression can effectively promote cell proliferation by simultaneously relieving cell cycle restraints, apoptosis, senescence, and presumably p53 functions in DNA damage repair and cell metabolism, among other important tumor suppressive mechanisms."
COPS6 activates TP53.
| 2
COPS6 activates TP53. 2 / 2
| 2

reach
"Since 14-3-3sigma is regulated by p53, at issue is whether CSN6 mediated 14-3-3sigma downregulation involves p53."

reach
"Noticeably, reduced expression of Csn6 in Emicro-Myc background can also contribute to p53 stabilization in 33% of Emicro-Myc and Csn6 +/- lymphomas when compared with Emicro-Myc and Csn6 +/+, suggesting that both CSN6 mediated p53 downregulation and CSN6 mediated Myc elevation contribute to lymphomagenesis of this system (XREF_FIG)."
COPS6 ubiquitinates TP53.
| 1
COPS6 ubiquitinates TP53. 1 / 1
| 1

sparser
"The CSN6-COP1 axis has following physiological significance possibly: (1) CSN6 stabilizing COP1 directly enhances COP1-mediated p53 ubiquitination and degradation. (2) CSN6-COP1 axis causes 14-3-3σ degradation, which on the one hand, can block 14-3-3σ’s positive effect on p53 stability, on the other hand, activates Akt and promotes Akt-mediated cell survival."
COPS6 affects SNAI1
| 2 6
COPS6 binds SNAI1.
| 6
| 6

sparser
"The results of co-immunoprecipitation showed that CSN6 and Snail1 proteins bound to each other (Figure xref D)."

sparser
"Western Blot analysis showed that CSN6 could up-regulate the expression of Snail1 protein in a dose-dependent manner, and CO-IP analysis showed that CSN6 could bind with Snail1."

sparser
"Also we showed that CSN6 associates with Snail1 and enhances Snail1 protein level by inhibiting the ubiquitin-mediated degradation of Snail1."

sparser
"Our findings provided a thoughtful understanding of novel CSN6-Snail1 signaling in promoting breast cancer metastasis."

sparser
"Conclusion: These findings provide new insight into applicability of using the CSN6-Snail1 axis as a potential therapeutic target in breast cancer."

sparser
"Co-immunoprecipitation study was used to show the interaction between the protein CSN6 and Snail1."
COPS6 activates SNAI1.
| 2
COPS6 activates SNAI1. 2 / 2
| 2

eidos
"Ubiquitination assay was performed to validate whether ubiquitination is involved in the upregulation of Snail1 by CSN6 ."

eidos
"Thus , we speculated that CSN6 induced up-regulation of Snail may be regulated at the post-transcriptional level ."
COPS6 affects CUL
| 4 3
COPS6 binds CUL.
| 1 3
| 1 1

sparser
"Indeed, based on the mole fraction of Csn6 that is bound to individual cullins, up to 60% of CSN remains associated with cullins following immunoprecipitation ( xref )."

reach
"On the other hand, it is conceivable that in CSN6 overexpressing cancers abundant CSN6 binds more amounts of Cullin and thus reduces the accessibility of Cullin to CSN5 for deneddylation, thereby preserving Cullin neddylation."
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 activates CUL.
| 2
COPS6 activates CUL. 2 / 2
| 2

reach
"We find that CSN6 enhanced Cullin neddylation facilitates auto-ubiquitination and degradation of Myc E3 ligase Fbxw7, thereby stabilizing Myc, indicates that CSN6 is a positive upstream regulator of Myc."

reach
"CSN6 competes with CSN5 to increase Cullin neddylation."
COPS6 inhibits CUL.
| 1
COPS6 bound to CUL inhibits CUL. 1 / 1
| 1

reach
"On the other hand, it is conceivable that in CSN6 overexpressing cancers abundant CSN6 binds more amounts of Cullin and thus reduces the accessibility of Cullin to CSN5 for deneddylation, thereby preserving Cullin neddylation."
COPS6 affects CORO1A
| 5 3
COPS6 binds CORO1A.
| 1 3
| 1 2

reach
"Mechanism studies show that CSN6 interacts with p57 and Skp2 through its C-terminal domain, which, in turn, promotes Skp2 mediated protein ubiquitination of p57, thereby decreasing the steady-state expression of p57."

sparser
"CSN6 associates with p57 (Kip2) , and its overexpression can decrease the steady-state expression of p57 (Kip2) ; accordingly, CSN6 deficiency leads to p57 (Kip2) stabilization."

sparser
"Significantly, univariate Kaplan-Meier analysis of tumor samples demonstrates that high CSN6 expression or low p57 expression is associated with poor overall survival."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 activates CORO1A.
| 2
COPS6 activates CORO1A. 2 / 2
| 2

reach
"CSN6 associates with p57 (Kip2), and its overexpression can decrease the steady-state expression of p57 (Kip2); accordingly, CSN6 deficiency leads to p57 (Kip2) stabilization."

reach
"CDK inhibitor p57 (Kip2) is negatively regulated by COP9 signalosome subunit 6."
COPS6 inhibits CORO1A.
| 1
COPS6 inhibits CORO1A. 1 / 1
| 1

reach
"Loss of Skp2 compromised CSN6 mediated p57 (Kip2) destabilization, suggesting collaboration between Skp2 and CSN6 in degradation of p57 (Kip2)."
COPS6 decreases the amount of CORO1A.
| 1
COPS6 decreases the amount of CORO1A. 1 / 1
| 1

reach
"CSN6 associates with p57 (Kip2), and its overexpression can decrease the steady-state expression of p57 (Kip2); accordingly, CSN6 deficiency leads to p57 (Kip2) stabilization."
CDKN1B affects COPS6
1 | 1 2 3
1 | 1 2 3

reach
"Mechanistic studies show that CSN6 interacts with p27 (Kip1) and facilitates ubiquitin mediated degradation of p27 (Kip1)."

reach
"Mechanistic studies show that CSN6 interacts with p27 and facilitates ubiquitin mediated degradation of p27."

sparser
"Mechanistic studies show that CSN6 interacts with p27(Kip1) and facilitates ubiquitin-mediated degradation of p27(Kip1)."

No evidence text available

trips
"Mechanistic studies show that CSN6 interacts with p27(Kip1) and facilitates ubiquitin-mediated degradation of p27(Kip1)."

sparser
"Mechanistic studies show that CSN6 interacts with p27 and facilitates ubiquitin-mediated degradation of p27."

sparser
"Mechanistic studies showed that CSN6 interacts with p27 and enhances ubiquitin-mediated degradation of p27."
SKP2 affects COPS6
3 | 2 1
3 | 2

reach
"Mechanism studies show that CSN6 interacts with p57 and Skp2 through its C-terminal domain, which, in turn, promotes Skp2 mediated protein ubiquitination of p57, thereby decreasing the steady-state expression of p57."

No evidence text available

No evidence text available

No evidence text available

reach
"XREF_BIBR The authors provide evidence that CSN6 interacts with SKP2 to promote p57 Kip2 polyubiquitylation."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."

reach
"In HCC, CSN6 overexpression promotes epithelial-mesenchymal transition and predicts poor prognosis (26)."

reach
"Additionally, CSN6 was found to promote EMT by inhibiting E-cadherin, which were significantly mitigated via upregulation of Snail as a result of MEK and ERK pathway activation."

reach
"CSN6 promotes PTC progression by inducing the EMT."

eidos
"CSN6 induces EMT and enhances metastasis of breast cancer cells by reducing Snail1 ubiquitination ."

reach
"Together, the results suggest that CSN6 may positively regulate beta-catenin transcription, thereby mediating the EMT."
COPS6 increases the amount of epithelial to mesenchymal transition.
| 2

reach
"CSN6 positively regulates beta-catenin expression in a beta-Trcp-dependent manner and triggers the expression of several EMT related genes regulated by beta-catenin."

reach
"CSN6 positively regulated beta-catenin expression in a beta-Trcp-dependent manner and triggered expression of several EMT related genes regulated by beta-catenin."
| 1 6
| 1 6

reach
"CSN6 promotes the cell migration of breast cancer cells by positively regulating Snail1 stability."

reach
"CSN6 promoted the cell migration and wound healing abilities in breast cancer cell lines."

eidos
"These results indicate that CSN6 affects the EMT process of cancer cells by up-regulating the expression of Snail1 protein and promotes cell migration ."

reach
"Furthermore, migration and invasion assays showed that knockdown of CSN6 reduced cell migration and invasion in DLD-1."

reach
"Also, WT CSN6 increased cell migration and invasion in a wound healing assay (p < 0.001, Figure 3 I) and in Transwell migration and invasion assays, whereas CSN6 S148A lost such capability, demonstrat[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

reach
"Here, we identified that CSN6 promoted melanoma cell migration and invasion in vivo."

reach
"Also, WT CSN6 increased cell migration and invasion in a wound healing assay (p < 0.001, XREF_FIG) and in transwell migration and invasion assays (XREF_FIG), whereas CSN6 S148A lost such capability, demonstrating that the CSN6 promoted migration and invasion of colon cancer cells requires a phosphorylation event."
COPS6 affects SKP2
3 | 2 1
3 | 2

reach
"Mechanism studies show that CSN6 interacts with p57 and Skp2 through its C-terminal domain, which, in turn, promotes Skp2 mediated protein ubiquitination of p57, thereby decreasing the steady-state expression of p57."

No evidence text available

No evidence text available

No evidence text available

reach
"XREF_BIBR The authors provide evidence that CSN6 interacts with SKP2 to promote p57 Kip2 polyubiquitylation."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 affects ERVK-10
| 3 4
COPS6 binds ERVK-10.
| 2 2
| 2 2

reach
"Co-immunoprecipitation and GST pull-down assays showed that CSN6 bound to ALV integrase likely through direct interaction of CSN6 to the catalytic core of the integrase."

reach
"COP9 signalosome subunit 6 binds and inhibits avian leukosis virus integrase."

sparser
"Co-immunoprecipitation and GST pull-down assays showed that CSN6 bound to ALV integrase likely through direct interaction of CSN6 to the catalytic core of the integrase."

sparser
"COP9 signalosome subunit 6 binds and inhibits avian leukosis virus integrase."
COPS6 inhibits ERVK-10.
| 1 2
| 1 2

reach
"We further demonstrated CSN6 inhibited integrase activity in vitro; knockdown of CSN6 in DF-1 promoted ALV production."

sparser
"We further demonstrated CSN6 inhibited integrase activity in vitro; knockdown of CSN6 in DF-1 promoted ALV production."

sparser
"COP9 signalosome subunit 6 binds and inhibits avian leukosis virus integrase."
COPS6 affects COPS6
| 7
COPS6 activates COPS6.
| 5
COPS6 activates COPS6. 5 / 5
| 5

reach
"CSN6 mRNA levels did not increase significantly in response to EGF (XREF_SUPPLEMENTARY), suggesting that EGF regulates CSN6 posttranslationally."

reach
"CSN6 mRNA levels did not increase significantly in response to EGF, suggesting that EGF regulates CSN6 posttranslationally."

reach
"The EGF-ERK2 Axis Phosphorylates CSN6 on S148 and Enhances CSN6 Stabilization."

reach
"In addition, phosphorylation of CSN6 increases the stability of CSN6, thereby promoting its regulatory capacity."

reach
"CSN6 S60 phosphorylation is known to increase the stability of CSN6 [XREF_BIBR]."
COPS6 inhibits COPS6.
| 2
COPS6 inhibits COPS6. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 affects COP1
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
Fbxw1 affects COPS6
| 3 3
| 3 3

sparser
"We found that CSN6 associated with β-Trcp in vivo ( xref ), suggesting that CSN6 interacts with F-box protein β-Trcp and regulates it, thereby stabilizing β-catenin."

sparser
"We found that CSN6 associated with β-Trcp in vivo (F), suggesting that CSN6 interacts with F-box protein β-Trcp and regulates it, thereby stabilizing β-catenin."

reach
"We found that CSN6 also associates with beta-Trcp and facilitates its degradation."

reach
"We found that CSN6 associated with beta-Trcp in vivo, suggesting that CSN6 interacts with F-box protein beta-Trcp and regulates it, thereby stabilizing beta-catenin."

reach
"We found that CSN6 associated with beta-Trcp in vivo (XREF_FIG), suggesting that CSN6 interacts with F-box protein beta-Trcp and regulates it, thereby stabilizing beta-catenin."

sparser
"We found that CSN6 also associates with β-Trcp and facilitates its degradation."
SNAI1 affects COPS6
| 6
| 6

sparser
"The results of co-immunoprecipitation showed that CSN6 and Snail1 proteins bound to each other (Figure xref D)."

sparser
"Western Blot analysis showed that CSN6 could up-regulate the expression of Snail1 protein in a dose-dependent manner, and CO-IP analysis showed that CSN6 could bind with Snail1."

sparser
"Also we showed that CSN6 associates with Snail1 and enhances Snail1 protein level by inhibiting the ubiquitin-mediated degradation of Snail1."

sparser
"Our findings provided a thoughtful understanding of novel CSN6-Snail1 signaling in promoting breast cancer metastasis."

sparser
"Conclusion: These findings provide new insight into applicability of using the CSN6-Snail1 axis as a potential therapeutic target in breast cancer."

sparser
"Co-immunoprecipitation study was used to show the interaction between the protein CSN6 and Snail1."
CUL5 affects COPS6
5 1 |
5 1 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CUL3 affects COPS6
6 |
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CUL2 affects COPS6
6 |
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects POU2F1
| 6
COPS6 deubiquitinates POU2F1.
| 2
COPS6 leads to the deubiquitination of POU2F1. 2 / 2
| 2

reach
"Moreover, overexpression of CSN6 reduced OCT1 ubiquitination, while ectopic expression of TRIM21 reversed this effect."

reach
"Simultaneously, knockdown of CSN6 increased OCT1 ubiquitination, while knockdown of TRIM21 reversed this impact."
COPS6 decreases the amount of POU2F1.
| 2
COPS6 decreases the amount of POU2F1. 2 / 2
| 2

reach
"Consistent with this finding, we found that knockdown of CSN6 increased the ubiquitination level of OCT1."

reach
"We found that overexpression of CSN6 reduced the ubiquitination level of OCT1."
COPS6 inhibits POU2F1.
| 1
COPS6 inhibits POU2F1. 1 / 1
| 1

reach
"Indeed, CSN6 knockdown led to decelerated turnover of TRIM21 but accelerated turnover of OCT1."
COPS6 increases the amount of POU2F1.
| 1
COPS6 increases the amount of POU2F1. 1 / 1
| 1

reach
"We found that the expression of CSN6 increased the steady-state protein expression levels of OCT1 and ALDH1A1, with a concurrent reduction in TRIM21 expression in a dose dependent manner."
COPS6 affects MAPK1
2 | 4
COPS6 binds MAPK1 and Leu163. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
2 |

No evidence text available

No evidence text available
COPS6 affects ERK
| 2 4
| 2 4

sparser
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 ( xref )."

sparser
"Model of CSN6-ERK Interaction."

sparser
"In the present study, replacing some conserved residues on the D- site compromised CSN6’s capacity to interact with ERK, suggesting that these residues are involved in ERK-CSN6 protein-protein interaction."

reach
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 (XREF_FIG)."

sparser
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6 (B)."

reach
"A coimmunoprecipitation assay revealed that ERK1/2 binds to CSN6."
| 3 3
| 3

sparser
"This shuttling of p27 Kip1 from the nucleus to the cytoplasm could be mediated by additional interaction with CSN6 and the E3 ubiquitin ligase constitutive photomorphogenic 1 (COP1) [ xref ]."

sparser
"This study demonstrated that UBR5, a novel E3 ubiquitin ligase interacting with CSN6, was negatively regulated by CSN6 and was responsible for CDK9 ubiquitination and degradation in melanoma cells."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 activates E3_Ub_ligase.
| 3
| 3

reach
"For example, CSN6, a component of the COP9 signalosome, positively regulate E3 ubiquitin ligases."

reach
"It has been reported that CSN6 can promote some degree of tumor progression by regulating the stability of several E3 ligases XREF_BIBR - XREF_BIBR, XREF_BIBR."

reach
"Mechanistic studies show that CSN6 binds and regulates FOXO4 stability through enhancing the E3 ligase activity of COP1, and that COP1 directly interacts with FOXO4 through a VP motif on FOXO4 and accelerates the ubiquitin-mediated degradation of FOXO4."
COPS6 affects CUL5
5 1 |
5 1 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CUL3
6 |
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CUL2
6 |
6 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects BTBD2
5 1 |
5 1 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
SFN affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
RBX1 affects COPS6
1 1 | 2 1
1 1 | 2

No evidence text available

reach
"In addition, components of signaling pathways such as IkappaBalpha 17 and the adenomatous polyposis coli (APC) protein 18 are stabilized by USP15.In CSN-CRL complexes, subunit CSN2 interacts with cull[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available

reach
"CSN6 processing occurs in CSN-CRL complexes and is followed by the cleavage of Rbx1, the direct interaction partner of CSN6."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
NEDD8 affects COPS6
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
MYC affects COPS6
| 5
MYC activates COPS6.
| 3
MYC activates COPS6. 3 / 3
| 3

reach
"CSN6 increase Myc stability by reducing Myc ubiquitination."

reach
"A recent study also demonstrated that CSN6 contributed to carcinogenesis by positive regulation of Myc stability."

reach
"As expected, Myc mediated transcriptional activation target CDK4 and Myc mediated transcriptional repression targets p27Kip1 and p21Cip1 were deregulated in Emicro-Myc and Csn6 +/- lymphomas compared to Emicro-Myc and Csn6 +/+ lymphomas (XREF_FIG)."
MYC binds COPS6.
| 2
| 2

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."

reach
"These data show that the association between CSN6 and Myc is present in many types of human cancer, suggesting that the positive regulation of Myc by CSN6 may be a clinically relevant regulatory pathway in human cancers (XREF_FIG)."
LRR1 affects COPS6
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
ERCC8 affects COPS6
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
DDB1 affects COPS6
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
DCAF11 affects COPS6
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CUL affects COPS6
| 1 3
| 1 1

sparser
"Indeed, based on the mole fraction of Csn6 that is bound to individual cullins, up to 60% of CSN remains associated with cullins following immunoprecipitation ( xref )."

reach
"On the other hand, it is conceivable that in CSN6 overexpressing cancers abundant CSN6 binds more amounts of Cullin and thus reduces the accessibility of Cullin to CSN5 for deneddylation, thereby preserving Cullin neddylation."
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 affects ptc
| 5
COPS6 activates ptc. 5 / 5
| 5

reach
"In vitro and in vivo data showed that loss of CSN6 attenuated cell proliferation, migration, and invasion of PTC cells, confirming the vital function of CSN6 in PTC."

reach
"CSN6 promotes PTC progression by inducing the EMT."

reach
"Second, functional assays showed that CSN6 inhibition significantly reduced both the motility and the proliferation of PTC cells."

reach
"Thus, loss of CSN6 expression inhibits PTC proliferation and migration."

reach
"These results suggest that CSN6 robustly modulates PTC migration and invasiveness."
COPS6 affects cell growth
| 1 3
| 1 3

reach
"MTT and BrdU assays revealed that recovery of CSN6 expression rescued cell growth and proliferation."

reach
"Knockdown of COPS5 and COPS6 inhibited cell growth and migration of the CAL27 and SCC25 cell lines."

eidos
"CSN6 knockdown hindered cell growth , soft agar colony formation , and tumorigenicity ( Figure S17A-D , Supporting Information ) compared with control cells ."

reach
"Also, CSN6 overexpression leads to increased cell growth, transformation and promotes tumorigenicity."
COPS6 affects Ubiquitin
| 5
COPS6 inhibits Ubiquitin.
| 3
| 3

reach
"Indeed, we revealed that CSN6 reduces the stability of UBR5 by regulating the ubiquitin mediated degradation of UBR5, furtherly stabilizing CDK9 expression, suggesting that UBR5 may be a downstream factor of CSN6 in melanoma cells."

reach
"Taken together, these results indicate that EGF signaling elevated CSN6 and COP1 to cause down regulation of FOXO4 regardless of its PKB/Akt‐mediated phosphorylation status.2.2 CSN6 Enhances Ubiquitin-Mediated Degradation of FOXO4 through K48 Link."

reach
"2.1 EGF Signal and CSN6/COP1 Enhance Ubiquitin-Mediated Degradation of FOXO4."
COPS6 activates Ubiquitin.
| 2
| 2

reach
"For example, CSN6, a component of the COP9 signalosome, positively regulate E3 ubiquitin ligases."

reach
"31 Our data indicates that CSN6 enhances ubiquitin‐mediated degradation of FOXO4 through K48 link ubiquitination, thereby downregulating FOXO4.2.3 COP1 Is Involved in CSN6-Mediated Ubiquitination of FOXO4."
COPS6 affects STUB1
| 1 3 1
COPS6 binds STUB1.
| 1 1 1
| 1 1 1

sparser
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self-ubiquitination."

trips
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self-ubiquitination."

reach
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self ubiquitination."
COPS6 decreases the amount of STUB1.
| 2
COPS6 decreases the amount of STUB1. 2 / 2
| 2

reach
"Moreover, CSN6 decreased CHIP expression and increased EGFR expression in the tumor samples."

reach
"Inhibition of CSN6 by small interfering RNA decreased PD-L1 expression but also increased CHIP expression in GBM cells."
COPS6 affects SLC2A1
1 1 | 1 2
COPS6 increases the amount of SLC2A1.
| 2
COPS6 increases the amount of SLC2A1. 2 / 2
| 2

reach
"As CSN6 mitigates the expression level of FOXO4, we showed that CSN6 overexpression leads to increased gene expression of Glut1 (Figure 5F, Figure S15A, Supporting Information)."

reach
"In contrast, protein analysis demonstrated that CSN6 knockdown reduced the expression of Glut1 while increased the expression of FOXO4 (Figure 5F)."
COPS6 binds SLC2A1.
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 activates SLC2A1.
| 1
COPS6 activates SLC2A1. 1 / 1
| 1

eidos
"In contrast , protein analysis demonstrated that CSN6 knockdown reduced the expression of Glut1 while increased the expression of FOXO4 ( Figure 5F ) ."
COPS6 affects SIRT2
| 2 3
COPS6 inhibits SIRT2.
| 2 1
COPS6 inhibits SIRT2. 3 / 3
| 2 1

eidos
"Further investigation discovered that CSN6 suppressed the expression of SIRT2 via up-regulating Nkx2.2 , a transcription suppressor of SIRT2 ."

reach
"Finally, our data showed that CSN6 was partially dependent on the stabilization of Nkx2.2 protein to inhibit SIRT2 and promote myocardial hypertrophy."

eidos
"CSN6 inhibited the expression of SIRT2 , and re-expression of SIRT2 attenuated the myocardial hypertrophy caused by CSN6 overexpression ."
COPS6 decreases the amount of SIRT2.
| 2
COPS6 decreases the amount of SIRT2. 2 / 2
| 2

reach
"CSN6 inhibited the expression of SIRT2, and re-expression of SIRT2 attenuated the myocardial hypertrophy caused by CSN6 overexpression."

reach
"Further investigation discovered that CSN6 suppressed the expression of SIRT2 via up-regulating Nkx2.2, a transcription suppressor of SIRT2."
COPS6 affects SFN
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects RBX1
1 1 | 2 1
1 1 | 2

No evidence text available

reach
"In addition, components of signaling pathways such as IkappaBalpha 17 and the adenomatous polyposis coli (APC) protein 18 are stabilized by USP15.In CSN-CRL complexes, subunit CSN2 interacts with cull[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

No evidence text available

reach
"CSN6 processing occurs in CSN-CRL complexes and is followed by the cleavage of Rbx1, the direct interaction partner of CSN6."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 affects NEDD8
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects MDM2
| 5
COPS6 deubiquitinates MDM2.
| 3
COPS6 leads to the deubiquitination of MDM2 on K364. 2 / 2
| 2

reach
"Mechanism studies indicated that CSN6 prevented MDM2 autoubiquitination at lysine 364, resulting in stabilization of MDM2 and degradation of p53."

reach
"Previous studies have demonstrated that CSN6 prevents MDM2 autoubiquitination at lysine 364, which results in the stabilization of MDM2 and the degradation of p53."
Modified COPS6 leads to the deubiquitination of MDM2 on K364. 1 / 1
| 1

reach
"Expression of CSN6 appeared to prevent MDM2 autoubiquitination at lysine 364, resulting in stabilization of MDM2 and degradation of p53."
COPS6 activates MDM2.
| 2
COPS6 activates MDM2. 2 / 2
| 2

reach
"CSN6 may promote carcinogenesis by positively regulating v-myc avian myelocytomatosis viral oncogene homolog (Myc) and MDM2 proto-oncogene stability, and is regarded as a potential target for cancer therapy."

reach
"Previously, Lee 's laboratory demonstrated that CSN6, a subunit of the COP9 signalosome, interacts with and inhibits the degradation of an oncogene MDM2, leading to its stabilization (XREF_FIG)."
COPS6 affects MAP3K1
| 1 1 1
COPS6 binds MAP3K1.
| 1 1
| 1 1

trips
"Here, we show that CSN6 associates with MEKK1 and reduces MEKK1 expression level by facilitating the ubiquitin-mediated degradation of MEKK1."

sparser
"Here, we show that CSN6 associates with MEKK1 and reduces MEKK1 expression level by facilitating the ubiquitin-mediated degradation of MEKK1."
COPS6 decreases the amount of MAP3K1.
| 1
COPS6 decreases the amount of MAP3K1. 1 / 2
| 1

reach
"Here, we show that CSN6 associates with MEKK1 and reduces MEKK1 expression level by facilitating the ubiquitin mediated degradation of MEKK1."
COPS6 affects LRR1
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects ERCC8
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects EGFR
| 3
COPS6 increases the amount of EGFR.
| 1
COPS6 increases the amount of EGFR. 1 / 3
| 1

reach
"Moreover, CSN6 decreased CHIP expression and increased EGFR expression in the tumor samples."
COPS6 deubiquitinates EGFR.
| 1
COPS6 leads to the deubiquitination of mutated EGFR. 1 / 1
| 1

reach
"Reduction of mutant EGFR ubiquitination by CSN6 causes steadily elevated levels of EGFR, leading to proliferation, migration, invasion, and tumorigenesis 35."
COPS6 decreases the amount of EGFR.
| 1
COPS6 decreases the amount of EGFR. 1 / 1
| 1

reach
"Moreover, CSN6 decreased CHIP expression and increased EGFR expression in the tumor samples."
COPS6 affects DDB1
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects DCAF11
5 |
5 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CDKN2A
| 4 1
COPS6 binds CDKN2A.
| 2 1
| 2 1

reach
"Immunofluorescence localization and a co-immunoprecipitation study were used to show the interaction between the protein CSN6 and p16."

reach
"Moreover, CSN6 interacted with p16 and a proteasome activator REGgamma (PA28gamma), thereby facilitating ubiquitin independent degradation of p16."

sparser
"Immunofluorescence localization and a co-immunoprecipitation study were used to show the interaction between the protein CSN6 and p16."
COPS6 inhibits CDKN2A.
| 2
COPS6 inhibits CDKN2A. 2 / 2
| 2

reach
"Ubiquitination assay was performed to validate whether ubiquitination is involved in CSN6 mediated p16 degradation."

reach
"Du et al (42) demonstrated that CSN6 promoted the occurrence of gastric cancer via the ubiquitin-independent proteasomal degradation of p16INK4a."
COPS6 affects Aldh1a1 mRNA
| 5
COPS6 activates Aldh1a1 mRNA. 5 / 5
| 5

eidos
"We further showed that CSN6 expression caused a significant increase in the Aldh1a1 mRNA level in control cells but not in TRIM21 KO cells ( Fig. 2n ) ."

eidos
"In addition , quantitative RT-PCR analysis indicated that CSN6 knockdown caused a decrease in the Aldh1a1 mRNA level but failed to do so when TRIM21 was also knocked down ( Fig. 2m ) ."

eidos
"Importantly , CSN6 caused an increase in the Aldh1a1 mRNA level and that overexpression of TRIM21 led to a decrease in the Aldh1a1 mRNA level , even in the presence of CSN6 ( Fig. 2l ) ."

eidos
"Accordingly , CSN6 knockdown led to a decrease in the level of Aldh1a1 mRNA ( Fig. 1d ) , while ectopic expression of CSN6 in both the HCT116 and DLD-1 cell lines resulted in increased Aldh1a1 mRNA levels ( Fig. 1d ) ."

eidos
"CSN6 regulates ALDH1A1 expression through TRIM21 To investigate how knockdown of CSN6 can lead to reduced expression of Aldh1a1 mRNA , we determined whether CSN6-associated proteins might have a role ."
4 |
Pirinixic acid increases the amount of COPS6. 4 / 4
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
PRSS27 affects COPS6
| 4
| 3

sparser
"The association of CSN5 and CSN6 MPN (for Mpr1/Pad1 N-terminal) domains activates its isopeptidase activity."

sparser
"Here we report that CSN6 N-terminal domain containing its MPN domain can form a stable heterodimer with CSN5 catalytic domain in vitro ."

sparser
"CSN5 alone is inactive due to an auto-inhibited conformation of its catalytic domain, and the association of CSN5 with the CSN6 MPN (Mpr1/Pad1 N-terminal) domain activates its isopeptidase activity xref ."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
MAP2K1 affects COPS6
| 4
MAP2K1 phosphorylates COPS6.
| 2
MAP2K1 leads to the phosphorylation of COPS6 on serine. 2 / 2
| 2

reach
"MEK1 inhibition with PD98059 treatment abolished the serine phosphorylation of CSN6 (XREF_FIG)."

reach
"MEK1 inhibition with PD98059 treatment abolished the serine phosphorylation of CSN6."
MAP2K1 increases the amount of COPS6.
| 2
Modified MAP2K1 increases the amount of COPS6. 2 / 2
| 2

reach
"In addition, the expression of a constitutively active MEK1 (MEK1 CA) increased CSN6 expression in DLD-1 cells (XREF_SUPPLEMENTARY)."

reach
"In addition, the expression of a constitutively active MEK1 (MEK1 CA) increased CSN6 expression in DLD-1 cells."
FEM1B affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
FBXO17 affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
ERVK-10 affects COPS6
| 2 2
| 2 2

reach
"Co-immunoprecipitation and GST pull-down assays showed that CSN6 bound to ALV integrase likely through direct interaction of CSN6 to the catalytic core of the integrase."

reach
"COP9 signalosome subunit 6 binds and inhibits avian leukosis virus integrase."

sparser
"Co-immunoprecipitation and GST pull-down assays showed that CSN6 bound to ALV integrase likely through direct interaction of CSN6 to the catalytic core of the integrase."

sparser
"COP9 signalosome subunit 6 binds and inhibits avian leukosis virus integrase."
EIF3E affects COPS6
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
DDA1 affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
DCAF4 affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
DCAF1 affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
CSN2 affects COPS6
| 2 2
| 2

reach
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17]."

reach
"When taken together with the known crystal structure of the SCF [13] this allows us to speculate that the interaction of CSN2 and CSN6 with the SCF could serve to position the CSN5 subunit such that i[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CORO1A affects COPS6
| 1 3
| 1 2

reach
"Mechanism studies show that CSN6 interacts with p57 and Skp2 through its C-terminal domain, which, in turn, promotes Skp2 mediated protein ubiquitination of p57, thereby decreasing the steady-state expression of p57."

sparser
"CSN6 associates with p57 (Kip2) , and its overexpression can decrease the steady-state expression of p57 (Kip2) ; accordingly, CSN6 deficiency leads to p57 (Kip2) stabilization."

sparser
"Significantly, univariate Kaplan-Meier analysis of tumor samples demonstrates that high CSN6 expression or low p57 expression is associated with poor overall survival."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 affects PRSS27
| 4
| 3

sparser
"The association of CSN5 and CSN6 MPN (for Mpr1/Pad1 N-terminal) domains activates its isopeptidase activity."

sparser
"Here we report that CSN6 N-terminal domain containing its MPN domain can form a stable heterodimer with CSN5 catalytic domain in vitro ."

sparser
"CSN5 alone is inactive due to an auto-inhibited conformation of its catalytic domain, and the association of CSN5 with the CSN6 MPN (Mpr1/Pad1 N-terminal) domain activates its isopeptidase activity xref ."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
COPS6 affects FEM1B
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects FBXO17
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects EIF3E
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects DDA1
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects DCAF4
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects DCAF1
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CSN2
| 2 2
| 2

reach
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17]."

reach
"When taken together with the known crystal structure of the SCF [13] this allows us to speculate that the interaction of CSN2 and CSN6 with the SCF could serve to position the CSN5 subunit such that i[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 affects BTBD1
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
COPS6 affects ALDH1A1
| 1 3
COPS6 increases the amount of ALDH1A1.
| 3
COPS6 increases the amount of ALDH1A1. 3 / 3
| 3

reach
"Importantly, CSN6 caused an increase in the Aldh1a1 mRNA level and that overexpression of TRIM21 led to a decrease in the Aldh1a1 mRNA level, even in the presence of CSN6."

reach
"40 Interestingly, CSN6 is able to promote the expression of ALDH1A1, a known CSC marker upregulated in cancer spheroids."

reach
"We found that the expression of CSN6 increased the steady-state protein expression levels of OCT1 and ALDH1A1, with a concurrent reduction in TRIM21 expression in a dose dependent manner."
COPS6 activates ALDH1A1.
| 1
COPS6 activates ALDH1A1. 1 / 1
| 1

eidos
"Cells with high ALDH1A1 levels have increased expression levels of vimentin , matrix metalloproteinase-2 ( MMP2 ) , MMP7 and MMP9 , which are implicated in epithelial-mesenchymal transition and metastatic capabilities.40 Interestingly , CSN6 is able to promote the expression of ALDH1A1 , a known CSC marker upregulated in cancer spheroids.41 Chromatin immunoprecipitation assays have characterised ALDH1A1 as a direct target of beta-catenin activation ."
COPS5 affects PRSS27
| 4
| 3

sparser
"The association of CSN5 and CSN6 MPN (for Mpr1/Pad1 N-terminal) domains activates its isopeptidase activity."

sparser
"Here we report that CSN6 N-terminal domain containing its MPN domain can form a stable heterodimer with CSN5 catalytic domain in vitro ."

sparser
"CSN5 alone is inactive due to an auto-inhibited conformation of its catalytic domain, and the association of CSN5 with the CSN6 MPN (Mpr1/Pad1 N-terminal) domain activates its isopeptidase activity xref ."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
BTBD1 affects COPS6
4 |
4 |

No evidence text available

No evidence text available

No evidence text available

No evidence text available
Vpr affects COPS6
| 2 1
| 2 1

reach
"We demonstrate direct interactions between the putative ligand hVIP and MOV34 and Vpr in vitro and in vivo."

reach
"Human Vpr interacting protein (hVIP and Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [XREF_BIBR]."

sparser
"These data illustrate that the carboxyl-terminal domain of hVIP is critical for mediating hVIP-Vpr interaction as well as for its glucocorticoid response."
Quercetin affects COPS6
| 2
| 2

reach
"Western blot analysis revealed that quercetin reduced the protein expression levels of phosphorylated-Akt and increased CSN6 protein degradation; therefore, affecting the expression levels of Myc, p53, B-cell lymphoma 2 (Bcl-2) and Bcl-2 associated X protein."

reach
"In another study, quercetin inhibited the viability of HT29 cells, caused cell shrinkage, chromatin condensation, and nuclear collapse, lessened the protein expression levels of phosphorylated-Akt, and augmented the protein degradation of constitutive photomorphogenesis 6 signalosome (CSN6) (Yang et al., 2016)."
TOR1AIP2 affects COPS6
3 |

No evidence text available

No evidence text available

No evidence text available
TK1 affects COPS6
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
Snail1 affects COPS6
| 3
COPS6 binds Snail1. 3 / 3
| 3

reach
"We next investigated how CSN6 interacted with Snail1 to regulate the protein level of Snail1."

reach
"Western Blot analysis showed that CSN6 could up-regulate the expression of Snail1 protein in a dose dependent manner, and CO-IP analysis showed that CSN6 could bind with Snail1."

reach
"Co-immunoprecipitation study was used to show the interaction between the protein CSN6 and Snail1."
STUB1 affects COPS6
| 1 1 1
| 1 1 1

sparser
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self-ubiquitination."

trips
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self-ubiquitination."

reach
"We showed that CSN6 associated with CHIP and led to CHIP destabilization by increasing CHIP self ubiquitination."
SMN1 affects COPS6
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
RPL15 affects COPS6
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
RHOBTB1 affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
NR3C1 affects COPS6
1 1 | 1
1 1 | 1

reach
"Human Vpr interacting protein (hVIP and Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [XREF_BIBR]."

No evidence text available

No evidence text available
MPN domain affects COPS6
| 3
COPS6 binds COPS5 and MPN domain. 3 / 3
| 3

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation (Lingaraju et al., 2014)."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation 55."
MAPK affects COPS6
| 2 1
| 2 1

reach
"To gain insight into the structural basis of CSN6 's recognition by MAPK, we used HADDOCK to generate a model of the CSN6 and MAPK complex."

sparser
"The model reveals that CSN6 D-site interacts with the MAPK docking groove."

reach
"When its D-site was mutated to alanine (LV --> AA), CSN6 lost its ability to bind to MAPK, suggesting that the ERK docking groove binds to a D site at L163 and V165 in CSN6.To gain insight into the st[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
MAP3K1 affects COPS6
| 1 1
| 1 1

trips
"Here, we show that CSN6 associates with MEKK1 and reduces MEKK1 expression level by facilitating the ubiquitin-mediated degradation of MEKK1."

sparser
"Here, we show that CSN6 associates with MEKK1 and reduces MEKK1 expression level by facilitating the ubiquitin-mediated degradation of MEKK1."
LRRC14 affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
GNPTAB affects COPS6
| 3
| 2

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N terminal) () subunits, CSN5 and CSN6."

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N-terminal) ( xref ; xref ; xref ) subunits, CSN5 and CSN6."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
Flag affects COPS6
| 3
| 3

sparser
"These results show that the CSN complex bear only one copy of Csn6, either a full-length or a truncated form (S6CD); while the MPN − domain fragment of Csn6, when expressed without the S6CD and incapable of integrating into the CSN complex, can still interact with over-stoichiometric amounts of Flag-Csn6 ( xref , xref , xref )."

sparser
"Interestingly, HA-S6MPN, which did not co-IP with endogenous CSN subunits, interacted with ectopically expressed Flag-Csn6 ( xref )."

sparser
"FlagCSN6 was previously described. [ xref ] pCMV5‐Flag‐COP1 was kindly provided by E. Bianchi."
FBXO7 affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
FASN affects COPS6
| 3
| 3

sparser
"Mechanistic studies show that CSN6 associates with both FBXW7β and FASN, and antagonizes FBXW7β's activity by enhancing FBXW7β autoubiquitination and degradation, which in turn prevents FBXW7β-mediated FASN ubiquitination and degradation, thereby regulating lipogenesis positively."

sparser
"Both CSN6 and FASN are positively correlated in CRC, and CSN6-FASN axis, regulated by EGF, is responsible for poor prognosis of CRC."

sparser
"Thus, CSN6-FASN axis reprograms lipogenesis to promote tumor growth and is a target for cancer intervening strategy in CRC."
ELOC affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
| 3

sparser
"This shuttling of p27 Kip1 from the nucleus to the cytoplasm could be mediated by additional interaction with CSN6 and the E3 ubiquitin ligase constitutive photomorphogenic 1 (COP1) [ xref ]."

sparser
"This study demonstrated that UBR5, a novel E3 ubiquitin ligase interacting with CSN6, was negatively regulated by CSN6 and was responsible for CDK9 ubiquitination and degradation in melanoma cells."

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
DTL affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
CSN3 affects COPS6
| 3
COPS6 binds COPS5 and CSN3. 3 / 3
| 3

sparser
"Our data also demonstrate that CSNAP binds to CSN3, CSN5 and CSN6, possibly linking the MPN and PCI substructures."

sparser
"CSNAP interacts with CSN3, CSN5, and CSN6."

sparser
"We show that CSNAP binds CSN3, CSN5 and CSN6 and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
COPS9 affects COPS6
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects vpr
| 2 1
| 2 1

reach
"We demonstrate direct interactions between the putative ligand hVIP and MOV34 and Vpr in vitro and in vivo."

reach
"Human Vpr interacting protein (hVIP and Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [XREF_BIBR]."

sparser
"These data illustrate that the carboxyl-terminal domain of hVIP is critical for mediating hVIP-Vpr interaction as well as for its glucocorticoid response."
COPS6 affects quercetin
| 3
| 3

reach
"The overexpression of CSN6 reduced the effect of quercetin treatment on HT-29 cells, suggesting that quercetin induced apoptosis may involve the Akt-CSN6-Myc signaling axis in HT-29 cells."

reach
"The MTT assay revealed that the overexpression of CSN6 reduced the effect of quercetin on cell viability compared with the empty plasmid MIGR1 (XREF_FIG)."

reach
"The MTT assay revealed that the overexpression of CSN6 reduced the effect of quercetin on cell viability compared with the empty MIGR1 plasmid (XREF_FIG)."

reach
"A colitis-associated colorectal cancer model established that Csn6 intestinal conditional deletion decreased tumor development and altered nucleotide metabolism."

eidos
"CSN6 mediates nucleotide metabolism to promote tumor development and chemoresistance in colorectal cancer ."

reach
"CSN6 mediates nucleotide metabolism to promote tumor development and chemoresistance in colorectal cancer."
COPS6 affects migration
| 3
COPS6 activates migration. 3 / 3
| 3

eidos
"In melanoma cells , CSN6 knockdown remarkably inhibited cell proliferation , tumorigenicity , migration , and invasion , whereas CSN6 recovery rescued the proliferative and metastatic abilities ."

eidos
"CSN6 promotes GBM proliferation , migration , invasion , and tumorigenesis through upregulation of EGFR by blocking its ubiquitination ; this happens as a result of interactions with CHIP that cause its degradation , although CHIP auto-ubiquitination occurs through an unknown mechanism [ 91 ] ."

eidos
"In summary , these findings demonstrated that downregulation of CSN6 expression could inhibit cell proliferation , migration and invasion ."
| 3

reach
"CSN6 knockdown also accelerated apoptosis as evident in increased sub-G1 population after propidium iodide staining followed by flow cytometry."

reach
"Through combinatorial effects on the MDM2-p53 signaling axis and now SKP2 mediated p57 Kip2 degradation, it is hypothesized that CSN6 overexpression can effectively promote cell proliferation by simultaneously relieving cell cycle restraints, apoptosis, senescence, and presumably p53 functions in DNA damage repair and cell metabolism, among other important tumor suppressive mechanisms."

reach
"CSN6 knockdown increased apoptosis as evident in increased Annexin V staining when compared with vector control."
COPS6 affects TOR1AIP2
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects TK1
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects Snail1 protein
| 1 2
COPS6 activates Snail1 protein.
| 1 1
COPS6 activates Snail1 protein. 2 / 2
| 1 1

reach
"The above results prompted us to study how CSN6 up-regulates Snail1 protein."

eidos
"The above results prompted us to study how CSN6 up-regulates Snail1 protein ."
COPS6 increases the amount of Snail1 protein.
| 1
COPS6 increases the amount of Snail1 protein. 1 / 1
| 1

reach
"Western Blot analysis showed that CSN6 could up-regulate the expression of Snail1 protein in a dose dependent manner, and CO-IP analysis showed that CSN6 could bind with Snail1."
COPS6 affects SMN1
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects RPL15
2 1 |
2 1 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects RHOBTB1
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects NR3C1
1 1 | 1
1 1 | 1

reach
"Human Vpr interacting protein (hVIP and Mov34), which binds to both Vpr and GR, translocates to the nucleus following either dexamethasone or Vpr treatment, further suggesting that Vpr and GR form an functional complex within cells [XREF_BIBR]."

No evidence text available

No evidence text available
COPS6 affects MPN domain
| 3
COPS6 binds COPS5 and MPN domain. 3 / 3
| 3

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation (Lingaraju et al., 2014)."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation 55."
COPS6 affects MAPK
| 2 1
| 2 1

reach
"To gain insight into the structural basis of CSN6 's recognition by MAPK, we used HADDOCK to generate a model of the CSN6 and MAPK complex."

sparser
"The model reveals that CSN6 D-site interacts with the MAPK docking groove."

reach
"When its D-site was mutated to alanine (LV --> AA), CSN6 lost its ability to bind to MAPK, suggesting that the ERK docking groove binds to a D site at L163 and V165 in CSN6.To gain insight into the st[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"
COPS6 affects LRRC14
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects GNPTAB
| 3
| 2

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N terminal) () subunits, CSN5 and CSN6."

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N-terminal) ( xref ; xref ; xref ) subunits, CSN5 and CSN6."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
COPS6 affects Flag
| 3
| 3

sparser
"These results show that the CSN complex bear only one copy of Csn6, either a full-length or a truncated form (S6CD); while the MPN − domain fragment of Csn6, when expressed without the S6CD and incapable of integrating into the CSN complex, can still interact with over-stoichiometric amounts of Flag-Csn6 ( xref , xref , xref )."

sparser
"Interestingly, HA-S6MPN, which did not co-IP with endogenous CSN subunits, interacted with ectopically expressed Flag-Csn6 ( xref )."

sparser
"FlagCSN6 was previously described. [ xref ] pCMV5‐Flag‐COP1 was kindly provided by E. Bianchi."
COPS6 affects FBXO7
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects FASN
| 3
| 3

sparser
"Mechanistic studies show that CSN6 associates with both FBXW7β and FASN, and antagonizes FBXW7β's activity by enhancing FBXW7β autoubiquitination and degradation, which in turn prevents FBXW7β-mediated FASN ubiquitination and degradation, thereby regulating lipogenesis positively."

sparser
"Both CSN6 and FASN are positively correlated in CRC, and CSN6-FASN axis, regulated by EGF, is responsible for poor prognosis of CRC."

sparser
"Thus, CSN6-FASN axis reprograms lipogenesis to promote tumor growth and is a target for cancer intervening strategy in CRC."
COPS6 affects ELOC
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects EGF
| 3
COPS6 activates EGF.
| 2
COPS6 activates EGF. 2 / 2
| 2

reach
"CSN6 mRNA levels did not increase significantly in response to EGF, suggesting that EGF regulates CSN6 posttranslationally."

reach
"CSN6 mRNA levels did not increase significantly in response to EGF (XREF_SUPPLEMENTARY), suggesting that EGF regulates CSN6 posttranslationally."
COPS6 inhibits EGF.
| 1
COPS6 inhibits EGF. 1 / 1
| 1

reach
"Importantly, EGF‐mediated down regulation of FOXO4 can be reversed by the knockdown of CSN6 (Figure 1D), suggesting the involvement of CSN6 during this process."
COPS6 affects DTL
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects CSN3
| 3
COPS6 binds COPS5 and CSN3. 3 / 3
| 3

sparser
"Our data also demonstrate that CSNAP binds to CSN3, CSN5 and CSN6, possibly linking the MPN and PCI substructures."

sparser
"CSNAP interacts with CSN3, CSN5, and CSN6."

sparser
"We show that CSNAP binds CSN3, CSN5 and CSN6 and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
COPS6 affects COPS9
3 |
3 |

No evidence text available

No evidence text available

No evidence text available
COPS6 affects A0A288CFT1
3 |

No evidence text available

No evidence text available

No evidence text available
COPS5 affects MPN domain
| 3
COPS6 binds COPS5 and MPN domain. 3 / 3
| 3

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation (Lingaraju et al., 2014)."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation 55."
COPS5 affects GNPTAB
| 3
| 2

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N terminal) () subunits, CSN5 and CSN6."

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N-terminal) ( xref ; xref ; xref ) subunits, CSN5 and CSN6."
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
COPS5 affects CSN3
| 3
COPS6 binds COPS5 and CSN3. 3 / 3
| 3

sparser
"Our data also demonstrate that CSNAP binds to CSN3, CSN5 and CSN6, possibly linking the MPN and PCI substructures."

sparser
"CSNAP interacts with CSN3, CSN5, and CSN6."

sparser
"We show that CSNAP binds CSN3, CSN5 and CSN6 and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
COPS5 affects COPS6, and PRSS27
| 3
| 3

sparser
"The association of CSN5 and CSN6 MPN (for Mpr1/Pad1 N-terminal) domains activates its isopeptidase activity."

sparser
"Here we report that CSN6 N-terminal domain containing its MPN domain can form a stable heterodimer with CSN5 catalytic domain in vitro ."

sparser
"CSN5 alone is inactive due to an auto-inhibited conformation of its catalytic domain, and the association of CSN5 with the CSN6 MPN (Mpr1/Pad1 N-terminal) domain activates its isopeptidase activity xref ."
COPS5 affects COPS6, and MPN domain
| 3
COPS6 binds COPS5 and MPN domain. 3 / 3
| 3

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain, and the dimer is topologically knotted to engage in Cullin deneddylation (Lingaraju et al., 2014)."

reach
"Structurally, CSN6 and CSN5 form a heterodimer through MPN domain and the dimer is topologically knotted to engage in Cullin deneddylation 55."
COPS5 affects COPS6, and CSN3
| 3
COPS6 binds COPS5 and CSN3. 3 / 3
| 3

sparser
"Our data also demonstrate that CSNAP binds to CSN3, CSN5 and CSN6, possibly linking the MPN and PCI substructures."

sparser
"CSNAP interacts with CSN3, CSN5, and CSN6."

sparser
"We show that CSNAP binds CSN3, CSN5 and CSN6 and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
CDKN2A affects COPS6
| 2 1
| 2 1

reach
"Immunofluorescence localization and a co-immunoprecipitation study were used to show the interaction between the protein CSN6 and p16."

reach
"Moreover, CSN6 interacted with p16 and a proteasome activator REGgamma (PA28gamma), thereby facilitating ubiquitin independent degradation of p16."

sparser
"Immunofluorescence localization and a co-immunoprecipitation study were used to show the interaction between the protein CSN6 and p16."
A0A288CFT1 affects COPS6
3 |

No evidence text available

No evidence text available

No evidence text available
2 |
Cobalt dichloride decreases the amount of COPS6. 2 / 2
2 |

No evidence text available

No evidence text available

sparser
"For example, CSN6 can interact with amino-terminal caspase recruitment domain (CARD) of Nod1, a cytoplasmic protein that belongs to the Nod/NLR/CATERPILLER protein family and whose activation is involved in apoptotic pathways."

reach
"For example, CSN6 can interact with amino-terminal caspase recruitment domain (CARD) of Nod1, a cytoplasmic protein that belongs to the Nod/NLR/CATERPILLER protein family and whose activation is involved in apoptotic pathways."
ZNF24 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
ZEB2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
WIPI2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
UBR5 affects COPS6
| 1 1
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
| 1

sparser
"A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells (Fig. xref )."
UBE2M affects COPS6
2 |
2 |

No evidence text available

No evidence text available
TRIB3 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
TRDMT1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
TDGF1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
Ser148 affects MAPK1
| 2
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
SULT1E1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
STX5 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
STK40 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
SNRPG affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
SLC2A1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
SKP1 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
SERPINB9 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
SERPINA5 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
SAT1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
S100A10 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
RPA2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
ROGDI affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
RFC5 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
RAE1 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
RAB27A affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
QTRT1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PTEN affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PSMD11 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PSAP affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PRKRA affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PMF1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PHYHIP affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PFKL affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PDZK1IP1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PAFAH1B3 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
PAEP affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
ORAI2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
NOD1 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
MYCBP affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
MNAT1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
MAPK1 affects Ser148
| 2
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
MAPK1 affects Leu163
| 2
COPS6 binds MAPK1 and Leu163. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
MAP7D1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
Leu163 affects MAPK1
| 2
COPS6 binds MAPK1 and Leu163. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
LPL affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
LAMA4 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
KLHL9 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL8 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL42 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL22 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL18 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL15 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHL13 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
KLHDC3 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
HMOX2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
HIV1gp4 affects COPS6
2 |
COPS6 binds HIV1gp4. 2 / 2
2 |

No evidence text available

No evidence text available
FBXW9 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
FBXW7 affects COPS6
| 1 1
| 1 1

sparser
"CSN6’s association with Fbxw7 facilitates its degradation."

reach
"First, we found that CSN6 associated with Myc, Fbxw7 and Cullin-1 in U2OS cells in vivo (XREF_FIG), suggesting that CSN6 interacts with SCF complex and may regulate it to stabilize Myc."
FBXO6 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
FBXO44 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
FBXO11 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
FBXL14 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
FAU affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
ERH affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
EP300 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
EMD affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
ELOB affects COPS6
2 |
2 |

No evidence text available

No evidence text available
EGFR affects COPS6
| 2
EGFR phosphorylates COPS6 on S148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
EDN1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
Delta(9)-tetrahydrocannabinol increases the amount of COPS6.
1 |
1 |

No evidence text available
Delta(9)-tetrahydrocannabinol decreases the amount of COPS6.
1 |
1 |

No evidence text available
DLEU1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
DIS3L2 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
DCAF16 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
CUL affects CSN2
| 2
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CSNAP affects COPS6
| 2
COPS6 binds CSNAP. 2 / 2
| 2

reach
"Our data also demonstrate that CSNAP binds to CSN3, CSN5, and CSN6, possibly linking the MPN and PCI substructures."

reach
"We show that CSNAP binds CSN3, CSN5, and CSN6, and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
CSN2 affects CUL
| 2
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CSN1S1 affects COPS6
| 1 1
| 1 1

sparser
"By forming a total of 35 subcomplexes, we are able to build a comprehensive interaction map that shows two symmetrical modules, Csn1/2/3/8 and Csn4/5/6/7, connected by interactions between Csn1-Csn6."

reach
"Interestingly, the complex is composed of two modules, Csn1/2/3/8 and Csn4/5/6/7, connected by interactions between Csn1 and Csn6."
CRELD1 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
CRBN affects COPS6
2 |
2 |

No evidence text available

No evidence text available
COX5A affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
COX17 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects v-myc avian myelocytomatosis viral oncogene homolog
| 2
COPS6 activates v-myc avian myelocytomatosis viral oncogene homolog. 2 / 2
| 2

reach
"A recent study determined that CSN6 promotes carcinogenesis by positively regulating v-myc avian myelocytomatosis viral oncogene homolog (Myc) stability."

reach
"CSN6 may promote carcinogenesis by positively regulating v-myc avian myelocytomatosis viral oncogene homolog (Myc) and MDM2 proto-oncogene stability, and is regarded as a potential target for cancer therapy."
COPS6 affects turnover OCT1
| 2
COPS6 inhibits turnover OCT1. 2 / 2
| 2

eidos
"Indeed , CSN6 knockdown led to decelerated turnover of TRIM21 but accelerated turnover of OCT1 ( Fig. 4c ) ."

eidos
"c In DLD-1 cells expressing scrambled or CSN6-specific shRNA , CSN6 knockdown reduced the turnover rate of the TRIM21 protein and increased the turnover rate of OCT1 ."
COPS6 affects steady-state TRIM21
| 2
COPS6 inhibits steady-state TRIM21. 2 / 2
| 2

eidos
"Tripartite motif ( TRIM ) protein family members ( numbering > 70 ) have been implicated in various cellular functions , including cell proliferation , differentiation , development , apoptosis , antiviral activity , autophagy and oncogenesis.44 TRIM21 plays a pivotal role in immune activation during pathogen infection , but its cellular function remains unclear.45 Interestingly , CSN6 is able to decrease the steady-state expression of TRIM21 by enhancing TRIM21 ubiquitination , thereby promoting cancer stemness ."

eidos
"In HCT116 cells , CSN6 reduced the steady-state level of TRIM21 , and MLN4924 treatment reversed this effect ( Fig. 3g ) ."
COPS6 affects pathway
| 2
COPS6 activates pathway. 2 / 2
| 2

sparser
"Furthermore, we found that UBR5 knockdown rescued all the effects induced by CSN6 silencing, indicating that CSN6 activates the CDK9 pathway to promote melanoma growth and metastasis by reducing the UBR5 level."

sparser
"Furthermore, in CSN6-knockdown melanoma cells, UBR5 knockdown abrogated the effects caused by CSN6 silencing, suggesting that CSN6 activates the UBR5/CDK9 pathway to promote melanoma cell proliferation and metastasis."

reach
"Bioinformatics analysis suggested that COPS6 was a mediator of IL-6 production in the tumor microenvironment and a negative regulator of CD8 + T cell tumor infiltration in breast cancer."

reach
"COPS6 promotes tumor progression and reduces CD8+ T cell infiltration by repressing IL-6 production to facilitate tumor immune evasion in breast cancer."
COPS6 affects cell migration breast cancer cells
| 2
COPS6 activates cell migration breast cancer cells. 2 / 2
| 2

eidos
"CSN6 promotes the cell migration of breast cancer cells by positively regulating Snail1 stability ."

eidos
"CSN6 promotes the cell migration of breast cancer cells by positively regulating Snail1 stability Background : CSN6 , a subunit of the highly conserved constitutive photomorphogenesis 9 ( COP9 ) signalosome ( CSN ) , has been reported to be implicated in tumor progression in various kinds of malignant tumors ."
COPS6 affects cell cycle
| 2
| 2

reach
"Through combinatorial effects on the MDM2-p53 signaling axis and now SKP2 mediated p57 Kip2 degradation, it is hypothesized that CSN6 overexpression can effectively promote cell proliferation by simultaneously relieving cell cycle restraints, apoptosis, senescence, and presumably p53 functions in DNA damage repair and cell metabolism, among other important tumor suppressive mechanisms."

reach
"As the cellular abundance of p27 is an indicator of cell cycle, we thus reviewed relative articles to find whether the cell cycle arrest effect caused by COPS5 or COPS6 inhibition was p27 dependent."

sparser
"For example, CSN6 can interact with amino-terminal caspase recruitment domain (CARD) of Nod1, a cytoplasmic protein that belongs to the Nod/NLR/CATERPILLER protein family and whose activation is involved in apoptotic pathways."

reach
"For example, CSN6 can interact with amino-terminal caspase recruitment domain (CARD) of Nod1, a cytoplasmic protein that belongs to the Nod/NLR/CATERPILLER protein family and whose activation is involved in apoptotic pathways."
COPS6 affects activity
| 2
COPS6 activates activity. 2 / 2
| 2

sparser
"Because is an upstream regulator of these two pathways, mutations will continue to activate both RAS-MAPK and AKT pathways to stabilize CSN6, which in turn activates β-catenin activity to cause path[MISSING/INVALID CREDENTIALS: limited to 200 char for Elsevier]"

sparser
"Because KRAS is an upstream regulator of these two pathways, KRAS mutations will continue to activate both RAS-MAPK and AKT pathways to stabilize CSN6, which in turn activates β-catenin activity to cause pathogenesis in colon cancer."
COPS6 affects ZNF24
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects ZEB2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects WIPI2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects UBE2M
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects TRIB3
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects TRDMT1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects TIMP2
| 2
COPS6 activates TIMP2. 2 / 2
| 2

reach
"Bioinformatics and Luciferase reporter genes demonstrated that CSN6 can target the corresponding sites of TIMP-2 promoter."

reach
"Additionally, we verified that CSN6 may promote OSCC malignant progression by regulating TIMP-2."
COPS6 affects TDGF1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects Snail1 stability
| 2
COPS6 activates Snail1 stability. 2 / 2
| 2

eidos
"The above results suggest that CSN6 promotes Snail1 stability via impeding ubiquitination of Snail1 ."

eidos
"Taken together , these results indicated that CSN6 promotes Snail1 stability through reducing ubiquitination ."
COPS6 affects Ser148
| 2
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 affects SULT1E1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects STX5
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects STK40
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects SNRPG
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects SKP1
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects SERPINB9
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects SERPINA5
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects SAT1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects S100A10
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects RPA2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects ROGDI
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects RFC5
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects RAE1
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects RAB27A
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects QTRT1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PTEN
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PSMD11
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PSAP
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PRKRA
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PMF1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PHYHIP
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PFKL
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PDZK1IP1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PAFAH1B3
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects PAEP
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects ORAI2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects NOD1
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects Melanoma
| 2
| 2

eidos
"CSN6 promotes melanoma proliferation and metastasis by controlling the UBR5-mediated ubiquitination and degradation of CDK9 As a critical subunit of the constitutive photomorphogenesis 9 ( COP9 ) signalosome ( CSN ) , CSN6 is upregulated in some human cancers and plays critical roles in tumorigenesis and progression , but its biological functions and molecular mechanisms in melanoma remain unknown ."

eidos
"CSN6 promotes melanoma proliferation and metastasis by controlling the UBR5-mediated ubiquitination and degradation of CDK9 ."
COPS6 affects MYCBP
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects MNAT1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects MAPK1, and Ser148
| 2
COPS6 binds MAPK1 and Ser148. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 affects MAP7D1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects Leu163, and MAPK1
| 2
COPS6 binds MAPK1 and Leu163. 2 / 2
| 2

reach
"Mechanistic studies revealed that CSN6 is deregulated by epidermal growth factor receptor (EGFR) signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."

reach
"Mechanistic studies revealed that CSN6 is deregulated by EGFR signaling, in which ERK2 binds directly to CSN6 Leu163 and Val165 and phosphorylates CSN6 at Ser148."
COPS6 affects LPL
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects LAMA4
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects KLHL9
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL8
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL42
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL22
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL18
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL15
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHL13
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects KLHDC3
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects JUN
| 2
COPS6 ubiquitinates JUN.
| 1
COPS6 leads to the ubiquitination of JUN. 1 / 1
| 1

reach
"In detail, in breast cancer, CSN6 decreases MEKK1 mediated c-Jun ubiquitination, promotes Skp2 mediated p57 Kip2 protein ubiquitination 9."
COPS6 activates JUN.
| 1
COPS6 activates JUN. 1 / 1
| 1

reach
"CSN6 positively regulates c-Jun in a MEKK1 dependent manner."
COPS6 affects HMOX2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects HIV1gp4
2 |
COPS6 binds HIV1gp4. 2 / 2
2 |

No evidence text available

No evidence text available
COPS6 affects FBXW9
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects FBXO6
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects FBXO44
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects FBXO11
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects FBXL14
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects FAU
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects ERH
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects EP300
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects EMD
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects ELOB
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects EDN1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects DLEU1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects DIS3L2
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects DCAF16
2 |
2 |

No evidence text available

No evidence text available
| 1

eidos
"CSN6 promotes GBM proliferation , migration , invasion , and tumorigenesis through upregulation of EGFR by blocking its ubiquitination ; this happens as a result of interactions with CHIP that cause its degradation , although CHIP auto-ubiquitination occurs through an unknown mechanism [ 91 ] ."
COPS6 affects CSNAP
| 2
COPS6 binds CSNAP. 2 / 2
| 2

reach
"Our data also demonstrate that CSNAP binds to CSN3, CSN5, and CSN6, possibly linking the MPN and PCI substructures."

reach
"We show that CSNAP binds CSN3, CSN5, and CSN6, and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues."
COPS6 affects CSN1S1
| 1 1
| 1 1

sparser
"By forming a total of 35 subcomplexes, we are able to build a comprehensive interaction map that shows two symmetrical modules, Csn1/2/3/8 and Csn4/5/6/7, connected by interactions between Csn1-Csn6."

reach
"Interestingly, the complex is composed of two modules, Csn1/2/3/8 and Csn4/5/6/7, connected by interactions between Csn1 and Csn6."
COPS6 affects CRELD1
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects CRC PDOs
| 1 1
COPS6 activates CRC PDOs. 2 / 2
| 1 1

eidos
"Knockdown of CSN6 reduced the number and the size of CRC PDOs formed ( Fig. 1g ) ."

reach
"We found that decreasing CSN6 expression via knockdown reduced the number and growth of CRC PDOs, supporting the role of CSN6 in regulating stemness during tumorigenicity."
COPS6 affects CRBN
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects COX5A
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects COX17
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects CKS1B
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects CDKN2C
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects CDH10
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects CCDC106
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects C4orf17
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects C1orf174
1 1 |
1 1 |

No evidence text available

No evidence text available
COPS6 affects BTRC
1 | 1
COPS6 inhibits BTRC.
| 1
COPS6 inhibits BTRC. 1 / 1
| 1

eidos
"This indicated that up-regulation of CSN6 by PDGFR / PI3K / Akt signaling promotes beta-TrCP degradation , which , in turn , stabilizes the cell cycle protein Cdc25A and results in PASMC proliferation ."
COPS6 binds BTRC.
1 |
1 |

No evidence text available
COPS6 affects BTBD9
2 |
2 |

No evidence text available

No evidence text available
COPS6 affects A375
| 2
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."
COPS6 affects 14-3-3sigma
| 2
COPS6 inhibits 14-3-3sigma. 2 / 2
| 2

reach
"This result suggests that downregulation of 14-3-3sigma by CSN6 is not dependent on p53 expression."

reach
"Since CSN6 downregulates and thus antagonizes the activity of 14-3-3sigma, we reasoned that CSN6 would have a role in cell proliferation and anchorage independent growth."
| 2

reach
"The ability of hVIP and analogues to stimulate cAMP generation paralleled their potencies in displacing 125I-VIP binding."

reach
"(D-Phe2) VIP, VIP [10-28], VIP [16-28], and (p-Cl-D-Phe6, Leu17) VIP, a putative VIP receptor antagonist, affected neither basal cAMP levels nor hVIP induced cAMP accumulation."
COPS5 affects COPS6, and GNPTAB
| 2
| 2

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N terminal) () subunits, CSN5 and CSN6."

sparser
"Sitting atop this platform is the heterodimer formed by the MPN (Mpr1p and Pad1p N-terminal) ( xref ; xref ; xref ) subunits, CSN5 and CSN6."
COPS2 affects COPS3, COPS4, COPS5, COPS6, COPS7A, COPS8, and GPS1
2 |

No evidence text available

No evidence text available
CKS1B affects COPS6
2 |
2 |

No evidence text available

No evidence text available
CDKN2C affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
CDH10 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
CCDC106 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
C4orf17 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
C1orf174 affects COPS6
1 1 |
1 1 |

No evidence text available

No evidence text available
BTBD9 affects COPS6
2 |
2 |

No evidence text available

No evidence text available
AKT1 affects COPS6
1 1 |
AKT1 phosphorylates COPS6 on S60. 2 / 2
1 1 |

No evidence text available

"Mechanistic studies show that akt causes csn6 phosphorylation at ser 60, which, in turn, reduces ubiquitin-mediated protein degradation of csn6."
A375 affects COPS6
| 2
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."
17alpha-ethynylestradiol increases the amount of COPS6. 2 / 2
2 |

No evidence text available

No evidence text available
1 |
Valproic acid increases the amount of COPS6. 1 / 1
1 |

No evidence text available
Tert-butyl hydroperoxide decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
Methylmercury chloride decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
Is overexpressed cancers affects COPS6
| 1
Is overexpressed cancers activates COPS6. 1 / 1
| 1

eidos
"Previous studies have identified that CSN6 was implicated in tumor progression , because it is overexpressed in multiple common types of cancers , such as cervical cancer , thyroid cancer , colorectal cancer , breast cancer , lung cancer , hepatocellular carcinoma and glioblastoma 15-19 ."
HsdR affects COPS6
| 1
| 1

reach
"In vitro experiments revealed that hPACAP and hVIP also bind to hSR and activate downstream signaling, but only at high concentrations."
1 |
Hsa-miR-328-3p decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
1 |
Hsa-let-7i-5p decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
1 |
Hsa-let-7c-5p decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
Flutamide affects COPS6
1 |
Flutamide increases the amount of COPS6. 1 / 1
1 |

No evidence text available
Dichloroacetic acid increases the amount of COPS6. 1 / 1
1 |

No evidence text available
Diarsenic trioxide increases the amount of COPS6. 1 / 1
1 |

No evidence text available
Csn affects RBX1
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
Copper(II) sulfate decreases the amount of COPS6. 1 / 1
1 |

No evidence text available
Clofibrate affects COPS6
1 |
Clofibrate increases the amount of COPS6. 1 / 1
1 |

No evidence text available
Bisphenol A affects COPS6
1 |
Bisphenol A increases the amount of COPS6. 1 / 1
1 |

No evidence text available
1 |
Benzo[a]pyrene increases the amount of COPS6. 1 / 1
1 |

No evidence text available
ZYG11B affects COPS6
1 |
1 |

No evidence text available
ZMAT2 affects COPS6
1 |
1 |

No evidence text available
VIM affects COPS6
1 |
1 |

No evidence text available
USP25 affects COPS6
| 1
| 1

sparser
"We speculate that BTBD9 through its interactions with USP21 and CSN6 plays a role in the turnover of dynamin 1."
UBR5 affects A375
| 1
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
TXN affects COPS6
1 |
1 |

No evidence text available
TUBB affects COPS6
1 |
1 |

No evidence text available
TP63 affects COPS6
1 |
1 |

No evidence text available
SYNCRIP affects COPS6
1 |
1 |

No evidence text available
SNRNP70 affects COPS6
1 |
1 |

No evidence text available
SMC3 affects COPS6
1 |
1 |

No evidence text available
SLC25A5 affects COPS6
1 |
1 |

No evidence text available
SKP2 affects E3_Ub_ligase
| 1

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
SIRT2 affects COPS6
| 1
SIRT2 inhibits COPS6. 1 / 1
| 1

reach
"29 The latest research showed that constitutive photomorphogenic 9 signalosome complex subunit 6 (CSN6) and plant homeodomain finger protein 19 (PHF19) exacerbate the pathological myocardial hypertrophy induced by Ang II by inhibiting the expression of SIRT2, and the overexpression of SIRT2 can reduce the effect of CSN6 in promoting myocardial hypertrophy."
SDHA affects COPS6
1 |
1 |

No evidence text available
SCG2 affects COPS6
1 |
1 |

No evidence text available
RPS4X affects COPS6
1 |
1 |

No evidence text available
RPS20 affects COPS6
1 |
1 |

No evidence text available
RPS2 affects COPS6
1 |
1 |

No evidence text available
RPS15A affects COPS6
1 |
1 |

No evidence text available
RPS14 affects COPS6
1 |
1 |

No evidence text available
RPLP2 affects COPS6
1 |
1 |

No evidence text available
RPLP1 affects COPS6
1 |
1 |

No evidence text available
RPL7P32 affects COPS6
1 |
1 |

No evidence text available
RPL7AP9 affects COPS6
1 |
1 |

No evidence text available
RPL6 affects COPS6
1 |
1 |

No evidence text available
RPL29P30 affects COPS6
1 |

No evidence text available
RPL23 affects COPS6
1 |
1 |

No evidence text available
RPL18 affects COPS6
1 |
1 |

No evidence text available
RPL11 affects COPS6
1 |
1 |

No evidence text available
RING-box protein 1 affects CUL
| 1
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
RIBC2 affects COPS6
1 |
1 |

No evidence text available
RBX1 affects csn
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
RBM14 affects COPS6
1 |
1 |

No evidence text available
RAB40A affects COPS6
1 |
1 |

No evidence text available
PWP1 affects COPS6
1 |
1 |

No evidence text available
PSMD14 affects COPS6
1 |
1 |

No evidence text available
PRSS27 affects GNPTAB
| 1
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
PRIM1 affects COPS6
1 |
1 |

No evidence text available
PRDX1 affects COPS6
1 |
1 |

No evidence text available
POP7 affects COPS6
1 |
1 |

No evidence text available
PDGFR affects COPS6
| 1
PDGFR activates COPS6. 1 / 1
| 1

eidos
"This indicated that up-regulation of CSN6 by PDGFR / PI3K / Akt signaling promotes beta-TrCP degradation , which , in turn , stabilizes the cell cycle protein Cdc25A and results in PASMC proliferation ."
PDCD2L affects COPS6
1 |
1 |

No evidence text available
PBX2 affects COPS6
1 |
1 |

No evidence text available
PABPC1 affects COPS6
1 |
1 |

No evidence text available

reach
"Further, CSN6‐mediated FOXO4 down regulation was rescued by the proteasome inhibitor MG132 (Figure 2D, Figure S5D, Supporting Information)."
MDM2-p53 affects COPS6
| 1
MDM2-p53 activates COPS6. 1 / 1
| 1

reach
"Hence, this study has further strengthened the significance of the MDM2-p53 pathway on tumorigenesis through a novel link of Akt mediated CSN6 activation."
MBTD1 affects COPS6
1 |
1 |

No evidence text available
M affects COPS6
1 |
COPS6 binds M. 1 / 1
1 |

No evidence text available
LYZ affects COPS6
1 |
1 |

No evidence text available
LRRC47 affects COPS6
1 |
1 |

No evidence text available
LARP4 affects COPS6
1 |
1 |

No evidence text available
KSR2 affects COPS6
1 |
1 |

No evidence text available
KRT75 affects COPS6
1 |
1 |

No evidence text available
KRT24 affects COPS6
1 |
1 |

No evidence text available
KRT1 affects COPS6
1 |
1 |

No evidence text available
KRAS affects COPS6
| 1
Mutated KRAS activates COPS6. 1 / 1
| 1

reach
"Because KRAS is an upstream regulator of these two pathways, KRAS mutations will continue to activate both RAS-MAPK and AKT pathways to stabilize CSN6, which in turn activates beta-catenin activity to cause pathogenesis in colon cancer."
KIR2DS1 affects COPS6
1 |
1 |

No evidence text available
KCTD18 affects COPS6
1 |
1 |

No evidence text available
KCTD10 affects COPS6
1 |
1 |

No evidence text available
IRF8 affects COPS6
1 |
1 |

No evidence text available
IMPDH2 affects COPS6
1 |
1 |

No evidence text available
IGHV3OR15-7 affects COPS6
1 |

No evidence text available
HSPA9 affects COPS6
1 |
1 |

No evidence text available
HSPA7 affects COPS6
1 |
1 |

No evidence text available
HSPA5 affects COPS6
1 |
1 |

No evidence text available
HSP90B1 affects COPS6
1 |
1 |

No evidence text available
HSP90AA2P affects COPS6
1 |

No evidence text available
HNRNPUL1 affects COPS6
1 |

No evidence text available
HNRNPH3 affects COPS6
1 |
1 |

No evidence text available
HNRNPH1 affects COPS6
1 |
1 |

No evidence text available
HNRNPA2B1 affects COPS6
1 |

No evidence text available
GNPTAB affects PRSS27
| 1
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
GAPDH affects COPS6
1 |
1 |

No evidence text available
FUS affects COPS6
1 |
1 |

No evidence text available
FOXO4 affects CARD16
| 1
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
FOXI1 affects COPS6
1 |
1 |

No evidence text available
FBXO42 affects COPS6
1 |
1 |

No evidence text available
FBXO22 affects COPS6
1 |
1 |

No evidence text available
FBXO21 affects COPS6
1 |
1 |

No evidence text available
FBXL5 affects COPS6
1 |
1 |

No evidence text available
ERCC6 affects COPS6
1 |
1 |

No evidence text available
EPB41L4A-DT affects COPS6
1 |

No evidence text available
EGFR-ERK affects COPS6
| 1
EGFR-ERK activates COPS6. 1 / 1
| 1

reach
"Thus, these results suggest that the EGFR-ERK pathway may upregulate CSN6, which may inhibit PD-L1 degradation and subsequently maintain PD-L1 stability in GBM."
EGF-ERK2 Axis affects COPS6
| 1
EGF-ERK2 Axis phosphorylates COPS6 on S148. 1 / 1
| 1

reach
"The EGF-ERK2 Axis Phosphorylates CSN6 on S148 and Enhances CSN6 Stabilization."
E3_Ub_ligase affects SKP2
| 1

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
DET1 affects COPS6
1 |
1 |

No evidence text available
DENR affects COPS6
1 |
1 |

No evidence text available
DDX5 affects COPS6
1 |
1 |

No evidence text available
DCUN1D1 affects COPS6
1 |
1 |

No evidence text available
DCAF7 affects COPS6
1 |
1 |

No evidence text available
DCAF4L1 affects COPS6
1 |
1 |

No evidence text available
DCAF17 affects COPS6
1 |
1 |

No evidence text available
DCAF12L2 affects COPS6
1 |

No evidence text available
DCAF10 affects COPS6
1 |
1 |

No evidence text available
CUL affects csn
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CUL affects RING-box protein 1
| 1
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CUL affects RBX1
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
| 1

sparser
"The core of the subcomplex is based on a stable heterotrimeric association of CSN7, CSN4, and CSN6, requiring coexpression in a bacterial reconstitution system."
CSN2 affects csn
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CSN2 affects RING-box protein 1
| 1
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
CSN2 affects RBX1
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
CORO1A affects SKP2
| 1

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 affects ubiquitination degradation cancer associated proteins
| 1
COPS6 activates ubiquitination degradation cancer associated proteins. 1 / 1
| 1

eidos
"Furthermore , CSN6 can also coordinate with E3 ligase to mediate ubiquitination and degradation of cancer associated proteins 14 ."
COPS6 affects ubiquitination OCT1
| 1
COPS6 inhibits ubiquitination OCT1. 1 / 1
| 1

eidos
"Consistent with this finding , we found that knockdown of CSN6 increased the ubiquitination level of OCT1 ( Fig. 5d ) ."
COPS6 affects ubiquitin proteasome
| 1
COPS6 inhibits ubiquitin proteasome. 1 / 1
| 1

reach
"Mechanistically, CSN6 blocked the ubiquitin proteasome system mediated degradation of Nkx2.2 protein by interacting with it and inhibiting its ubiquitination directly in cardiomyocytes."
COPS6 affects ubiquitin proteasome system-mediated Nkx2.2 protein
| 1
COPS6 inhibits ubiquitin proteasome system-mediated Nkx2.2 protein. 1 / 1
| 1

eidos
"Mechanistically , CSN6 blocked the ubiquitin proteasome system-mediated degradation of Nkx2.2 protein by interacting with it and inhibiting its ubiquitination directly in cardiomyocytes ."
COPS6 affects turnover TRIM21 protein
| 1
COPS6 activates turnover TRIM21 protein. 1 / 1
| 1

eidos
"c In DLD-1 cells expressing scrambled or CSN6-specific shRNA , CSN6 knockdown reduced the turnover rate of the TRIM21 protein and increased the turnover rate of OCT1 ."
COPS6 affects tumour-formation diluted
| 1
COPS6 activates tumour-formation diluted. 1 / 1
| 1

eidos
"Knockdown of CSN6 led to reduction of tumour-formation frequency in vivo at low diluted level ( Fig. 6a , b ) ."
COPS6 affects tumour growth
| 1
COPS6 activates tumour growth. 1 / 1
| 1

eidos
"We also found that knockdown of CSN6 reduced tumour growth ( Fig. 6c ) ."
COPS6 affects tumorigenicity
| 1
COPS6 activates tumorigenicity. 1 / 1
| 1

eidos
"In melanoma cells , CSN6 knockdown remarkably inhibited cell proliferation , tumorigenicity , migration , and invasion , whereas CSN6 recovery rescued the proliferative and metastatic abilities ."
COPS6 affects tumorigenicity Figure S17A-D
| 1
COPS6 activates tumorigenicity Figure S17A-D. 1 / 1
| 1

eidos
"CSN6 knockdown hindered cell growth , soft agar colony formation , and tumorigenicity ( Figure S17A-D , Supporting Information ) compared with control cells ."
COPS6 affects tumor growth
| 1
COPS6 activates tumor growth. 1 / 1
| 1

eidos
"To demonstrate the impact of CSN6-COP1 axis in regulating FOXO4 and subsequent gene expression of SGOC genes in vivo , we performed mouse xenograft cancer studies and demonstrated that CSN6 knockdown suppressed tumor growth ( Figure S17C , Supporting Information ) ."
COPS6 affects stemness marker aldehyde dehydrogenase A1
| 1
COPS6 activates stemness marker aldehyde dehydrogenase A1. 1 / 1
| 1

eidos
"Multiple lines of evidence indicate that CSN6 promotes the gene expression of stemness marker aldehyde dehydrogenase 1 A1 ( ALDH1A1 ) , indicating that CSN6 expression initiates cancer stemness in CRC ."
COPS6 affects steady-state protein OCT1 ALDH1A1
| 1
COPS6 activates steady-state protein OCT1 ALDH1A1. 1 / 1
| 1

eidos
"We found that the expression of CSN6 increased the steady-state protein expression levels of OCT1 and ALDH1A1 , with a concurrent reduction in TRIM21 expression in a dose-dependent manner ( Fig. 2j ) ."
COPS6 affects steady-state FOXO4
| 1
COPS6 inhibits steady-state FOXO4. 1 / 1
| 1

eidos
"We then found that CSN6 decreased the steady-state expression of FOXO4 in a dose-dependent manner in several CRC cell lines ( Figure 1E , Figure S2A , Supporting Information ) ."
COPS6 affects spheres enriched
| 1
COPS6 activates spheres enriched. 1 / 1
| 1

eidos
"CSN6 has the capability to promote the formation of spheres enriched in CSCs , suggesting that CSN6 overexpression may promote distant metastasis and confer resistance after chemotherapy ."
COPS6 affects sphere-initiation
| 1
COPS6 activates sphere-initiation. 1 / 1
| 1

eidos
"Consistent with this finding , CSN6 knockdown decreased the sphere-initiation frequency , as determined by in vitro limited dilution assays ( LDAs ; Fig. 1b ) ."
COPS6 affects sphere-formation
| 1
COPS6 activates sphere-formation. 1 / 1
| 1

eidos
"In terms of stemness regulation , CSN6 knockdown reduced the sphere-formation ability ( Fig. 5g ) , while overexpression of OCT1 in the presence of CSN6 knockdown rescued the sphere-formation ability ( Fig. 5g ) ."
COPS6 affects sphere
| 1
COPS6 activates sphere. 1 / 1
| 1

eidos
"In this study , we found that loss of CSN6 results in a significant decrease in sphere formation and PDO proliferation ."
COPS6 affects soft agar colony
| 1
COPS6 activates soft agar colony. 1 / 1
| 1

eidos
"CSN6 knockdown hindered cell growth , soft agar colony formation , and tumorigenicity ( Figure S17A-D , Supporting Information ) compared with control cells ."

reach
"In another study, quercetin inhibited the viability of HT29 cells, caused cell shrinkage, chromatin condensation, and nuclear collapse, lessened the protein expression levels of phosphorylated-Akt, and augmented the protein degradation of constitutive photomorphogenesis 6 signalosome (CSN6) (Yang et al., 2016)."
COPS6 affects nucleotide
| 1
| 1

eidos
"Isotope metabolite tracing showed that CSN6 loss reduced de novo nucleotide synthesis ."
COPS6 affects migration breast cells
| 1
COPS6 activates migration breast cells. 1 / 1
| 1

eidos
"Overall , the results indicated that CSN6 promoted the migration in breast cells in vitro ."
COPS6 affects metastasis potential breast cancer cells
| 1
COPS6 activates metastasis potential breast cancer cells. 1 / 1
| 1

eidos
"In summary , we draw noteworthy conclusions that CSN6 had a positive impact on Snail1 stability , and then contributing to the enhanced metastasis potential of breast cancer cells ."

reach
"COP9 signalosome subunit 6 (CSN6), an oncogenic marker of CRC, increases lipogenesis via interacting with and stabilizing FASN."
COPS6 affects lactate fructose-1
| 1
COPS6 activates lactate fructose-1. 1 / 1
| 1

eidos
"Another metabolomic analysis by mass spectrometry demonstrated that CSN6 knockdown leads to reduction of lactate and fructose-1 ,6 - bisphosphate , and the significance of the changes in metabolite levels was documented ( Figure 5B , Figures S13 and S14 , Supporting Information ) ."
COPS6 affects hsdR
| 1
| 1

reach
"In vitro experiments revealed that hPACAP and hVIP also bind to hSR and activate downstream signaling, but only at high concentrations."
COPS6 affects growth migration invasion melanoma cells
| 1
COPS6 activates growth migration invasion melanoma cells. 1 / 1
| 1

eidos
"In this study , we show that CSN6 promotes the growth , migration and invasion of melanoma cells via CDK9-mediated signaling pathways ."
COPS6 affects glycine
| 1
COPS6 activates glycine. 1 / 1
| 1

eidos
"Metabolomic studies demonstrate that CSN6 expression leads to serine and glycine production ."
COPS6 affects establishing CSN6-TRIM21-OCT1-ALDH1A1 stemness-promoting axis
| 1
COPS6 inhibits establishing CSN6-TRIM21-OCT1-ALDH1A1 stemness-promoting axis. 1 / 1
| 1

eidos
"OCT1 is known to regulate normal cell and CSC function.33 Loss of OCT1 in the colon was associated with restricted tumorigenicity.43 High OCT1 protein levels are correlated with the frequency of CD24 ( low ) / CD44 ( high ) cancer-initiating cells in primary malignant tissue.33 OCT1 is a transcription factor for ALDHs.27 Importantly , we show that CSN6 can reduce TRIM21-mediated OCT1 ubiquitination to regulate ALDH1A1 mRNA expression , thereby establishing the CSN6-TRIM21-OCT1-ALDH1A1 stemness-promoting axis ."
COPS6 affects decelerated turnover TRIM21
| 1
COPS6 inhibits decelerated turnover TRIM21. 1 / 1
| 1

eidos
"Indeed , CSN6 knockdown led to decelerated turnover of TRIM21 but accelerated turnover of OCT1 ( Fig. 4c ) ."
| 1

reach
"Then, we explored how CSN6 affects the stability of CDK9 and found that overexpression of CSN6 decreased the turnover rate of CDK9 in melanoma cells by using the de novo protein synthesis inhibitor cycloheximide (CHX, Sigma, USA)."
COPS6 affects cullin E3 ligases
| 1
COPS6 inhibits cullin E3 ligases. 1 / 1
| 1

eidos
"CSN6 inhibits activity of cullin E3 ligases by removing Nedd8 modifications to prevent desmosomal degradation / dissolution ."
COPS6 affects csn
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 affects criminal justice recidivism
| 1
COPS6 inhibits criminal justice recidivism. 1 / 1
| 1

eidos
"HVIPs have been reported to reduce both trauma and criminal justice recidivism ( Cooper et al ., 2006 ; Shibru et al ., 2007 ) ; however , there is limited and mixed evidence to support their effectiveness ( Affinati et al ., 2016 ; Chong et al ., 2015 ; Cooper et al ., 2006 ; Dicker , 2016 ; Juillard et al ., 2016 ; Purtle et al ., 2013 ; Smith et al ., 2013 ) ."

reach
"Through combinatorial effects on the MDM2-p53 signaling axis and now SKP2 mediated p57 Kip2 degradation, it is hypothesized that CSN6 overexpression can effectively promote cell proliferation by simultaneously relieving cell cycle restraints, apoptosis, senescence, and presumably p53 functions in DNA damage repair and cell metabolism, among other important tumor suppressive mechanisms."
COPS6 affects capacity BT549 MDA-MB-231 cell motility
| 1
COPS6 activates capacity BT549 MDA-MB-231 cell motility. 1 / 1
| 1

eidos
"Wound healing assays showed that knockdown of CSN6 decreased the capacity for BT549 and MDA-MB-231 cell motility ( Figure 2D ) ."
COPS6 affects cancer stemness
| 1
COPS6 activates cancer stemness. 1 / 1
| 1

eidos
"Our previous observation that CSN6 overexpression reduces the recurrence-free survival of CRC patients23 is probably , at least in part , due to the promotion of cancer stemness by CSN6 ."
COPS6 affects breast cancer cells
| 1
COPS6 activates breast cancer cells. 1 / 1
| 1

eidos
"Furthermore , we identified that CSN6 enhancement leads to Snail1 stabilization and promotes metastasis of breast cancer cells through inhibiting Snail1 ubiquitination ."
COPS6 affects breast cancer cells migration is acknowledged
| 1
COPS6 activates breast cancer cells migration is acknowledged. 1 / 1
| 1

eidos
"CSN6 promotes breast cancer cells migration in vitro It is acknowledged that malignant cells are characterized by possessing the capabilities of adhesion and migration ."

reach
"Mechanistically, CSN6 upregulated purine and pyrimidine biosynthesis by increasing expression of PHGDH, a key enzyme in the serine synthesis pathway."
COPS6 affects ZYG11B
1 |
1 |

No evidence text available
COPS6 affects ZO-1 gene
| 1
COPS6 increases the amount of ZO-1 gene. 1 / 1
| 1

reach
"CSN6 downregulation in K1 and TPC-1 cells significantly increased ZO-1 gene expression and decreased that of the vimentin gene."
COPS6 affects ZMAT2
1 |
1 |

No evidence text available
COPS6 affects Wnt
| 1
COPS6 activates Wnt. 1 / 1
| 1

reach
"Downregulation of CSN6 attenuates papillary thyroid carcinoma progression by reducing Wnt and beta-catenin signaling and sensitizes cancer cells to FH535 therapy."
COPS6 affects VIM
1 |
1 |

No evidence text available
| 1

eidos
"Consistent with this finding , knockdown of CSN6 reduces the ubiquitination level of TRIM21 and decelerated turnover of TRIM21 ( Fig. 4b , c ) ."
COPS6 affects USP25
| 1
| 1

sparser
"We speculate that BTBD9 through its interactions with USP21 and CSN6 plays a role in the turnover of dynamin 1."
COPS6 affects Trp-Gly
| 1
COPS6 activates Trp-Gly. 1 / 1
| 1

reach
"Of note, CSN6 overexpression suppressed the Wg signaling defects caused by Axin overexpression (XREF_SUPPLEMENTARY B), but did not suppress Wg signaling defects caused by Lgs 17E overexpression (XREF_SUPPLEMENTARY E)."
COPS6 affects TXN
1 |
1 |

No evidence text available
COPS6 affects TUBB
1 |
1 |

No evidence text available
COPS6 affects TSC2
| 1
COPS6 inhibits TSC2. 1 / 1
| 1

reach
"For example, CSN6 may enhance E6-E6AP-mediated degradation of tumor suppressor protein TSC2 [XREF_BIBR], thereby regulating the activation of mTORC1 and cap dependent translation [XREF_BIBR] critical for viral life cycle in epithelial tissue types and promoting neoplastic progression."
COPS6 affects TP63
1 |
1 |

No evidence text available
COPS6 affects TCHP
| 1
COPS6 inhibits TCHP. 1 / 1
| 1

reach
"For example, CSN6 may enhance E6-E6AP-mediated degradation of tumor suppressor protein TSC2 [XREF_BIBR], thereby regulating the activation of mTORC1 and cap dependent translation [XREF_BIBR] critical for viral life cycle in epithelial tissue types and promoting neoplastic progression."
COPS6 affects Snail1 ubiquitination
| 1
COPS6 inhibits Snail1 ubiquitination. 1 / 1
| 1

eidos
"CSN6 probably functions to inhibit Snail1 ubiquitination and then switches the E3 ligase target from Snail1 itself to other proteins ."
COPS6 affects SYNCRIP
1 |
1 |

No evidence text available
COPS6 affects SNRNP70
1 |
1 |

No evidence text available
COPS6 affects SMC3
1 |
1 |

No evidence text available
COPS6 affects SLC25A5
1 |
1 |

No evidence text available
COPS6 affects SDHA
1 |
1 |

No evidence text available
COPS6 affects SCG2
1 |
1 |

No evidence text available
COPS6 affects RPS4X
1 |
1 |

No evidence text available
COPS6 affects RPS20
1 |
1 |

No evidence text available
COPS6 affects RPS2
1 |
1 |

No evidence text available
COPS6 affects RPS15A
1 |
1 |

No evidence text available
COPS6 affects RPS14
1 |
1 |

No evidence text available
COPS6 affects RPLP2
1 |
1 |

No evidence text available
COPS6 affects RPLP1
1 |
1 |

No evidence text available
COPS6 affects RPL7P32
1 |
1 |

No evidence text available
COPS6 affects RPL7AP9
1 |
1 |

No evidence text available
COPS6 affects RPL6
1 |
1 |

No evidence text available
COPS6 affects RPL29P30
1 |

No evidence text available
COPS6 affects RPL23
1 |
1 |

No evidence text available
COPS6 affects RPL18
1 |
1 |

No evidence text available
COPS6 affects RPL11
1 |
1 |

No evidence text available
COPS6 affects RING-box protein 1
| 1
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
COPS6 affects RIBC2
1 |
1 |

No evidence text available
COPS6 affects RBM14
1 |
1 |

No evidence text available
COPS6 affects RAB40A
1 |
1 |

No evidence text available
COPS6 affects PWP1
1 |
1 |

No evidence text available
COPS6 affects PSMD9
| 1
COPS6 activates PSMD9. 1 / 1
| 1

reach
"RFWD2 serves as a negative regulator of P27 (Ko et al., 2019), leading to CSN6-mediated P27 degradation in HCT116 and HEK-293T cells (Choi et al., 2015a)."
COPS6 affects PSMD14
1 |
1 |

No evidence text available
COPS6 affects PRIM1
1 |
1 |

No evidence text available
COPS6 affects PRDX1
1 |
1 |

No evidence text available
COPS6 affects POP7
1 |
1 |

No evidence text available
COPS6 affects PDCD2L
1 |
1 |

No evidence text available
COPS6 affects PBX2
1 |
1 |

No evidence text available
COPS6 affects PABPC1
1 |
1 |

No evidence text available
COPS6 affects MBTD1
1 |
1 |

No evidence text available
COPS6 affects M
1 |
COPS6 binds M. 1 / 1
1 |

No evidence text available
COPS6 affects Lipogenesis
| 1
| 1

eidos
"COP9 signalosome subunit 6 ( CSN6 ) , an oncogenic marker of CRC , increases lipogenesis via interacting with and stabilizing FASN ."
COPS6 affects LYZ
1 |
1 |

No evidence text available
COPS6 affects LRRC47
1 |
1 |

No evidence text available
COPS6 affects LARP4
1 |
1 |

No evidence text available
COPS6 affects KSR2
1 |
1 |

No evidence text available
COPS6 affects KRT75
1 |
1 |

No evidence text available
COPS6 affects KRT24
1 |
1 |

No evidence text available
COPS6 affects KRT1
1 |
1 |

No evidence text available
COPS6 affects KIR2DS1
1 |
1 |

No evidence text available
COPS6 affects KCTD18
1 |
1 |

No evidence text available
COPS6 affects KCTD10
1 |
1 |

No evidence text available
COPS6 affects IRF8
1 |
1 |

No evidence text available
COPS6 affects IMPDH2
1 |
1 |

No evidence text available
COPS6 affects IGHV3OR15-7
1 |

No evidence text available
COPS6 affects IDEF1
| 1
COPS6 inhibits IDEF1. 1 / 1
| 1

reach
"Collectively, the cellular CSN6 level is decreased during early stages of -Fe to ensure the rapid accumulation of IDEF1, which in turn up-regulates several iron uptake and utilisation related genes to help overcome -Fe stress in rice."
COPS6 affects HSPA9
1 |
1 |

No evidence text available
COPS6 affects HSPA7
1 |
1 |

No evidence text available
COPS6 affects HSPA5
1 |
1 |

No evidence text available
COPS6 affects HSP90B1
1 |
1 |

No evidence text available
COPS6 affects HSP90AA2P
1 |

No evidence text available
COPS6 affects HNRNPUL1
1 |

No evidence text available
COPS6 affects HNRNPH3
1 |
1 |

No evidence text available
COPS6 affects HNRNPH1
1 |
1 |

No evidence text available
COPS6 affects HNRNPA2B1
1 |

No evidence text available
COPS6 affects GAPDH
1 |
1 |

No evidence text available
COPS6 affects FUS
1 |
1 |

No evidence text available
COPS6 affects FOXO4 ubiquitination
| 1
COPS6 activates FOXO4 ubiquitination. 1 / 1
| 1

eidos
"CSN6 increases FOXO4 turnover rate and enhances FOXO4 ubiquitination ."
COPS6 affects FOXO4 protein
| 1
COPS6 inhibits FOXO4 protein. 1 / 1
| 1

eidos
"A qRT-PCR assay indicated that CSN6 regulated FOXO4 post-transcriptionally as CSN6 expression led to FOXO4 protein reduction but had no impacts on mRNA expression of FOXO4 ( Figure S5A , B , Supporting Information ) ."
COPS6 affects FOXI1
1 |
1 |

No evidence text available
COPS6 affects FBXO42
1 |
1 |

No evidence text available
COPS6 affects FBXO22
1 |
1 |

No evidence text available
COPS6 affects FBXO21
1 |
1 |

No evidence text available
COPS6 affects FBXL5
1 |
1 |

No evidence text available
COPS6 affects FAM126A
| 1
COPS6 activates FAM126A. 1 / 1
| 1

reach
"In HCC, CSN6 overexpression promotes epithelial-mesenchymal transition and predicts poor prognosis (26)."
COPS6 affects ERCC6
1 |
1 |

No evidence text available
COPS6 affects EPB41L4A-DT
1 |

No evidence text available
COPS6 affects EGFR-interacting E3 ligase CHIP
| 1
COPS6 inhibits EGFR-interacting E3 ligase CHIP. 1 / 1
| 1

eidos
"CSN6 may also destabilize EGFR-interacting E3 ligase CHIP by promoting its autoubiquitination ( 278 ) ."
COPS6 affects E6
| 1
COPS6 leads to the deubiquitination of E6. 1 / 1
| 1

reach
"Meanwhile, CSN6 could bind to the E6 oncoprotein of human papillomavirus (HPV) and inhibit the polyubiquitination of E6 to reduce its degradation, thereby regulating the activity of p53 in cell proliferation and apoptosis to affect the development of cervical cancer XREF_BIBR."
COPS6 affects DET1
1 |
1 |

No evidence text available
COPS6 affects DENR
1 |
1 |

No evidence text available
COPS6 affects DDX5
1 |
1 |

No evidence text available
COPS6 affects DCUN1D1
1 |
1 |

No evidence text available
COPS6 affects DCAF7
1 |
1 |

No evidence text available
COPS6 affects DCAF4L1
1 |
1 |

No evidence text available
COPS6 affects DCAF17
1 |
1 |

No evidence text available
COPS6 affects DCAF12L2
1 |

No evidence text available
COPS6 affects DCAF10
1 |
1 |

No evidence text available
| 1

sparser
"The core of the subcomplex is based on a stable heterotrimeric association of CSN7, CSN4, and CSN6, requiring coexpression in a bacterial reconstitution system."
COPS6 affects CSN6-CSN5 hetreodimer
| 1
COPS6 inhibits CSN6-CSN5 hetreodimer. 1 / 1
| 1

reach
"In competition experiment, more CSN6 may leads to reduced CSN6-CSN5 hetreodimer, thereby affecting Culllin deneddylation 55."
COPS6 affects CSN2, CUL, and RING-box protein 1
| 1
CUL binds COPS6, CSN2, and RING-box protein 1. 1 / 1
| 1

sparser
"The CSN becomes assembled in supercomplexes with CRLs in which CSN2 interacts with cullins and CSN6 with Rbx1 [16,17] ."
COPS6 affects CSN2, CUL, RBX1, and csn
| 1
CUL binds COPS6, RBX1, csn, and CSN2. 1 / 1
| 1

sparser
"CSN physically interacts with the cullin and RBX1 subunits of CRLs through its subunits CSN2 and CSN6 and it is thought that these interactions provide CSN with the affinity for its CRL targets ( xref )."
COPS6 affects CORO1A, E3_Ub_ligase, and SKP2
| 1

sparser
"Mechanistic studies show that CSN6 associates with p57 (Kip2) and Skp2, a component of the E3 ligase, which, in turn, facilitates Skp2-mediated protein ubiquitination of p57 (Kip2) ."
COPS6 affects COA1
1 |
1 |

No evidence text available
COPS6 affects CLTCL1
1 |
1 |

No evidence text available
COPS6 affects CIB2
| 1
COPS6 inhibits CIB2. 1 / 1
| 1

reach
"By contrast, CSN6 knockdown impaired SKP2 mediated polybiquitylation of p57 Kip2."
COPS6 affects CDK9 ubiquitination
| 1
COPS6 inhibits CDK9 ubiquitination. 1 / 1
| 1

eidos
"In addition , to investigate whether CSN6 controls the ubiquitination and degradation of the E3 ligase UBR5 to stabilize CDK9 , in vivo ubiquitination assays were performed and found that CSN6 increased UBR5 ubiquitination levels and decreased CDK9 ubiquitination levels in melanoma cells and 293FT cells ( Fig. 5F , G ) ."
COPS6 affects CDK9 stability
| 1
COPS6 activates CDK9 stability. 1 / 1
| 1

eidos
"In summary , these results suggested that CSN6 improved CDK9 stability by elevating ubiquitin-mediated UBR5 degradation ."
COPS6 affects CDK4
1 |
1 |

No evidence text available
COPS6 affects CD8
| 1
COPS6 inhibits CD8. 1 / 1
| 1

eidos
"COPS6 promotes tumor progression and reduces CD8 + T cell infiltration by repressing IL-6 production to facilitate tumor immune evasion in breast cancer ."
COPS6 affects CD274
| 1
COPS6 increases the amount of CD274. 1 / 1
| 1

reach
"Inhibition of CSN6 by small interfering RNA decreased PD-L1 expression but also increased CHIP expression in GBM cells."
COPS6 affects CASP7
1 |
1 |

No evidence text available
COPS6 affects C1QBP
1 |
1 |

No evidence text available
COPS6 affects BACH2
1 |
1 |

No evidence text available
COPS6 affects ANXA1
1 |
1 |

No evidence text available
COPS6 affects AMOTL2
1 |
1 |

No evidence text available
COPS6 affects ACTB
1 |
1 |

No evidence text available
COPS6 affects 2-NBDG uptake
| 1
COPS6 activates 2-NBDG uptake. 1 / 1
| 1

eidos
"As CSN6-FOXO4 axis impacts on the expression of Glut1 , biochemical assays that quantitates the glucose uptake ( consumption ) by assessing uptake of ( 2 - ( N - ( 7-nitrobenz-2-oxa-1 ,3 - diazol-4-yl ) amino ) -2 - deoxyglucose ( 2-NBDG ) ) , a green fluorescent glucose analog , additionally demonstrated that CSN6 knockdown inhibited 2-NBDG uptake ( Figure 5G ) , while FOXO4 knockdown increased 2-NBDG uptake ( Figure 5H ) ."
COPS5 affects COPS6, GNPTAB, and PRSS27
| 1
| 1

sparser
"Moreover, we demonstrate that CSNAP, which is present at unit stoichiometry, tethers together the two distinct structural elements of the complex by mutually binding the MPN subunits, CSN5 and CSN6, and the PCI subunit CSN3."
| 1

sparser
"The core of the subcomplex is based on a stable heterotrimeric association of CSN7, CSN4, and CSN6, requiring coexpression in a bacterial reconstitution system."
1 |

No evidence text available

No evidence text available
COA1 affects COPS6
1 |
1 |

No evidence text available
CLTCL1 affects COPS6
1 |
1 |

No evidence text available
CHX affects COPS6
| 1
CHX activates COPS6. 1 / 1
| 1

reach
"When the cells were treated with EGF and cycloheximide (CHX), a protein synthesis inhibitor, EGF reduced CHX induced CSN6 and PD-L1 turnover in GBM cells."
CDK9 affects A375
| 1
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."
CDK4 affects COPS6
1 |
1 |

No evidence text available
CASP7 affects COPS6
1 |
1 |

No evidence text available
CARD16 affects FOXO4
| 1
| 1

sparser
"We found that CSN6, COP1, and FOXO4 form complexes dynamically under EGF stimulation as evidenced by coelution from a gel filtration experiment (Figure S3A, Supporting Information)."
CAGTTTGTGAACAAGTTCAAT affects COPS6
| 1
CAGTTTGTGAACAAGTTCAAT activates COPS6. 1 / 1
| 1

reach
"pGIPZ CSN6 short hairpin RNA (shRNA) was generated with the shCSN6-1 : CTTGAGAGAAACCGCTGTCAT and shCSN6-2 : CAGTTTGTGAACAAGTTCAAT oligonucleotides targeting the CSN6 transcript."
C1QBP affects COPS6
1 |
1 |

No evidence text available
BTRC affects COPS6
1 |
1 |

No evidence text available
BACH2 affects COPS6
1 |
1 |

No evidence text available
Akt signal affects COPS6
| 1
Akt signal activates COPS6. 1 / 1
| 1

eidos
"PKB / Akt signal activates CSN6 via phosphorylation to regulate FOXO4-mediated gene expression of SGOC network ."
Akt inhibitor affects COPS6
| 1
Akt inhibitor increases the amount of COPS6. 1 / 1
| 1

reach
"PI3K and Akt inhibitor L294002 reduced the S60 phosphorylation level of CSN6 and caused subsequent E6AP downregulation."
ANXA1 affects COPS6
1 |
1 |

No evidence text available
AMOTL2 affects COPS6
1 |
1 |

No evidence text available
ACTB affects COPS6
1 |
1 |

No evidence text available
A375 affects UBR5
| 1
UBR5 binds COPS6 and A375. 1 / 1
| 1

reach
"The E3 ubiquitin ligase UBR5 has shown the ability to ubiquitinate CDK9 38, so we hypothesized that CSN6 stabilizes the expression of CDK9 by regulating the E3 ligase UBR5.A co-IP assay was performed and demonstrated that CSN6 interacted with UBR5 in A375 and MV3 melanoma cells."
A375 affects CDK9, and COPS6
| 1
CDK9 binds COPS6 and A375. 1 / 1
| 1

reach
"A co-IP assay further validated that CSN6 interacted with CDK9 in A375 and MV3 melanoma cells."